Intron 2 of the alcohol dehydrogenase gene (Adh1-12) : a nuclear DNA marker for mammalian systematics

TEXAS TECH UNIVERSITY

Natural Science Research Laboratory

Occasional Papers

Museum of Texas Tech University

Number 256 27 July 2006

Intron 2 of the Alcohol Dehydrogenase Gene (Adh1-\2): A Nuclear
DNA Marker for Mammalian Systematics

Brian R. Amman, J. Delton Hanson, Lisa K. Longhofer,

Steven R. Hoofer, and Robert D. Bradley

Abstract

DNA sequences from a novel nuclear marker (2nd intron of the vertebrate alcohol dehydro¬
genase gene, Adh\-\2) and the mitochondrial cytochrome-/) gene ( Cyt-b ) were examined in 41
species and six genera of rodents (one Holochilus , 13 Neoloma , six Oryzomys , one Ototylomys,
19 Peromyscus , and one Tylomys). The Adh 1 -12 dataset was characterized by having a significant
level of phylogenetic signal (P< 0.01) and a low level of homoplasy (consistency index = 0.78,
retention index = 0.89), Based on parsimony, maximum likelihood, and Bayesian analyses, the
Adh\-\2 results were congruent with results from Cyt-b and other types of data, and generally
were accompanied by high statistical support. All phylogenetic relationships at and above the
genus level were strongly supported. Furthermore, compared with Cyt-b, the Adh 1-12 dataset
provided supported resolution to more species-level relationships within Neotoma, Peromyscus ,
and Oryzomys , despite fewer overall characters (489 Adh 1 -12; 1,143 Cyt-b ) and fewer parsimony
informative characters (126 Adh 1-12; 464 Cyt-b). Overall, results of this study indicated that
Adh\-\2 DNA sequences are useful for addressing phylogenetic relationships within and among
the Sigmodontinae andNeotominae. The slower rate of molecular evolution observed in Adh\-
12 sequences, coupled with low levels of homoplasy and strength of resolution for supraspecific
relationships, indicated that this marker may be useful for resolving phylogenetic relationships
at low to intermediate taxonomic levels in mammals.

Key words: alcohol dehydrogenase gene, cytochrome-/) gene, molecular systematics,
rodents

2

Occasional Papers, Museum of Texas Tech University

Introduction

The use of nucleotide sequence data has greatly
enhanced our knowledge of mammalian systematics. In
mammals, the majority of molecular-based phylogenies
have been estimated by analysis of maternally inherited,
mitochondrial DNA (mtDNA) sequences, especially
protein coding genes. Advantages in using mtDNA
sequences in phylogeny reconstruction include: tech¬
nical ease in DNA isolation and polymerase chain
reaction amplification, manageable sequence lengths
(generally <1,200 base pairs, bp), ease of alignment,
availability of “universal” primers, differential rates of
molecular evolution in specific regions of the molecule,
significant phylogenetic signal, and substantial data¬
bases (GenBank, EMBL, etc.) of comparative material.
However, there are drawbacks to mtDNA that can result
in a misrepresentation of the true phylogeny, includ¬
ing retention of ancestral polymorphisms, incomplete
lineage sorting, differential rates of evolution among
lineages, and hybridization (Avise 1994; Hillis et al.
1996; Prychitko and Moore 2000). Likewise, base
composition of mtDNA protein coding genes (excess of
C and A at the 3rd positions - Anderson et al. 1981; Roe
etal. 1985; Desjardins and Morais 1990; Prychitko and
Moore 2000; Ballard et al. 2002) may result in codon
bias and homoplasy (Prychitko and Moore 2000) lead¬
ing to a biased reconstruction of ancestral sequences
(Collins et al. 1994; Lockhart et al. 1994; Perna and
Kocher 1995). Although some of these drawbacks
can be addressed, nuclear DNA sequences are highly
desirable as an alternative dataset to independently
test mtDNA hypotheses and to essentially counteract
criticisms of mtDNA.

Historically, nuclear DNA sequences have been
used to address phylogenetic questions pertaining to
relationships above the genus level (e.g., rRNA genes
- Gouy and Li 1989; Perasso et al. 1989), principally
because nuclear sequence markers with levels of varia¬
tion suitable for resolving relationships among closely
related species or genera are scarcely known and have
been difficult to discover. Intron markers are an obvi¬
ous and likely source of nuclear variability suitable
for low- or intermediate-level phylogenetics. With the
exception of some conserved areas, such as regulatory
sites (Jackson and Hoffmann 1994), most nucleotide
positions within introns are adaptively neutral and

independently distributed and generally are evolv¬
ing faster than those within exons, thus increasing
their potential in population genetics or phylogenetic
analysis of closely related species (Ballard et al. 2002;
Prychitko and Moore 2000; Slade et al. 1994; Wick-
liffe et al. 2003). In addition, introns of various sizes
are relatively abundant in the nuclear genome, and
usually primer design in conserved areas of adjacent
exons enable efficient amplification across taxonomic
boundaries. In vertebrates, several introns have been
shown to be useful in studies at or below the genus
level (Prychitko and Moore 1997, 2000; Oakley and
Phillips 1999; Lavoue et al. 2003; Reeder and Bradley
2003; Johansson and Ericson 2004; Helbig et al. 2005),
and others have been shown to be relatively invariant
at or below the species level (Wickliffe et al. 2003;
Carroll and Bradley 2005). Alternatively, Fonseca et
al. (in press) and Porter et al. (in review) found intron
sequences useful for resolving relationships among
closely related species of bats.

The purpose of this study was to examine the
phylogenetic utility of DNA sequence data from the
2nd intron of the alcohol dehydrogenase gene 1 (Adh 1)
obtained for 41 species in six genera of rodents. Adh
genes, in mammalian systems, code for dimeric zinc-
metallo enzymes that catalyze oxidization of alcohols
to aldehydes or ketones (Szalai et al. 2002). Seven
distinct classes are recognized in vertebrates (Duester
et al. 1999; Dolney et al. 2001; Szalai et al. 2002), six
of which are present in mammalian species (Duester
et al. 1999; Szalai et al. 2002). In rodents, four Adh
classes (I, 11, III, and IV) have been reported (Crabb
and Edenberg 1986; Zhang et al. 1987; Park and Plapp
1991; Bradley et al. 1993, 1998; Duester et al. 1999;
Szalai et al. 2002) and are controlled by six genes,
Adh \, Adh2, Adh3, Adh4, AdhSa, andH<7/?5b (Duester et
al. 1999; Dolney et al. 2001; Szalai et al. 2002). Adh 1
is approximately 13 kilobase pairs in length (Crabb et
al. 1989), contains nine exons (coding between 6 and
87 amino acids) and eight introns (ranging from 91 bp
to 3.6 kilobase pairs; Zhang et al. 1987). Hereafter, in
referring to the 2nd intron, we follow the recommended
nomenclature (Adh [-12J of vertebrate alcohol dehydro¬
genases outlined in Duester et al. (1999).

Amman et al.-Alcohol Dehydrogenase and Mammalian Systematics

3

Materials and Methods

Specimens examined.- —Specimens examined,
GenBank accession numbers, and information associ¬
ated with museum vouchers are listed in Appendix I.
Complete sequences for Adh\-\2 and cytochrome-/)
( Cyt-b) were obtained for 41 individuals and 10 indi¬
viduals, respectively, and were deposited in GenBank.
In addition, 31 Cyt-b sequences were retrieved from
GenBank. Holochilus chacarius was designated as the
outgroup taxon in phylogenetic analyses of Adh\-\2
and Cyt-b data, as previous morphological and mo¬
lecular studies agree that Holochilus may be outside
the remainder of taxa in this study (reviewed in Musser
and Carleton 2005). Sequence data were evaluated
and relationships were inferred among the 40 ingroup
species (13 Neotoma, six Oryzomys , one Ototylomys,
19 Peromyscus, and one Tylomys) representing the
subfamilies Neotominae and Sigmodontinae (Musser
and Carleton 2005).

Adh7-/2 data. —Genomic DNA was isolated from
approximately 0.1 g frozen muscle or liver tissues by the
method of Smith and Patton (1999). Polymerase chain
reaction (PCR; Saiki et al. 1988) primers for Adh 1-12
(Table 1) were designed from conserved regions in
exons 2 and 3 based on sequences from Homo (Ikuta
et al. 1986), Geomys (Bradley et al. 1993, 1998), Mus
(Zhang et al. 1987), Peromyscus (Zheng et al. 1993),
and Rattus (Crabb et al. 1989). A nuclear fragment
approximately 650 bp long, encompassing the entire
Adh\-12, was amplified in all six generalising two for¬
ward primers (2340-1 or EXON 1I-F) and two reverse
primers (2340-11 or EXON III-R). PCR thermal profiles

varied only slightly among genera examined: initial
denaturation at 95°C for 2-10 min, followed by 25-30
cycles of denaturation at 95°C for 30-60 sec, annealing
ramped from 52-53°C down to 46-48°C and back up to
52-53°C at a rate of 0.6°C/sec, extension at 73°C for
1.5 min, and a final extension cycle of 73°C for 4 min.
Ramping speed between all three phases of PCR was
set at a rate of 1 °C/sec. Reaction concentrations (35 pi
volume) included approximately 300 ng genomic DNA,
0.07 mM dNTPs, 2.86 mM MgCl, 3.5 pi 10X buffer,
0.286 pM primer, and 1.25-1.5 U enzyme (FailSafe
PCR Enzyme Mix, Epicentre, Valencia, California).
In some reactions, 1.5 U AmpliTaq Gold (PE Applied
Biosystems, Foster City, California) was used with an
initial denaturation time of 10 min.

PCR products were purified using the QIAquick
PCR purification kit (Qiagen, Valencia, California) and
sequenced with Big-Dye version 3.1 chain terminators
(Applied Biosystems, Inc., Foster City, California).
Appropriate external primers and four internal prim¬
ers (350F, 350R, 41 OF, 41 OR; Table 1) were used to
sequence each strand entirely. Thermal profile for
cycle sequencing was modified from the manufacturer’s
recommendation: 25-30 cycles of 95°C for 30 sec dena¬
turation, 50°C for 20 sec annealing, and 60°C for 3 min
extension. Sequencing reactions were precipitated and
concentrated with standard isopropanol methods, re¬
suspended in 15ml Hi-Di Formamide, and electropho-
resed on an ABI31 00-Avant Genetic Analyzer (Applied
Biosystems, Inc., Foster City, California). Sequencher
3.0 software (Gene Codes, Ann Arbor, Michigan) was

Table 1. Primer sequences used in the polymerase chain reaction (PCR) amplification and sequencing
of the alcohol dehydrogenase locus. Sequences are given in a 5'to 3 ’orientation.

Primer

Sequence

2340-1 (5’PCR primer)

2340-11 (3’PCR primer)

EXON II-F(5’ PCR primer)

EXON III-R (3’PCR primer)

350F (internal sequencing primer)

350R (internal sequencing primer)

41 OF (internal sequencing primer)

41 OR (internal sequencing primer)

GTAATCAAGTGCAAAGCAGCTG

TAACCACGTGGTCATCTGAGC'G

GTAATCAAGTGCAAAGCRGCYYTRTGGGAG

GACTTTATCACCTGGTTTYACWSAAGTCACCCC

GTGCTAAACATCTTGATTCCRAAAG

GCTTTTGGAATCAAGATGTTTAG

CTATAGCACAGCACAGC

TGCTGTGCTGTGCTATAG

4

Occasional Papers, Museum of Texas Tech University

used to assemble and proof resultant fragments. Base
calling ambiguities on single strands were resolved
by choosing the call on the cleanest strand or by us¬
ing appropriate IUB ambiguity code if both strands
showed the same ambiguity.

Because provisional statements of homology
(i.e., sequence alignment) are of special concern for
non-coding DNA sequences possibly containing in¬
sertion/deletions (Giribet and Wheeler 1999), and be¬
cause many parameters can affect multiple-sequence
alignment and resulting phylogenetic inference (De-
Salle et al. 1994; Hickson et al 2000; Lutzoni et al.
2000; Wheeler 1995), two multiple-sequence align¬
ments ofzk//?l -I2 data were performed independently
in Clustal X software (Thompson et al. 1997): one
using a 30:4 gap cost-ratio, the other using a 5:4 gap
cost-ratio (Van Den Bussche and Hoofer 2001; Van
Den Bussche et al. 2002). Alignments subsequently
were examined using MacClade software (version
4.05; Maddison and Maddison 2002), ambiguously
aligned sites were delimited following methods of
Hoofer and Van Den Bussche (2003), and analyses
were performed with and without those sites.

Cyt-b data .—Sequences of the entire (1,143
bp) mitochondrial Cyt-b gene were obtained from
each of the 41 species to facilitate comparison to
the Adh 1-J2 data. PCR and sequencing primers,
conditions, and thermal profiles followed Edwards
and Bradley (2002) and Bradley et al. (2004a).
Sequence alignments were performed manually
and checked in MacClade software (version 4.05;
Maddison and Maddison 2002) to ensure there were
no insertions/deletions or stop codons in the protein¬
coding gene.

Data analysis .—Analyses were performed
in PAUP* 4.0b 10 software (Swofford 2002) or
MrBayes 2.01 software (Huelsenbeck and Ronquist
2001). Nucleotide positions were treated as unor¬
dered, discrete characters (A, C, G, and T), multiple
states as polymorphisms, and gaps as missing.
Nucleotide sequences from both Adh \-12 and Cyt-
b were evaluated four ways: 1) base frequencies,
number of transitions, number of transversions, and
number of substitutions per 100 bp were estimated
within and compared among the five ingroup genera;
2) levels of phylogenetic signal were estimated using

the -statistic (Hillis and Huelsenbeck 1992) for
100,000 randomly drawn trees; 3) genetic distances
(uncorrected “p”) were obtained and compared using
pairwise comparisons of taxa; and 4) maximum like¬
lihood, Bayesian likelihood, and parsimony analyses
were performed and compared among taxa.

Based on hierarchical likelihood ratio tests
(hLRTs) in Modeltest software (Posada and Cran¬
dall 1998), the following models of nucleotide
substitution and associated parameters best fit the
data: Adh\-\2 —Hasegawa-Kishino-Yano (HKY)
model with allowances for gamma distribution of rate
variation (G), ti/tv = 2.308, JtA = 0.301, JtC = 0.191,
jiG = 0.183, JtT = 0.325, a = 1.662; Cyt-b— general
time reversible (GTR) with allowances for G and
proportion of invariant sites (I), R A( = 1.310, R A( , =
10.479, R aT = 2.473, R C( . = 0.708, R ct = 32.137' JtA
= 0.375, JtC = 0.343, jtG = 0.079, JtT = 0.203, a =
0.687, p - 0.456. The HKY + G model best fit the
Adh 1 -12 data with and without ambiguous characters,
although specific model parameters differed slightly;
Adh\-\2 values reported were calculated without
ambiguous characters.

Bayesian analyses were run at least two mil¬
lion generations with four Markov-chains, random
starting trees for each chain, and trees sampled
every 100th generation. For each data set, two
independent analyses were run to assess whether
chains converged on the same posterior probability
distribution and whether likelihood values became
stable (Huelsenbeck et al. 2002). Model parameters
were treated as unknown variables (with uniform
priors) to be estimated in each Bayesian analysis
(Leache and Reeder 2002). Burn-in values (initial
set of unstable generations to be ignored) were based
on empirical evaluation of likelihoods converging
on stable values. Clade reliabilities were assessed
using posterior probabilities (values > 0.95 regarded
as significant).

Maximum likelihood analyses were performed
with full heuristic searches, neighbor-joining start¬
ing trees, and tree-bisection-reconnection branch
swapping. Parsimony analyses, with all characters
and substitution types given equal probabilities (i.e.,
unweighted), were conducted with full heuristic
searches with 10 random additions, starting trees

Amman et al.-Alcohol Dehydrogenase and Mammalian Systematics

5

by simple addition, and tree-bisection-reconnection
branch swapping. Clade reliabilities were assessed
in parsimony analyses using bootstrapping methods
with 250 iterations (Felsenstein 1985). Due to pro¬

hibitive computation time under maximum likelihood,
bootstrapping was performed for 100 iterations for just
the Adh 1-12 dataset (100 iterations). Values > 70 were
regarded as strong support.

Results

Adh/-/2 data .—Complete sequence of Adh 1-
12 averaged 530 bp for the 41 rodents examined,
ranging from 494 ( Holochitm) to 576 (Peromyscus
califoniicus). Alignment of sequences resulted in 614
aligned sites (125 ambiguously aligned) with the 5:4
gap cost-ratio, and 607 aligned sites (133 ambiguously
aligned) with the 30:5 gap cost-ratio, corresponding
to the insertion of more gaps with a lower cost ratio.
As results from all subsequent analyses, phylogenetic
analyses in particular, essentially were identical regard¬
less of alignment and with and without the ambiguously
aligned characters excluded, only results based on the
5:4 alignment with 125 ambiguous characters removed
are reported and discussed.

After removing 125 ambiguous characters, 489
characters were available for analysis, of which 260
were constant and 126 were parsimony informative.
Overall nucleotide frequencies varied slightly among
the three genera (Table 2), averaging 30.47% (A),
17.51% (C), 17.94% (G), and 34.08% (T). The transi¬
tion to transversion ratio was approximately 2.28 to l.
The number of heterozygous sites ranged from zero
(37 taxa) to three (N. Stephensi, N. mexicana, and O.
perenensis ), with a mean heterozygosity of 0.34 per
taxon. The g ( statistic was skewed significantly left

(-0.65; P< 0.01), indicating strong phylogenetic signal
(Hillis and Huelsenbeck 1992).

Cyt-b data .—^Complete sequences of Cyt-h (1,143
bp) were included for the 41 rodents examined herein.
Sequence alignment was unequivocal and contained no
stop codons. Of the 1,143 characters, 589 were constant
and 475 parsimony informative. Nucleotide variation
was distributed across codon positions as expected for
protein-coding genes (1st position, 111; 2nd position,
37; 3rd position, 327). Overall nucleotide frequen¬
cies varied slightly among the three genera (Table 2),
averaging 31.67% (A), 28.15% (C), 12.45% (G), and
27.74% (T), and transition to transversion ratio was
approximately 2.68 to 1. Theg, statistic was skewed
significantly left (-0.49; P < 0.01), indicating strong
phylogenetic signal (Hillis and Huelsenbeck 1992).

Phylogenetic analyses .—For ^4^/71 -12 and Cyt-b ,
Bayesian likelihoods reached stability before 100,000
generations (i.e., bum-in = 1,000), thinning the data to
19,000 sample points. Topology and posterior prob¬
abilities for nodes and model parameters for all sets of
runs agreed. Maximum likelihood analysis resulted in
a single best tree for both Adh\-\2 (Lnl = -2,718.63)
and Cyt-b (Lnl = -14,379.92) data sets (Figs. 1 and 2).

Table 2. Nucleotide base composition (A, C, G, and T), number of transition substitutions per 100 bp (#Ti/100 bp),
number of transversion substitutions per 100 bp (#Tv/l 00 bp), and the uncorrected p distance (p Dist) for the 3 genera
possessing multiple taxa. All values were averaged across taxa within each of the 3 genera for intron 2 of the alcohol
dehydrogenase locus (AdhJ-I2) and the mitochondrial cytochrome-b gene (Cyt-b).

Taxon/Sequence

% A

%C

% G

% T

# Ti/100 bp

# Tv/100 bp

p Dist

Peromyscus Adh\-\2

30.16

17.48

18.58

33.77

2.31

1.09

3.41%

Peromyscus Cyt-b

31.72

27.45

12.62

28.21

8.38

2.79

12.29%

Neotoma Adh 1 -12

30.35

17.73

17.59

34.33

1.67

0.50

2.22%

Neotoma Cyt-b

32.24

28.93

12.43

26.40

8.73

2.90

11.61%

Oryzomys Adh\-\2

31.34

17.33

16.97

33.37

4.48

2.10

6.70%

Oiyzomys Cyt-b

31.16

28.43

11.98

28.43

7.73

5.75

14.00%

6

Occasional Papers, Museum of Texas Tech University

Parsimony analysis resulted in 62 most-parsimonious
trees (length = 363, Cl = 0.78, RI = 0.89) and a single
most-parsimonious tree (length = 3,321, Cl = 0.28, RI
= 0.48) for Adh 1-12 and Cyt-b, respectively.

There were some topological differences within
and between datasets and between the three optimality
criteria, although only one difference between datasets
represented a statistically supported conflict (i.e., > 70%
bootstrap value, > 0.95 Bayesian posterior probability).

This conflict involved the sister species relationships
of N. albigula , N. leu codon, and N. micropus. Adh 1-12
supported a N. albigula/N. 1eucodon sister relationship,
whereas Cyt-b supported a N. leucodon/N. micropus
sister relationship (Figs. 2 and 3). Overall, statistically
supported topologies obtained from all optimality cri¬
teria agreed within and between datasets, supporting
monophyly of Neotoma and Peromyscus and diphyly
o f Oryzo mys (Fig. 3).

Discussion

Results of this study indicated that Adh 1 -12 DN A
sequences are useful for addressing phylogenetic re¬
lationships within and among the Sigmodontinae and
Neotominae. Based on the g statistic and consistency
and retention indices, the Adh 1 -12 dataset had a greater
overall phylogenetic signal and less homoplasy than
the Cyt-b dataset. Adh 1 -12 sequences also provided
statistically supported resolution to slightly more re¬
lationships than Cyt-b (Fig. 3). For example, Adh 1 -12
strongly supported all relationships examined at and
above the genus level, including monophyly of Neo¬
toma and Peromyscus and a sister relationship between
Ototylomys and Tylomys , relationships that have been
documented repeatedly by analysis of morphological
and DN A sequence data (Carleton 1980; Bradley et al.
2004b; Edwards and Bradley 2002; Reeder and Bradley
2004, in press a and b). Adh 1-12 supported a diphyletic
origin for Oryzo mys, a relationship also supported by
Cyt-b and recent studies of nuclear markers (Myers and
Tucker 1995; Smith and Patton 1993; Weksler 2003).

It is particularly noteworthy that, compared with
Cyt-b , the Adh\-\2 dataset provided supported resolu¬
tion to more species-level relationships within Neoto¬
ma , Peromyscus , and Oryzomys (Fig. 3), despite fewer
overall characters (489 Adh 1-12, 1,143 Cyt-b) and fewer
parsimony informative characters (126 Adh\-\2, 464
Cyt-b). Furthermore, all but one of the species-level
relationships were congruent with results from Cyt-b.
The exception involved the sister species relationships
of N. albigula, N. Ieucodon , and N. micropus , and per¬
haps represented a situation of misleading phylogenetic
inference. Whereas Adh 1-12 analysis provided strong
support for a sister relationship between N. albigula

and N. leucodon (parsimony, 98%; maximum likeli¬
hood, 94%; Bayesian, 100%), Cyt-b analysis strongly
supported a sister relationship between N. leucodon and
N. micropits (parsimony, 86%; Bayesian, 100%). The
difference, however, is thatA/M -I[2 support was based
on three characters, whereas Cyt-b support was based
on 22 characters. We view these particular Adh 1-12
results with caution, and suggest additional study of
nuclear markers will be necessary to help determine
whether Adh 1-12 results accurately reflect a conflict
between the mitochondrial and nuclear genomes or
represents the case of misleading inference of relation¬
ship due to inadequate variability.

Overall, the Adhi- 12 results are congruent with
results from Cyt-b and other types of data, and gener¬
ally are accompanied by high statistical support. Fur¬
thermore, multiple sequence alignment, which can be
problematic with non-coding DNA sequences (Giribet
and Wheeler 1999; Hoofer and Van Den Bussche 2003;
Van Den Bussche et al. 2002), was not of particular
concern in this study. Although we identified 125
ambiguously aligned characters in the 5:4 alignment
and 133 in the 30:5 alignment, results from analysis
of both alignments with and without the ambiguous
characters were identical in topology and statistical
support. Thus, most of the phylogenetic signal in the
Adh\-\2 dataset was associated with polymorphisms
(nucleotide substitutions) rather than insertions/dele¬
tions. Yet, some insertion/deletions were informative.
For example, a 5 bp (nucleotide positions 335-339) and
a 4 bp (nucleotide positions 487-490) insertion/deletion
were present in species of Oryzomys and Holochilus
but absent in Neotoma and Peromyscus. Similarly, a 17

Amman et al.—Alcohol Dehydrogenase and Mammalian Systematics

7

Adh 1-12

— 0.01 substitutions/site

O. albigularis

— O. perenensis

— O. melanotis

— O. alfaroi

O. couesi
0. palustris
Holochilus

■ P. attwateri
— P. difficilis

L P. gratus
|— P. melanophrys
. *— P. perfulvus
*— P. megalops

- P. beatae
P. boylii

_ - P. hylocetes

- P. levipes

- P. schmidlyi
L P. spicilegus

- P. californicus
-P. eremicus

— P. leucopus
-P. maniculatus

— P crinitus
— P. mexicanus
— P. pectoralis
r A/, leucodon
'— A/, albigula
' — N. mexicana
— N. goldmani
j— N. floridana

_ ' N. magister

— N. micropus
j— N. picta
' N. Isthmica
N. Stephensi

I- N. fuscipes

N. cinerea
*— N. lepida

Ot. phyllotis
- T. nudicaudus

Figure 1, Maximum likelihood phylogram (Lnl -2,718.627) from analysis of 5:4 gap cost-ratio alignment
of complete A dh \-12 sequences (489 base pairs; 614 aligned sites minus 125 ambiguously aligned sites)
using best-fit model (HKY + G; ti/tv = 2.308, jiA = 0.301, jtC = 0.191, jtG = 0.183, JtT = 0.325, a =
1,662). Holochilus was the designated outgroup. N. = Neotoma. O. ~ Oryzomys. Of. Ototylomys,
P. = Peromyscus. T = Tylomys.

8

Occasional Papers, Museum of Texas Tech University

Cyt-b

— 0.05 substitutions/site

N. floridana
N. magister
pj 1 — N. albigula

- N. goldmani

N. leucodon
N. micropus
r~ N. picta
L^— N. isthmica
— N. mexicana
- N. cinerea

t_ N

— N. stephensi
■ N. fuscipes

■ N. lepida

— Ot. phyllotis
■ T. nudicaudus

- P. leucopus
P. maniculatus
I - P. melanophrys
P. perfulvus
— P. mexicanus

t'

P. megalops
P. attwateri
P. difficilis
P. pectoralis
r P. beatae
L P. levipes
P. schmidlyi
■ P. boylii
j - P. hylocetes
— P. spicilegus
— P. gratus
~P. californicus

■ P. eremicus

■ P. crinitus

— O. alfaroi

— O. melanotis
O. perenensis

— O. albigularis
I O. couesi
O. palustris
■ Holochilus

Figure 2. Maximum likelihood phylogram (Lnl -14,379.922) from analysis of complete Cyt-b
sequences (1,143 base pairs) using best-fit model (GTR + G + I; R M , = 1.310, R Afi = 10.479, R A1
- 2.473, R ( ,. = 0.708, R rT = 32.137, JtA = 0.375, jrC - 0.343, jtG - 0.079. JtT = 0.203, a = 0.687,

7 lO C7

p w ~ 0.456). Holochilus was the designated outgroup. N. ^ Neotoma. O. ~ Oryzomys. Ot. =*
Ototylomys. P. = Peromyscus. T. =- Tylomys.

Amman et al.—Alcohol Dehydrogenase and Mammalian Systematics

9

P. beatae
P. levipes
P. schmidlyi
P. boylii
P. hylocetes
P. spicilegus
P. attwateri
P. difficilis
P. gratus
P. megalops
P. melanophrys
P. perfulvus
P. mexicanus
P. californicus
P. eremicus
P. leucopus
P. maniculatus
P. pectoralis
P. crinitus

N. goldmani
N. magister
N. floridana
N. albigula
N. leucodon
N. micropus
N. fuscipes
N. cinerea
N. lepida
N. mexicarta

N. picta
N. isthmica

N. stephensi

Ot. phyllotis
T. nudicaudus

O, albigularis
O. perenensis
O. melanotis

O. alfaroi

O. couesi
O. palustris

Holochilus

Figure 3. Cladograms from phylogenetic analyses of complete ^<^1-12 (left) and Cyt-b (right) DNA sequences.
Holochilus was the designated outgroup. In order, numbers above and below nodes are bootstrap proportions (250
iterations) from parsimony analysis, bootstrap proportions (100 iterations) from maximum likelihood analysis, and
posterior probability proportions from Bayesian analysis, Maximum likelihood bootstrapping was feasible only for
Adh\-\2 data. Only nodes with >70% bootstrap support or >0.95 posterior probabilities, or both, are shown. Vertical
dotted line indicates sister relationship between N. micropus and clade of A’, floridana + N. magister. N. = Neotoma .
O. = Oiyzomys. Ot. = Ototylomys. P. = Peromyscus. T. = Tylomys.

10

Occasional Papers, Museum of Texas Tech University

bp insertion/deJetion (nucleotide positions 502-518)
was present in Neotoma and Pero my setts but was ab¬
sent in Oryzomys and Holochilus. These results are
encouraging toward the goal of recovering reliable
phylogenetic relationships at low and intermediate

taxonomic levels from a nuclear intron. Further
study of this intron, along with other nuclear and
mitochondrial markers, should aid our understand¬
ing of the phyletic limitations of Adh\-Y2 as well as
organismal genealogy.

Acknowledgments

Thanks to B. Dnate Baxter, Nevin D. Durish,
Michelle L. Haynie, Dallas D. Henson, Lindsey D.
Porr, Andrew O. Stallings, Ryan R. Chambers, and two
anonymous reviewers for providing helpful comments
on previous versions of this manuscript. Thanks to

Robert J. Baker for use of laboratory equipment and
computers during various stages of this study. This
research was supported by a grant from the National
Institutes of Health (DHHS A141435-01 to RDB).

Literature Cited

Anderson, S., A, T. Bankier, B. G. Barrell, M. H. de Bruijn, A.

R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlicj,
B. A. Roe, F. Sanger, P. H, Schreier, A. J. Smith,
R. Staden, and 1. G. Young. 1981. Sequence and
organization of the human mitochondrial genome.
Nature 290:457-465.

Avise, J. C. 1994. Molecular markers, natural history, and
evolution. Chapman and Hall, New York.

Ballard, J, W., B. Chernoff, and J. C. Avise. 2002. Diver¬
gence of mitochondrial DNA is not corroborated
by nuclear DNA, morphology, or behavior in Dro¬
sophila simulam. Evolution 56:527-545.

Bradley, R. D., J. J. Bull, A. D. Johnson, and D. M. Hillis.

1993. Origin of a novel allele in a mammalian
hybrid zone. Proceedings National Academy of
Science 90:8939-8941.

Bradley, R. D., R. M. Adkins, R. L. Honeycutt, and J. H.
McDonald. 1998. Nucleotide polymorphism at
the alcohol dehydrogenase locus of pocket gophers,
genus Geomys. Molecular Biology and Evolution
15:709-717.’

Bradley, R. D., D, S, Carroll, M. L. Haynie, R. Muniz-
Martinez, M. J. Hamilton, and C. W. Kilpatrick.
2004a. A new species of Peromyscus from western
Mexico. Journal of Mammalogy 85:1184-1193.

Bradley, R. D., C. W. Edwards, D. S. Carroll, and C. W.

Kilpatrick. 2004b. Phylogenetic relationships of
Neotomine-Peromyscine rodents: based on DNA
sequences from the mitochondrial cytochrome h
gene. Journal of Mammalogy 85:389-395.

Carleton, M. D. 1980. Phylogenetic relationships in ne-
otomine-peromyscine rodents (Muridae) and a
reappraisal of the dichotomy within New World
cricetinae. Miscellaneous Publications, Museum of
Zoology, University of Michigan 157:1-146.

Carroll, D. S., and R. D. Bradley. 2005. Systematics of
the genus Sigmodon: DNA sequences from beta-
fibrinogen and cytochrome-6. The Southwestern
Naturalist 50:342-349.

Collins, T., P H. Wimberger, and G. J. P. Naylor. 1994.
Compositional bias, character-state bias, and
character-state reconstruction using parsimony.
Systematic Biology 43:482-496.

Crabb, D, W., and H. J. Edenberg. 1986. Complete amino
acid sequence of rat liver alcohol dehydrogenase
deduced from the cDNA sequences. Gene 48:287-
292.

Crabb, D. W., P. M. Stein, K. M. Dipple, R. Sidhu, K. Zhang,
and H. J. Edenberg. 1989. Structure and expres¬
sion of the Rat Class I alcohol dehydrogenase gene,
Genomics 5:906-914,

DeSalle, R., C. Wray, and R. Absher. 1994. Computational
problems in molecular systematics. Pp. 353-370
in Molecular ecology and evolutions: Approaches
and applications (B. Schierwater, B. Streit, G. P
Wagner, and R. DeSalle, eds.). Birkhauser Verlag
Basel, Switzerland.

Desjardins, P, and R. Morais. 1990. Sequence and gene
organization of chicken mitochondrial genome.
Journal of Molecular Biology 212:599-634.

Amman et al.-Alcohol Dehydrogenase and Mammalian Systematics

11

Dolney, D. E. A., G. Szalai, G. Duester, and M. R. Felder.
2001. Molecular analysis of genetic differences
among inbred mouse strains controlling tissue
expression pattern of alcohol dehydrogenase 4.
Gene 267:145-156.

Duester, G., J. Farres, M. R, Felder, R. S. Flolmes, J. Hoog,
X. Pares, B. V. Plapp, S. Yin, and H. Jdmvall. 1999.
Recommended nomenclature for the vertebrate
alcohol dehydrogenase gene family. Biochemical
Pharmicology 58:389-395.

Edwards, C. W. and R. D. Bradley. 2002. Molecular sys-
tematics of the genus Neotoma. Molecular Phylo¬
genetics and Evolution 25:489-500.

Felsenstein, J. 1985. Confidence limits on phylogemes:
An approach using the bootstrap. Evolution
39:783-791.

Fonseca, R.M, S.R. Hoofer, C.A. Cline, D.A. Parish, F.G.
Hoffmann, C.A. Porter, and R.J. Baker. In press.
Comments on the morphological variation in dark-
bellied species of Micronycteris (Phyllostomidae:
Micronycterinae), with description of a new spe¬
cies from northwestern Ecuador. Pp. xxx-xxxx in
The quintessential naturalist: honoring the life and
legacy of Oliver P. Pearson (D.A. Kelt, E, Lessa,
J. A. Salazar-Bravo, and J.L. Patton, eds.). Univer¬
sity of California Press.

Giribet, G., and W. C. Wheeler. 1999. On gaps. Molecular
Phylogenetics and Evolution 13:132-143.

Gouy, M., and W.-H. Li. 1989. Phylogenetic analysis based
on rRNA sequences supports the archaebacterial
rather than the eocyte tree. Nature 339:145-147.

Hafner, M. S., W. L. Gannon, J. Salazar-Bravo, and S. T.
Alvarez-Castaneda. 1997. Mammal collections
in the western hemisphere: a survey and directory
of existing collections. Allen Press, Lawrence,
Kansas.

Helbig, A. J., A. Kocum, I. Seibold, and M. J. Braun. 2005.

A multi-gene phylogeny of aquiline eagles (Aves:
Accipitriformes) reveals extensive paraphyly at the
genus level. Molecular Phylogenetics and Evolu¬
tion 35:147-164.

Hickson, R, E., C. Simon, and S. W. Perrey. 2000. The
performance of several multiple-sequence align¬
ment programs in relation to secondary-structure
features for an rRNA sequence. Molecular Biology
and Evolution 17:530-539.

Hillis, D. M., C. Moritz, and B. K. Mable. 1996. Molecular
systematics (D. M, Hillis, C. Moritz and B. K.
Mable, eds.) Second edition. Sinauer and Associ¬
ates, Sunderland, Massachusetts,

Hillis, D. M., and J. P. Huelsenbeck. 1992. Signal, noise,
and reliability in molecular phylogenetic analyses.
Journal of Heredity 83:189-195.

Hoofer, S. R., and R. A. Van Den Bussche. 2003. Mo¬
lecular phylogenetics of the chiropteran family
Vespertilionidae. Acta Chiropterologica 5 (supple¬
ment): 1-63.

Huelsenbeck, J. P., and F. Ronquist. 2001. Mr.Bayes:

Bayesian inference of phylogeny. Bioinformatics
17:754-755.

Huelsenbeck, J. P., B. Larget, R. E. Miller, and F. Ronquist.
2002. Potential applications and pitfalls of Bayes¬
ian inference of phylogeny. Systematic Biology
51:673-688.

Ikuta, E., S. Szeto, and A. Yoshida. 1986. Three human
alcohol dehydrogenase subunits: cDNA structure
and molecular and evolutionary divergence. Pro¬
ceedings of the National Academy of Sciences
83:634-638.

Jackson, P. D., and F. M. Hoffmann. 1994. Embryonic ex¬
pression patterns of the Drosophila decapentaplegic
gene: separate regulatory elements control blasto¬
derm expression and lateral ectodermal expression.
Developmental Dynamics 199:28-44.

Johansson, U. S., and P. G. P. Ericson. 2004. A re-evalu¬
ation of basal phylogenetic relationships within
trogons (Aves: Trogonidae) based on nuclear DNA
sequences. Journal of Zoological Systematics and
Evolutionary Research 43:166-173.

Lavoue, S., J. P. Sullivan, and C. D. Hopkins. 2003. Phy¬
logenetic utility of the first two introns of the S7
ribosomal protein gene in African electric fishes
(Mormyroidea: Teleostei) and congruence with
other molecular markers. Biological Journal of
the Linnean Society 78:273-292,

Leache, A. D., and T. W. Reeder. 2002. Molecular sys¬
tematics of the eastern fence lizard (Sceloporus
undidatiis): a comparison of parsimony, likelihood,
and Bayesian approaches. Systematic Biology
51:44-68.

Lockhart, P. J., M. A. Steel, M. D. Hendy, and D. Penny.

1994. Recovering evolutionary trees under a more
realistic model of sequence evolution. Molecular
Biology and Evolution 11:605-612.

Lutzoni, F., P. Wagner, V. Reeb, and S. Zoller. 2000. In¬
tegrating ambiguously aligned regions of DNA
sequences in phylogenetic analyses without vio¬
lating positional homology. Systematic Biology
49:628-651.

12

Occasional Papers, Museum of Texas Tech University

Maddison, D. R., and W. P. Maddison. 2002. MacClade 4
(version 4.05). Sinauer Associates, Sunderland,
Massachusetts.

Musser, G. G., and M. D. Carleton. 2005. Superfamily
Muroidea. Pp. 894-1531 in Mammal species of
the world: a taxonomic and geographic reference.
Third edition (D. E. Wilson and D. M. Reeder, eds.).
The Johns Hopkins University Press, Baltimore,
Maryland. 2 vols.

Myers, P., B. Lundrigan, and P. K. Tucker. 1995. Molecular
phylogenetics of oryzomyine rodents: the genus
Oligoiyzomys. Molecular Phylogenetics and Evo¬
lution 4:372-382.

Oakley, T. H., and R. B. Phillips. 1999. Phylogeny of sal-
monine fishes based on growth hormone introns:
Atlantic ( Salmo) and Pacific ( Oncorhynchus)
salmon are not sister taxa. Molecular Phylogenetics
and Evolution 11:381-393.

Park, D. H., and B. V. Plapp. 1991. Isoenzymes of horse
liver alcohol dehydrogenase active on ethanol and
steroids. cDNA cloning, expression, and compari¬
son of active sites. Journal of Biological Chemistry
266:13296-13302.

Perasso, R., A. Baroin, L.H. Qu, J. Bachellerie, and A.

Adoutte. 1989. Origin of the algae. Nature
339:142-144.

Pema, N. T., and T. Kocher. 1995. Unequal base frequen¬
cies and estimation of substitution rates. Molecular
Biology and Evolution 12:359—361.

Porter, C. A., S. R. Hoofer, C. A. Cline, F. G. Hoffmann, and
R. J. Baker. In review. Molecular phylogenetics of
the genus Micronycteris (Phyllostomidae: Micro-
nycterinae) with description of 2 new subgenera.
Journal of Mammalogy.

Posada, D. and K. A. Crandall. 1998, MODELTEST: testing
the model of DNA substitution. Bioinformatics
14:817-818.

Prychitko, T. M., and W. S. Moore. 1997. The utility of
DNA sequences of an intron from the beta-fibrino¬
gen gene in phylogenetic analysis of woodpeckers
(Aves: Picidae). Molecular Phylogenetics and
Evolution 8:1993-204.

Prychitko, T. M., and W. S. Moore. 2000. Comparative
evolution of the mitochondrial cytochrome b gene
and nuclear b-fibrinogen intron 7 in woodpeckers.
Molecular Biology and Evolution 17:1101-1 111.

Reeder, S. A., and R. D. Bradley. 2004. Molecular System-
atics of Neotomine-Peromyscine Rodents Based
on the dentin matrix protein 1 gene. Journal of
Mammalogy 85:1194-1200.

Reeder, S. A., and R. D. Bradley. In Press a. Phylogenetic
relationships of Neotomine-Peromyscine rodents
using DNA sequences from intron 7 of the beta
fibrinogen gene. Pp. xxx-xxx in The quintessential
naturalist: honoring the life and legacy of Oliver P
Pearson (D. A. Kelt, E. Lessa, J. L. Patton, and J.
A. Salazar-Bravo eds.). University of California
Publications in Zoology.

Reeder, S, A., C. W. Edwards, D. S. Carroll, and R. D. Brad¬
ley. In Press b. Neotomine-Peromyscine rodent
systematics based on combined analyses of nuclear
and mitochondrial DNA sequences. Molecular
Phylogenetics and Evolution.

Roe, B. A., D.-P. Ma, R. K. Wilson, and J. F.-H. Wong. 1985.

The complete nucleotide sequence of the Xenopus
laevis mitochondrial genome. Journal of Biological
Chemistry 260:9759-9774.

Saiki, R. K„ D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Hi-
guchi, G. T. Horn, K. B, Mullis, and H. A. Erlich.
1988. Primer-directed enzymatic amplification of
DNA with a thermostable DNA polymerase. Sci¬
ence 239:487-491.

Slade, R. W., C. Moritz, and A. Heideman. 1994. Multiple
nuclear-gene phylogenies: applications to pinnipeds
and comparisons with a mitochondrial DNA gene
phylogeny. Molecular Biology and Evolution
11:341-356.

Smith, M. F., J. L. Patton. 1993. The diversification of
South American murid rodents: evidence from mi¬
tochondrial DNA sequence data for the akodontine
tribe. Biological Journal of the Linnean Society
50:149-177.

Smith, M. F., and J. L. Patton. 1999. Phylogenetic relation¬
ships and the radiation of sigmodontine rodents
in South America: evidence from cytochrome b.
Journal of Mammalian Evolution 6:89-128.

Swofford, D. L. 2002. PAUP*: phylogenetic analysis using
parsimony (*and other methods) version 4.0b 10.
Sinauer Associates, Sunderland, Massachusetts.

Szalai, G., G. Duester, R. Friedman, H. Jia, S. Lin, B. A,
Roe, and M. R. Felder. 2002. Organizations of six
functional mouse alcohol dehydrogenase genes on
two overlapping bacterial artificial chromosomes.
European Journal of Biochemistry 269:224-232.

Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jean-mougin,
and D. G. Higgins. 1997. The Clustal X window
interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic
Acids Research 25:4876-4882.

Amman et al.-Alcohol Dehydrogenase and Mammalian Systematics

13

Van Den Bussche, R. A., and S. R, Hoofer. 2001. Evaluat¬
ing monophyly of Nataloidea (Chiroptera) with
mitochondrial DNA sequences. Journal of Mam¬
malogy 82:320-327.

Van Den Bussche, R. A., S. R. Hoofer, and E. W. Hansen.
2002. Characterization and phylogenetic utility
of the mammalian protamine PI gene. Molecular
Phylogenetics and Evolution 22:333-341.

Weksler, M. 2003. Phylogeny of neotropical oryzomyine
rodents (Muridae: Sigmodontinae) based on the
nuclear IRBP exon. Molecular Phylogeny and
Evolution 29:331-349.

Wheeler, W. C, 1995. Sequence alignment, parameter sen¬
sitivity, and the phylogenetic analysis of molecular
data. Systematic Biology 44:321-331.

Addresses of authors:

Addresses for Brian R. Amman, J. Delton Hanson,
Lisa K. Longhofer, Steven R. Hoofer, and Robert D.
Bradley:

Department of Biological Sciences
Texas Tech University
Lubbock, Texas 79409-3131
BRA e-mail: bamman@cdc.gov
JDH e-mail: j delton. hanson@ttu. edu
LKL e-mail: brombel4@hotmail.com
SRH e-mail:srhoofer@hotmail. com
RDB e-mail: robert.bradley@ttu.edu

Current Address for Brian R. Amman:

Centers for Disease Control and Prevention
Division of Viral and Rickettsial Diseases
Special Pathogens Branch
Atlanta, GA 30333

Wicldiffe, J. K„ F. G. Hoffmann, D. S. Carroll, Y. V. Dunina-
Barkovskaya, R. D. Bradley, and R. J. Baker. 2003.
Intron 7(Fgb-17) of the fibrinogen, B beta polypep¬
tide (Fgb): a nuclear DNA phylogenetic marker for
mammals. Occasional Papers, Museum of Texas
Tech University 219:i+1 -6.

Zhang, K., W. F. Bosron, and H. J. Edenberg. 1987. Struc¬
ture of the mouse Adh -1 gene and identification of
a deletion in a long alternating purine-pyrimidine
sequence in the first intron of strains expressing low
alcohol dehydrogenase activity. Gene 57:27-36.

Zheng, Y.-W., M. Bey, H. Liuand, and M. R. Felder. 1993.

Molecular basis of the alcohol dehydrogenase-neg¬
ative deer mouse. Journal of Biological Chemistry
268:24933-24939.

Current Address for Lisa K. Longhofer:

Texas Tech University Health Sciences Center
Texas Tech University
Lubbock, Texas 79409

Address for Robert D. Bradley:

Department of Biological Sciences and
Museum of Texas Tech University
Lubbock, Texas 79409-3191

14

Occasional Papers, Museum of Texas Tech University

Appendix I

Specimens examined. — Collection localities, museum acronyms, and GenBank accession numbers are
provided for each specimen examined in this study. Specimens are from the United States unless otherwise noted.
Abbreviations for museum acronyms (in parentheses and to the left of the semicolon) follow Hafner et al. (1997):
Abilene Christian University Natural History Collection (ACUNHC), Angelo State University Museum Natural
History Collections (ASNHC), Monte L. Bean Life Science Museum (BYU), Texas Cooperative Wildlife Col¬
lection (TCWC), Museum of Texas Tech University (TTU), The Museum of Southwestern Biology (MSB), and
Universidad Nacional Autonoma de Mexico (UNAM). If museum catalogue numbers were unavailable, specimens
were referenced with the corresponding TK number ( special number of the Museum of Texas Tech University).
GenBank accession numbers (AF, AY, U, and DQ) for Adh 1-12 and Cyt-b are provided in parentheses to the right
of the semicolon and separated by a comma, respectively.

Holochilus chacarius. —PARAGUAY: Department Pte. Hayes; Estancia Loma Pora, 23°33.15’S, 57°34.3’W (TTU104423;
DQ227456, DQ227455).

Neotoma albigula. —New Mexico; Yuma Co., 3.7 km S, 5.6 km W Somerton, UTM 11 708569E 3608362N (TTU78451; AY817648,
AF376477).

Neotoma cinerea. —Utah; San Juan Co., Owaehamo Bridge (MSB 121427; AY817635, AF 186799).

Neotoma fioridana. —South Carolina; Richland Co.. Congaree Swamp National Monument, 33°49’N, 80°50’W (MSB74955;
AY817637, AF294335).

Neotoma fuscipes. —California; Riverside Co., Rancho Capistrano (Ortega Mountains) (TTU81391, AY817632, AF376479).

Neotoma goldmani. —MEXICO: Nuevo Leon; 1 km S Providencia (TTU45227; AY817656, AF 186829).

Neotoma isthmica — MEXICO: Oaxaca; Las Minas, UTM 15 191165E 1824954N (TTU82665; AY817630, AF329079).

Neotoma lepida. —California; Orange Co., Irvine Lake, 1.3 km E Fremont Canyon on Lake View access road (TTU79131; AY817633,
AF307835).

Neotoma leucodon. —Texas; Kerr Co., Kerr Wildlife Management Area, UTM 14 452336E 3330772N (TTU71198; AY817643,
AF 186806).

Neotoma magister .— Virginia; Madison Co., Shenendoah National Park, White Oak Canyon, 38°34’36”N, 78 o 22’30”W (MSB74952;
AY817641, AF294336).

Neotoma mexicana .— Texas; Jeff Davis Co., Mount Livermore Preserve, UTM 13 579953E 3389871N (TTU101643; AY817645,
AF294346).

Neotoma micropus.— New Mexico; Roosevelt Co., 26.4 km S, 4.8 km E Taiban (TTU catalogue number unavailable, TK31643;
AY817652, AF 186822).

Neotomapicta .— MEXICO: Guerrero; 6.4 km SSW Filo de Caballo (UNAM catalogue number unavailable, TK93390; AY817629,
AF305569).

Neotoma stephensi— Arizona; Navaho Co., 4.8 km S Woodruff, UTM 12 588361E 3844338N (TTU78505; AY817642,
AF308867).

Ofjzomys albigularis .— ECUADOR: Pichincha; 10 km NW Quito, Tandayapa Valley, 0°00’13”N, 78 o 40’70”W (ACUNHC917;
DQ207945, DQ224407).

Otyzomys alfaroi.— NICARAGUA: Selava Negra; Altajo Trail (TTU 101644; DQ207950, DQ224410).

Amman et al.-Alcohol Dehydrogenase and Mammalian Systematics

15

Appendix I (cont.)

Oryzomys coitmi. —HONDURAS: Olancho; 4 km E Catacamas (Escuelade Sembrador), UTM 16 624523E 163751 IN (TTU84697;
DQ207948, DQ185383).

Oryzomys melanotis. —HONDURAS: Atlantida; Lancetilla Botanical Gardens, UTM 16 451012E 1740282N (TTU84374; DQ207947,
DQ224409).

Oryzomys pains trish-Texas\ Galveston Co., Texas City, Virginia Point (TTU82920; DQ207949. DQ 185382).

Oryzomys perenensis — PERU: Loreto; Maynas, 25 km S Iquitos (Estacio Biologia Allpahuayo) (TTU98606; DQ207946,
DQ224408).

Ototylomys phyllotis. — HONDURAS: Atlantida; Lancetilla Botanical Gardens, UTM 16451012E 1740282N (TTU84371; AY817624,
no Cyt-b data); MEXCIO: Quintana Roo, 1 km N Noh-bec (ASNHC7254; no Adh\-\2 data. AY009788).

Peromyscus attwateri. —Oklahoma; McIntosh Co., 5 km E Dustin (TTU55688; AY817626, AF155384).

Peromyscns beatae. —MEXICO: Chiapas, Yalentay, UTM 15 52417 IE 1852486N (UNAM catalogue number unavailable, TK93279;
AY994223, no Cyt-b data); Veracruz; Xometla (TCWC48060; mAdh\-\2 data, AF131921).

Peromyscus boylii. —California; San Diego Co., Heise County Park (TTU83102; AY994225, no Cyt-b data); MEXICO: Aguascali-
entes; Rincon de Romos (TCWC48438; no Adh 1-12 data, AF 131924).

Peromyscus californicus. —California; Los Angeles Co., Chatsworth Resevoir Park (TTU83292; AY994211, AF 155393).

Peromyscus crinitus. —Utah; Emery Co., Cottonwood Canyon, 39° 16’5 1.8”N, 111°10’31.9”W (BYU18639; AY994213,
AY376413).

Peromyscus difficilis. —MEXICO: Tlaxcala; 2 km NE Tepetitla (TTU82690; AY994219, AY376416).

Peromyscus eremicus, —California: Los Angeles Co., Kanan Dome Road (TTU81850; AY994212, no Cyt-b data); California; Los
Angeles Co., Calabasas Creekside Park (TTU83249; no Adh]-12, AY322503).

Peromyscus gratus — MEXICO: Michoacan; 4 km E Costzeo (UNAM catalogue number unavailable, TK46354; AY994218,
AY376421).

Peromyscus hylocetes. —MEXICO: Michoacan; Estacion Cerra Burror, Microodas; 3,270 m (UNAM catalogue number unavailable,
TK 45309; AY994235, DQ000481).

Peromyscus leucopus. —Texas; Presidio Co., Las Palomas Wildlife Management Area, UTM 13 52948 IE 3321292N (TTU75694;
AY994240, no Cyt-b data); Dickens Co., 0.9 km E Afton (TTU catalogue number unavailable, TK47506; no Adh 1-12 data,
AF131926).

Peromyscus levipes. —MEXICO: Michoacan, Las Minas, 3 km SW Tuxpan (UNAM catalogue number unavailable, TK47819;
AY994224, DQ000477).

Peromyscus maniculatus. —Arkansas; Mississippi Co., Dillahunty Pecan Orchard (TTU97830; AY994242, no Cyt-b data); Alaska,
Alexander Archipelago, Bushy Island, Petersburg Quad, 56°15’45 ,r N, 132°58’52”W (UAM50770; noAdh\-\2 data, AF119261).

Peromyscus megalops.— MEXICO: Guerrero; 6.4 km SSW Filo de Caballo (TTU82712; AY994217, DQ000475).

Peromyscus meianophrys. —MEXICO: Durango; 2.2 km S, 2.5 km E Vicente Guerrero (TTU75509; AY994216, AY322510).

Peromyscus mexicamts .— MEXICO; Chiapas; 14.4 km N Ocozocoaulta (TTU82759; AY994236, AY376425).

Appendix I (cont.)

Peromyscus pectoralis .—MEXICO: Jalisco; 30 km W Huejuquilla del Alto (UNAM catalogue number unavailable, TK48645;
AY994221, no Cyt-b data; TTU75575; no Adh\ 42 data, DQ000476).

Peromyscus perfitlvus.— MEXICO: Michoacan; Tunel de Riego, 2 km E Cerro Colorado, 1290 M, 19°19'220”N, 100°28 , 308”W
(UNAM catalogue number unavailable, TK47926; AY994215, DQ000474).

Peromyscus schmidlyi '—MEXICO: Durango; 6.1 km W Coyotes, Hacienda Coyotes, UTM 13 465908E 2634281N (TTU81617;
AY994228, AY322524).

Peromyscus spicilegus .—MEXICO: Michoacan; KM 81 carr., Ario de Rosales-La Huacana, 1602 m, 19°10’59”N, 101°43’42”W
(UNAM catalogue number unavailable, TK 47888; AY994232, DQ000480).

Tylomys mtdicaiidatus.— GUATEMALA: lzabal, Cerro San Gil (TTU62082; AY817625, AF307839).

TEXAS TECH UNIVERSITY

Natural Science Research Laboratory

Publications of the Museum of Texas Tech University

Institutional subscriptions are available through the Museum of Texas Tech University, attn; NSRL
Publications Secretary, Box 43191, Lubbock, TX 79409-3191. Individuals may also purchase separate numbers
of the Occasional Papers directly from the Museum of Texas Tech University.

ISSN 0149-175X

Museum of Texas Tech University, Lubbock, TX 79409-3191