(ISSN 0161-8202)
fOL
1
Journal of
ARACHNOLOGY
PUBLISHED BY THE AMERICAN ARACHNOLOGICAL SOCIETY
VOLUME 42
2014
NUMBER 3
THE JOURNAL OF ARACHNOLOGY
EDITOR-IN-CHIEF: Robert B. Suter, Vassar College
MANAGING EDITOR: Richard S. Vetter, University of California-Riverside
SUBJECT EDITORS: Ecology — Stano Pekar, Masaryk University, Czech Republic; Systematics — Mark Har-
vey, Western Australian Museum and Jason Bond, Auburn University; Behavior — Elizabeth Jakob, University of
Massachusetts Amherst; Morphology and Physiology — Peter Michalik, Ernst Moritz Arndt University Greifswald,
Germany
EDITORIAL BOARD: Alan Cady, Miami University (Ohio); Jonathan Coddington, Smithsonian Institution;
William Eberhard, Universidad de Costa Rica; Rosemary Gillespie, University of California, Berkeley; Charles
Griswold, California Academy of Sciences; Marshal Hedin, San Diego State University; Marie Herberstein,
Macquarie University; Yael Lubin, Ben-Gurion University of the Negev; Brent Opell, Virginia Polytechnic Insti-
tute & State University; Ann Rypstra, Miami University (Ohio); William Shear, Hampden-Sydney College; Jef-
frey Shultz, University of Maryland; Petra Sierwald, Field Museum; Soren Toft, Aarhus University; I-Min Tso,
Tunghai University (Taiwan).
The Journal of Arachnology (ISSN 0161-8202), a publication devoted to the study of Arachnida, is published
three times each year by The American Arachnological SocieO. Memberships (yearly): Membership is open to
all those interested in Arachnida. Subscriptions to The Journal of Arachnology and American Arachnology (the
newsletter), and annual meeting notices, are included with membership in the Society. Regular, $55; Students, $30;
Institutional, $125. Inquiries should be directed to the Membership Secretary (see below). Back Issues: James
Carrel, 209 Tucker Hall, Missouri University, Columbia, Missouri 65211-7400 USA. Telephone: (573) 882-3037.
Undelivered Issues: Allen Press, Inc., 810 E. 10th Street, P.O. Box 368, Lawrence, Kansas 66044 USA.
THE AMERICAN ARACHNOLOGICAL SOCIETY
PRESIDENT: Charles Griswold (2013-2015), California Academy of Science, San Francisco, California, USA.
PRESIDENT-ELECT: Marshal Hedin (2013-2015), San Diego State University, San Diego, California, USA.
MEMBERSHIP SECRETARY: Jeffrey W. Shultz (appointed). Department of Entomology, University of Maryland,
College Park, Maryland, USA.
TREASURER: Karen Cangialosi, Department of Biology, Keene State College, Keene, New Hampshire, USA.
SECRETARY: Paula Cushing, Denver Museum of Nature and Science, Denver, Colorado, USA.
ARCHIVIST: Lenny Vincent, Fullerton College, Fullerton, California, USA.
DIRECTORS: Jonathan Coddington (20 1 3-20 15), Richard S. Vetter (20 1 3-20 1 5 ), Michael Draney (2014-20 1 6)
PARLIAMENTARIAN: Brent Opell (appointed)
HONORARY MEMBERS: C.D. Dondale, H.W. Levi.
Cover photo: An adult male jumping spider, Hahronattiis pyrrithrix (Salticidae), displaying characteristic green forelegs, white
pedipalps and red face during courtship (see page 268). Photo by Colin Hutton.
Publication date: 26 November 2014
©This paper meets the requirements of ANSI/NISO Z39.48-1992 (Permanence of Paper).
2014. The Journal of Arachnology 42:205-219
Troglomorphic pseudoscorpions (Arachnida: Pseudoscorpiones) of northern Arizona, with the description
of two new short-range endemic species
Mark S. Harvey and J. Judson Wynne^: 'Department of Terrestrial Zoology, Western Australian Museum, Locked
Bag 49, Welshpool DC, Western Australia 6986, Australia; ^Research Associate, Division of Invertebrate Zoology,
American Museum of Natural History, Centra! Park West at 79th Street, New York, New York 10024-5192, U.S.A;
^Research Associate, California Academy of Sciences, 55 Music Concourse Drive, San Francisco, California 94118,
U.S.A; ‘‘Adjunct, School of Animal Biology, University of Western Australia, Crawley, Western Australia 6009,
Australia; ^Adjunct, School of Natural Sciences, Edith Cowan University, Joondalup, Western Australia 6027,
Australia; ^Department of Biological Sciences, Colorado Plateau Biodiversity Center, Landscape Conservation
Initiative, Northern Arizona University, Box 5640, Flagstaff, Arizona 86011, U.S.A. E-mail:
mark.harvey@museum.wa.gov.au
Abstract. This study reports on the pseudoscorpion fauna of the subterranean ecosystems of northern Arizona, U.S.A.
Our work resulted in the descriptions of two new species, Hesperochernes bradyhaughi sp. nov. and Tuberoclienies cohiii sp.
nov. (Chernetidae) and the range expansion of one species, Larca cavicola (Muchmore 1981 ) (Larcidae). All of these species
were cave-adapted and found within caves on Grand Canyon-Parashant National Monument in northwestern Arizona.
Based upon this work, the genus Archeolarca Hoff and Clawson is newly synonymized with Larca Chamberlin, and the
following species are transferred from Archeolarca to Larca, forming the new combinations L. aalbid (Muchmore 1984),
L. cavicola (Muchmore 1981), L. guadaliipensis (Muchmore 1981) and L. welbourni (Muchmore 1981). Despite intensive
sampling on the monument, the two new species were detected in only one cave. This cave supports the greatest diversity of
troglomorphic arthropod species on the monument — all of which are short-range endemics occurring in only one cave.
Maintaining the management recommendations provided by Peck and Wynne (2013) for this cave should aid in the long-
term persistence of these new pseudoscorpion species, as well as the other troglomorphic arthropods.
Keywords: Nearctic, troglomorphy, troglobite, new synonymy, cave
urn:lsid:zoobank.org:pub: A 1 5CB9DB-5B36-4A7C-8052-08E2EC 1 F4D34
The pseudoscorpion fauna of North American caves is
moderately well known, thanks largely to the efforts of J.C.
Chamberlin, C.C. Hoff, E.M. Benedict, D.R. Malcolm and W.B.
Muchmore who have characterized and described many different
North American troglobites and troglophiles. There are currently
144 named species found in cave habitats across the United
States including six species in five families from Arizona:
Pseudogarypus hypogeus Muchmore 1981 (Pseudogarypidae),
Albiorix anophthahmis Muchmore 1999 (Ideoroncidae), Chit-
rellina chiricahuae Muchmore, 1996 (Syarinidae), Archeolarca
cavicola Muchmore 1981, A. welbourni Muchmore 1981
(Larcidae) and Tuberochernes ubicki Muchmore 1997 {Cherne-
tidae) (Muchmore 1996; Muchmore & Pape 1999; Harvey &
Muchmore 2013). Only A. cmophthalmm and C. chiricahuae had
troglobitic modifications including the complete lack of eyes
and pallid body color (Muchmore 1996; Muchmore & Pape
1999; Harvey & Muchmore 2013), whereas the others are less
obviously modified with only the slightly attenuated append-
ages hinting at an obligate subterranean existence (Muchmore
1981, 1997).
Prior to this work, all of these cavernicolous species from
Arizona occurred south of the Colorado River with P.
hypogeus, A. cavicola and A. welbourni from northern Arizona
(Coconino County) and A. anophtludmus, C. chiricahuae and
T. ubicki from south-eastern Arizona (Pima, Cochise and
Santa Cruz Counties, respectively). During biological inven-
tories of caves on the Grand Canyon-Parashant National
Monument (hereafter referred to as Parashant) in northwest-
ern Arizona, one of us (J.J.W.) and colleagues found
representatives of three different pseudoscorpion species,
which are the subject of this study.
Over the past several years, Parashant caves have yielded
other significant and interesting arthropod species — many of
which are restricted to the cave environment. These include
two new genera (comprising two new species) — a book louse
(order Psocoptera, family Sphaeropsocidae: Troglosphaerop-
socus voylesi Mockford 2009 (Mockford 2009), and a cave
cricket (family Rhaphidophoridae: cf Ceuthophilus n. gen. n.
sp., Cohn and Swanson, unpublished data). This work also
resulted in the identification of several cave-adapted and cave-
limited species including a leiodid beetle, Ptoinaphagus
parashant Peck and Wynne 2013 (Peck & Wynne 2013), an
undescribed species of centipede (family Anopsobiidae;
Wynne, unpublished data), an undescribed Isopod species,
Brackenridgia n. sp. (S. Taiti, in litt.), and a recently described
cave limited millipede, Pratherodesmus voylesi Shear 2009
(Shear et al. 2009). Additionally, three new species of
trogloxenic beetles were reported from Parashant caves
including Eleodes wynnei Aalbu, Smith, and Triplehorn 2012
(Tenebrionidae; Aalbu et al. 2012), an undescribed species of
the carabid beetle genus Rhadine LeConte (Carabidae: the
perlevis species-group; T.C. Barr, in litt.), and an undescribed
carabid beetle species Pterostichus Stephens (Carabidae, K.
Will, in litt.).
METHODS
The junior author and colleagues sampled caves on Grand
Canyon-Parashant National Monument during 4-14 August
205
206
THE JOURNAL OF ARACHNOLOGY
2005, 1-6 May 2007, 16-25 August 2007, 12-21 May 2008,
and 5-12 March 2009. They sampled all caves identified as
having deep zone like conditions (/; = 10). Given the short
duration of study (between two to four site visits), and
potential seasonal effects, confidently identifying this zonal
environment was not possible. The cave deep zone is required
habitat for cave-adapted arthropods and is characterized by
complete darkness, stable temperature, a near-water saturated
atmosphere and limited to no airfiow (as in Howarth 1980,
1982). Parashant is located in northwestern Arizona, encom-
passes approximately 4,451 km“, and is characterized by
rugged terrain containing deeply incised canyons, mesas, and
mountains. Vegetation zones include Mojave Desert contain-
ing creosote bush (Larrea tridentata) and Joshua trees ( Yucca
brevifo/ia) at lower elevations, gradating through Great Basin
pinyon (Pinus edulis) and juniper (Jiiniperus spp.) woodlands
to Colorado Plateau grasslands and Ponderosa pine (Piuiis
pomlerosa) forest with aspen (Popidus tremidoides) groves on
Mt. Trumbull (elevation 2,447 m). All of the caves referred to
in this paper were located within the Supai, Kaibab, or
Redwall limestone formations. Elevation for the caves that
were studied ranges from 736 to 1,590 m.
Although we inventoried 10 Parashant caves, we provide
descriptions for only the three caves (PARA- 1001, PARA-
2204 and PARA-3503) where pseudoscorpions were detected.
PARA- 1001 Cave was the second most biologically diverse
cave on Parashant (Wynne, unpublished data), and supports
the largest known cricket roost in northern Arizona (Wynne &
Voyles 2014). A small solution cave within the Kaibab
limestone, it had a total surveyed length and depth of 76.2 m
and 10.4 m, respectively. This cave had a small south-facing
vertical entrance (135° aspect) at bottom center of a large
sinkhole. Vegetation was characterized as juniper scrublands
at 1,585 m elevation, and was located on the north side of the
lower Colorado River along the western extent of the Grand
Canyon. PARA-2204 Cave was the most biologically diverse
cave on the monument (Wynne, unpublished data). The
deepest extent of this cave contained active speleothem
formations and supported a near-saturated water atmosphere
year-round. Located within the Supai formation, this large
solution cave (total surveyed length 175 m) was comprised of
several sinuous phreatic passages. This cave has one horizon-
tal entrance (330° aspect) and was situated within a canyon
near the base of the canyon’s north-face. Located at 1,272 m
elevation, this cave occurred within the vegetation transition
zone of Mojave Desert scrub and juniper woodlands. PARA-
3503 Cave was a dry cave with no evidence of recent
speleothem activity, and supported a summer roost of bats,
Myotis sp. (Wynne, unpublished data). The cave had a large
horizontal entrance (135° aspect) situated upon a high bench
(1,102 m elevation on an exposed cliff face). This cave was
situated along the south-face of one of the largest canyons
draining into the Colorado River from the north. Occurring
within the Redwall formation, this large solution cave
contained 540 m of surveyed length with an estimated survey
depth of 14.2 m. Vegetation was characterized as Mojave
Desert scrub.
The work conducted in 2005 was part of a biological
baseline study [refer to Wynne & Voyles (2014) for a
description of sampling methods]. Later (between 2007 and
2009), these caves were systematically sampled to characterize
the cave-dwelling arthropod communities. Interval sampling
using baited pitfall traps, timed searches, and opportunistic
sampling techniques were used. To apply these techniques,
detailed maps for each cave were required. For interval
sampling, we established up to 10 sampling intervals (which
included a sampling station at either wall and one at cave
centerline for a total of < 3 sampling stations per interval). We
used 10% of the total cave length to establish the sampling
interval (e.g., for a 1,000 m long cave, the sampling interval
was every 100 m).
At each sampling station, we deployed live capture baited
pitfall traps and conducted timed searches. For pitfall traps,
we used two 907 g stacked plastic containers (13.5 cm high,
10.8 cm diameter rim and 8.9 cm base). A teaspoon of peanut
butter was used as bait and placed in the bottom of the
exterior container. At the bottom of the interior container, we
made several dozen holes so the bait could “breathe” to
attract arthropods (e.g.. Barber 1931). Attempts were made to
counter-sink each pitfall trap within the cave sediment or
rockfall. When this was not possible, we built ramps around
each trap using local materials (e.g., rocks, wooden debris,
etc.) so arthropods could access the trap and fall in (e.g.,
Ashmole et al. 1992). To discourage small mammals, we
placed small rocks around the edges of the trap and then
covered the mouth of the trap with a cap rock. Pitfall traps
were deployed for three to four days (a three day deployment
occurred once due to scheduling constraints). For timed
searches, we established a 1 m radius around each sampling
station (where the pitfall trap would be deployed) and
searched for arthropods within that ~3 m circle. A one to
three minute timed search (one minute if no arthropods were
observed, three minutes if arthropods were detected) was
conducted before pitfall trap deployment and prior to trap
removal.
Opportunistic collecting was executed by two to three trained
observers as they traversed the length of each cave. This
technique was applied as the observers were in transit between
sampling intervals while deploying and removing pitfall traps
and conducting timed searches. Opportunistic collecting was
not conducted while at sampling stations and was resumed only
when the observers were in transit once again. This technique
was used at least twice per cave (both during pitfall trap
deployment and retrieval trips). For example, a cave containing
10 sample station arrays, there were 27 individual “random
walks” per site visit (i.e., nine random walk samples times three
observers collecting along their between stations). Because we
conducted two site visits per cave, there would be a total of 54
samples. For one cave, PARA 1001 Cave, we had two observers
conduct the opportunistic collecting.
An alpha-numeric coding system developed by the National
Park Service (NPS) was used to safeguard the location of both
caves and their resources. We only provide generalized latitude
and longitude coordinates of the area to keep the precise
location of the cave confidential. Parashant National Monu-
ment headquarters in Saint George, Utah has the cipher table
with cave codes. A copy of this paper with actual cave names
is on file at both monument headquarters, National Park
Service and the National Cave and Karst Research Institute,
Carlsbad, New Mexico.
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
207
Specimens representing three species collected by one of us
(J.J.W.) and colleagues form the basis of this study. All
specimens were collected and stored in 70% ethanol. The
holotypes of both new species and specimens of the known
species are deposited in the Museum of Northern Arizona,
Flagstaff, Arizona (MNA). Temporary slide mounts were
prepared by mounting them on microscope slides with 10 or
12 mm coverslips supported by small sections of 0.25, 0.35 or
0.50 mm diameter nylon fishing line in a drop of lactic acid at
room temperature for two or more days. After study the
specimens were rinsed in water and returned to 75% ethanol
with the dissected portions placed in 12 X 3 mm glass genitalia
microvials (BioQuip Products, Inc.). All specimens were
studied using a Leica DM2500 compound microscope and
illustrated with the aid of a drawing tube. Measurements were
taken at the highest possible magnification using an ocular
graticule. Terminology and mensuration mostly follow
Chamberlin (1931), with the exception of the nomenclature
of the pedipalps, legs and with some minor modifications to
the terminology of the trichobothria (Harvey 1992), cheliceral
setation (Harvey & Edward 2007), cheliceral rallum (Judson
2007) and faces of the appendages (Harvey et al. 2012).
TAXONOMY
Family Larcidae Harvey 1992
Larcu Chamberlin 1930
Lorca Chamberlin 1930:616.
Arcbeolarca Hoff and Clawson 1952:2-3. Syn. nov.
Type species. — Lorca: Garypus lotus Hansen 1884, by
original designation.
Archeolarca: Archeolarco rotunda Hoff and Clawson 1952,
by original designation.
Remarks. — The genus Larca was created by Chamberlin
(1930) for the type species L. Iota (Hansen) from Europe and
L. gramilata (Banks 1891) from eastern U.S.A. Since then,
other species have been added from Europe (Beier 1939a;
Gardini 1983; Henderickx & Vets 2002; Zaragoza 2005) and
North America (Hoff 1961; Benedict & Malcolm 1978;
Muchmore 1981). Archeolarca was described for the type
species A. rotunda which was collected from pack rat middens
and porcupine nests in Utah (Hoff & Clawson 1952). Since
then, four additional species have been described from other
parts of western North America, all from cave ecosystems
(Muchmore 1981, 1984), and A. rotunda has been found in
New Mexico and Oregon (Hoff 1956a; Benedict & Malcolm
1978). Archeolarca only differs from Larca in the possession of
four trichobothria on the movable chelal finger of adults,
whereas species of Larca have only two or three trichobothria
(e.g. Hoff 1961; Benedict & Malcolm 1978; Muchmore 1981;
Gardini 1983; Muchmore 1984, 1990; Henderickx & Vets
2002; Zaragoza 2005). Most adult specimens from the
Parashant have four trichobothria on the movable chelal
finger (Fig. 12), consistent with being a species of Archeolarca,
but one male has four on the right chela and three on the left
(Fig. 11) raising the issue of whether the genera should be
retained.
The maintenance of garypoid genera based solely on
trichobothrial number has been abandoned for several other
groups including the garypid genera Anagarypus Chamberlin
1930 with seven trichobothria on the fixed finger and one or
two on the movable finger forming a pattern of 7/1-2
(Muchmore 1982), Eremogarypus Beier 1955, with a pattern
of 5-8/1-3 (e.g., Beier 1962; Beier 1973), Synsphyronus
Chamberlin 1930, with a pattern of 5-8/1-3 (e.g., Chamberlin
1943; Harvey 1987b, 2011) and Thaumastogarypus Beier 1947,
with a pattern of 7-8/3^ (e.g. Beier 1947; Mahnert 1982), and
the geogarypid genus Geogarypus Chamberlin 1930 in which
adults normally have an 8/4 pattern, but G. hucculentus Beier
1955 and G. connatus Harvey 1987 have a 7/4 pattern (Harvey
1986, 1987a). Intra-specific variation in the number of
trichobothria of the movable chelal finger has been reported
in the genus Serianus Chamberlin 1930 (Garypinidae). Hoff
(1950) found that a small series of specimens of S. nunutus
Hoff 1950 (now known as 5. argent uiae Muchmore 1981 due
to secondary homonymy of the original name) included adults
with the normal four trichobothria on the movable chelal
finger, as well as some with only two or three trichobothria.
Similarly, Mahnert (1988) found that the type series of
Paraserianus bolivianus Beier 1939 possessed three or four
trichobothria on the movable chelal finger. Given that the
main feature used to substantiate the genus Paraserianus by
Beier (1939b) was the presence of only three such trichobo-
thria (as opposed to four in Serianus), Mahnert (1988) placed
Paraserianus as a synonym of Serianus.
Comparison of specimens of many species of Larca and
Archeolarca by one of us (M.S.H.), including the type species
of both genera, has revealed no other significant differences
that could be considered to maintain distinct genera, and
Archeolarca is here regarded as a synonym of Larca, resulting
in the following new combinations: L. aalhui (Muchmore
1984), comb, nov., L. cavicola (Muchmore 1981 ), comb, nov., L.
guadalupensis (Muchmore 1981) comb. nov. and L. welhourni
(Muchmore 1981) comb. nov.
Larca cavicola (Muchmore) comb. nov.
(Figs. 1-14)
Archeolarca cavicola Muchmore 1981: 55-56, Figs. 11, 12.
Material examined. — U.S.A.: Arizona: Mohave County: 1
male, PARA-3503 Cave, Grand Canyon-Parashant Nation-
al Monument, ca. UTM 0247400 N, 4020000 E, Zone 12S,
baited pitfall trap lA, 20 May 2008, J.J. Wynne (MNA); 1
female, same data except baited pitfall trap 1C, 6 March
2009, J.J Wynne (MNA); 1 tritonymph, 1 deutonymph,
same data except trap 2B, 10 March 2009, J.J. Wynne
(MNA); 1 tritonymph, same data except trap 7A (MNA); 1
tritonymph, same data except opportunistic collecting in a
possible deep zone (MNA); 1 male, PARA-2204 Cave,
Grand Canyon-Parashant National Monument, ca. UTM
025100 N, 4041000 E, Zone 12S, M, baited pitfall trap 2B,
17 May 2008, J.J. Wynne (MNA); 1 female, same data
except 20 May 2008 (MNA); 1 tritonymph, same data
except trap lA (MNA); 1 male, same data except trap IB
(MNA).
Diagnosis. — Larca cavicola resembles the other species
previously included in the genus Archeolarca in possessing
four trichobothria on the movable chelal finger, but occasion-
ally this is reduced to three trichobothria. It differs from these
species by having reduced eyes, especially the posterior pair,
which are noticeably smaller than the anterior pair.
208
THE JOURNAL OF ARACHNOLOGY
Figures 1-5. — Lm-ca cavicola (Muchmore), male from PARA-2004 Cave: 1. Body, dorsal; 2. Body, ventral; 3. Carapace, dorsal; 4. Left chela,
lateral; 5. Anal region, posterior.
Description. — Adults: Color: carapace, pedipalps and coxae
deep red-brown, abdomen pale red-brown and legs pale
yellow-brown.
Chelicera: with 4 setae on hand, with shs absent, and 1
subdistal seta on movable finger (Fig. 7); all setae acuminate;
seta bs slightly shorter than others; with 2 dorsal lyrifissiires
and 1 ventral lyrifissure; galea of S and 9 very long with 3
terminal rami, rami of male smaller than on female; rallum of
4 blades, the most distal blade with several serrations on
leading edge, other blades smooth; serrula exterior with 14 (d),
16 (9) blades; lamina exterior present.
Pedipalp (Fig. 9): most surfaces of trochanter, femur,
patella and chelal hand lightly and sparsely granulate, chelal
fingers smooth; trochanter, femur, patella and chelal hand
with prominent, curved, slightly denticulate setae arranged
sparsely; patella with 3 small sub-basal lyrifissiires; trochanter
1.83-1.99 (d), 1.90-1.93 (9), femur 4.74-5.94 (d), 4.57-4.95 (9),
patella 3.63-4.47 (d), 3.69-3.94 (9), chela (with pedicel) 4.47-
5.28 (d), 4.08^.54 (9), chela (without pedicel) 4.22-5.02 (d),
3.85-4.26 (9), hand (with pedicel) 2.17-2.49 (d), 1.94-2.08 (9)
X longer than broad, movable finger (with pedicel) 0.96-1.01
(d), 0.99-1 .00 (9) X longer than hand. Fixed chelal finger with
8 trichobothria, movable chelal finger with 4 trichobothria
(Fig. 12), although sh absent from left chela of one male
(Fig. 1 1): eh, esh, ih and ist situated subbasally, est, isb and it
SLibmedially, et subdistally, and est opposite it; h and sb
situated subbasally, and st and t situated submedialiy, with st
situated very close to t; patch of microsetae not present on
external margin of fixed chelal finger near et. Venom
apparatus present in both chelal fingers, venom ducts fairly
short, terminating in nodus ramosus slightly distal to et in
fixed finger (Figs. 11, 12). Chelal teeth pointed, slightly
retrorse, becoming rounded basally; fixed finger with 32 (d,
9) teeth; movable finger with 32 (d), 33 (9) teeth; accessory
teeth absent.
Carapace (Figs. 3, 6): 0.77-0.86 (d), 0.74 (9) X longer than
broad; anterior margin straight; with 2 pairs of rounded
corneate eyes, tapetum present; with 31 (d), 32 (9) setae,
arranged with 4 (d, 9) near anterior margin and 4 (d, 9) near
posterior margin; with 1 deep, broad median furrow.
Coxal region: manducatory process rounded with 1 small
sub-oral seta, and 9 (d), 12 (9) additional setae; median
maxillary lyrifissure large, rounded and situated submedialiy;
posterior maxillary lyrifissure rounded. Coxae I to IV
becoming progressively wider. Chaetotaxy of coxae I-IV: d,
6: 6: 6: 14; 9, 6: 7: 9: 16.
Legs: femora I and II longer than patellae; junction between
femora and patellae III and IV very ungulate; femora III and
IV much smaller than patellae III and IV; femur -h patella of
leg IV 5.92 (d), 5.27 (9) X longer than broad (Fig. 10);
metatarsi and tarsi not fused; tarsus IV without tactile seta;
subterminal tarsal setae arcuate and acuminate; claws simple;
arolium much longer than claws, not divided.
Abdomen: tergites II-X and sternites IV-VIII of male and
female with medial suture line fully dividing each sclerite,
sternite IX partially divided. Tergal chaetotaxy: d, 4: 6: 10: 10:
11: 12: 11: 10: 10: 6 (arranged T4T): 7: 2; 9, 6: 5: 7: 9; 10: 11:
11: 13: 9: 6 (arranged T4T): 8: 2; tergites I-X uniseriate.
Sternal chaetotaxy: d, 19: (0) 19 [3 3] (0): (0) 6 (0); 7: 9: 7: 8:
8: 6: 3: 2; 9, 14: (0) 8 (0): (0) 4 (0): 6: 7: 6: 8: 9: 6: 4: 2; sternites
IV-X uniseriate; d and 9 sternite II and III with all setae
situated near posterior margin. Spiracles with helix. Anal
plates (tergite XII and sternite XII) situated between tergite XI
and sternite XI, and surrounded by desclerotized region of
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
209
Figures 6-14. — Larca cavicoki (Muchmore), specimens from PARA-3503 Cave: 6. Carapace, dorsal, male; 7. Chelicera, dorsal, male; 8.
Rallum, lateral, male; 9. Right pedipalp, dorsal, male; 10. Left leg IV, male; 1 1. Left chela, lateral, male; 12. Left chela, lateral, female; 13. Left
chela, tritonymph; 14. Left chela, deutonymph. Scale lines = 0.1 mm (Figs. 7, 8), 0.2 mm (Figs. 1 1-14), 0.5 mm (Figs. 6, 9, 10).
210
THE JOURNAL OF ARACHNOLOGY
tergite XI and sternite XI; sternite XI with ca. 18 (d'), 24 (?)
small lyrifissures. Pleural membrane finely wrinkled-plicate;
without any setae.
Genitalia: male: very similar to that described for L. laceyi
Muchmore, 1981 by Muchmore (1981). Female with 1 pair of
lateral cribriform plates and 2 pairs of median cribriform
plates; spermathecae absent.
Dimensions: male {PARA-3503 Cave) followed by other
males (where applicable): Body length 2.40 (2.14-2.42).
Pedipalps: trochanter 0.371/0.186 (0.351-0.387/0.192-0.207),
femur 1.021/0.172 (0.923-0.976/0.187-0.206), patella 0.859/
0.192 (0.768-0.832/0.200-0.229), chela (with pedicel) 1.220/
0.231 (1.173-1.286/0.262-0.272), chela (without pedicel) 1.160
(1.106-1.216), hand length 0.576 (0.569-0.622), movable finger
length 0.582 (0.547-0.595). Chelicera 0.200/0.115, movable
finger length 0.130. Carapace 0.605/0.784 (0.621-0.656/0.763-
0.772); anterior eye diameter 0.059, posterior eye diameter
0.043. Leg I: femur 0.382/0.090, patella 0.249/0.092, tibia 0.350/
0.067, metatarsus 0.252/0.042, tarsus 0.218/0.042. Leg IV: femur
-I- patella 0.740/0.125, tibia 0.605/0.079, metatarsus 0.285/0.055,
tarsus 0.270/0.048.
Female (PARA-3503 Cave) followed by other female (where
applicable): Body length 2.85 (2.72). Pedipalps: trochanter
0.422/0.219 (0.408/0.215), femur 1.108/0.224 (0.978/0.214),
patella 0.992/0.252 (0.822/0.223), chela (with pedicel) 1.394/
0.307 (1.304/0.320), chela (without pedicel) 1.309 (1.232), hand
length 0.640 (0.621), movable finger length 0.643 (0.616).
Chelicera 0.240/0.131, movable finger length 0.150. Carapace
0.708/0.960); anterior eye diameter 0.049, posterior eye
diameter 0.048. Leg I: femur 0.410/0.103, patella 0.289/0.117,
tibia 0.382/0.075, metatarsus 0.261/0.059, tarsus 0.237/0.048.
Leg IV: femur + patella 0.828/0.157, tibia 0.660/0.095,
metatarsus 0.300/0.067, tarsus 0.282/0.058.
Tritonymph: Color: carapace, pedipalps and coxae red-
brown, abdomen pale red-brown and legs pale yellow-brown.
Chelicera: with 4 setae on hand and 1 on movable finger;
galea long and slender with 3 terminal rami.
Pedipalp: trochanter 1.97, femur 5.05, patella 3.90, chela
(with pedicel) 4.58, chela (without pedicel) 4.32, hand (without
pedicel) 2.17 X longer than broad, and movable finger 1.02 X
longer than hand (without pedicel). Fixed chelal finger with 7
trichobothria, movable chelal finger with 3 trichobothria
(Fig. 13): eb, esb, isr and ib situated basally; est and it
medially; et distally, isb absent; b subbasally, st and t
submedially, sb absent. Fixed chelal finger with 26 teeth;
movable finger with 22 teeth.
Carapace: 0.85 X longer than broad; with 2 pairs of small
rounded corneate eyes; with 4 setae near anterior margin and 3
near posterior margin; with deep median furrow.
Legs: much as in adults.
Abdomen: tergal chaetotaxy: 4: 4: 6: 7: 8: 7: 8: 6: 6: 6
(arranged T4T): 7: 2. Sternal chaetotaxy: 2: (0) 7 (0): (0) 3 (0):
4: 4: 4: 5: 6: 4: 2: 2.
Dimensions (mm) (PARA-3503 Cave): Body length 1.75.
Pedipalps: trochanter 0.314/0.159, femur 0.768/0.152, patella
0.643/0.165, chela (with pedicel) 1.040/0.227, chela (without
pedicel) 0.981, hand length 0.493, movable finger length 0.501.
Carapace 0.544/0.640.
Deutonymph: Color: carapace, pedipalps and coxae pale
red-brown, abdomen and legs pale yellow-brown.
Chelicera: with 4 setae on hand and 1 on movable finger;
galea long and slender with 3 termiinal rami.
Pedipalp: trochanter 2.11, femur 5.16, patella 3.50, chela
(with pedicel) 4.19, chela (without pedicel) 3.94, hand (without
pedicel) 2.02 x longer than broad, and movable finger 0.97 X
longer than hand (without pedicel). Fixed chelal finger with 6
trichobothria, movable chelal finger with 2 trichobothria
(Fig. 14): eb, ist and ib situated basally; est and it medially; et
distally; it subdistally, esb and isb absent; b subbasally, t
submedially, sb and st absent. Fixed chelal finger with 24
teeth; movable finger with 21 teeth.
Carapace: 0.82 X longer than broad; with 2 pairs of small
rounded corneate eyes; with 4 setae near anterior margin and 4
near posterior margin; with deep median furrow.
Legs: much as in adults.
Abdomen: tergal chaetotaxy: 4: 4: 4: 6: 6: 6: 6: 6: 6: 6
(arranged T4T): 4: 2. Sternal chaetotaxy: 0: (0) 2 (0): (0) 2 (0):
3: 2: 4: 4: 4: 4: 4: 2.
Dimensions (mm) (PARA-3503 Cave): Body length 1.49.
Pedipalps: trochanter 0.278/0.132, femur 0.629/0.122, patella
0.514/0.147, chela (with pedicel) 0.850/0.203, chela (without
pedicel) 0.800, hand length 0.410, movable finger length 0.397.
Carapace 0.490/0.600.
Remarks. — Larca cavicola was described from a single
female collected in Cave of the Domes, Grand Canyon
National Park, Coconino County, Arizona (Muchmore
1981). The new specimens were taken from two different
caves within the Parashant, PARA-3503 Cave and PARA-
2204 Cave, expanding the known range of this species some
160 km west of the type locality. Specimens from both cave
localities have shorter and slightly thinner pedipalpal segments
than the female holotype. In addition, the PARA-3503 Cave
specimens have slightly longer and thinner pedipalps than
those from PARA-2204 Cave. There do not appear to be any
other morphological features that would warrant the recog-
nition of more than one species amongst these specimens
which are all here attributed to L. cavicola. As noted by
Muchmore (1981), this species shows some obvious troglo-
morphic features consistent with an obligate subterranean
existence including long, slender pedipalps and legs, reduced
posterior eyes, and fewer setae on the carapace. Given the
findings of both Muchmore (1981) and the present study, we
consider this species to be troglobitic. A useful measure of
troglomorphic adaptation in larcid pseudoscorpions was
proposed by Gardini (1983), who found that the ratio
pedipalpal femur length/carapace length was lower in epigean
species of Larca than in cavernicolous species. This pattern
was also observed in two new Spanish species of Larca
(Zaragoza 2005). A similar condition is found in the species
formerly described in Archeolarca. The epigean L. rotunda has
a low ratio of 1.20 (male), 1.36 (female) (Hoff & Clawson
1952), whereas the cavernicolous species generally have higher
ratios: L. aalbui 1.57 (male), L. cavicola 1.44 (female), L.
guadalupensis 1.34 (female) and L. welbourni 1.47 (female)
(Muchmore 1981, 1984). The ratios of the new specimens of L.
cavicola recorded here [1.69 (male), 1.56 (female)] are higher
than the female holotype, but we ascribe this to individual
variation.
Two of the three post-embryonic nymphal stages (deuto-
nymph and tritonymph) are present in the samples, and they
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
21 1
exhibit the same trichobothrial pattern as illustrated for L.
aalhiii (under the name Archeokuxa aalhid) by Harvey (1992).
Family Chernetidae Menge 1855
Subfamily Chernetinae Menge 1855
Hesperochernes Chamberlin 1924
Hesperochernes Chamberlin 1924:89-90.
Type species. — Hesperochernes laurae Chamberlin 1924, by
original designation.
Remarks. — The genus Hesperochernes currently comprises
19 North American species, ranging as far south as the
Dominican Republic and Mexico (e.g., Ellingsen 1910;
Chamberlin 1924; Beier 1933, 1976) and as far north as
Canada (Hoff 1945), and a single Japanese species (Sato 1983).
Muchmore (1974) provided details on how to separate
Hesperochernes from the morphologically similar genera
Chernes Menge 1855 and Dinocheirus Chamberlin 1929, but
admitted that the composition of the genus was not fully
resolved due to uncertainties in the morphology of several
species. Hesperochernes is currently diagnosed by the follow-
ing combination of characters: rallum composed of 4 blades;
tarsus III and IV without conspicuous tactile seta; setae of
pedipalps and tergites not large and leaf-like; female
spermathecae with long paired ducts terminating in rounded
sacs; and cheliceral setae bs and sbs usually dentate or
denticulate. Of these characters, Muchmore (1974) was only
able to nominate the spermathecal morphology and the
denticulate bs and sbs as features that distinguish it from
Chernes. It appears, however, that some species currently
assigned to Hesperochernes have an acuminate bs, including
H. canadensis, H. holsingeri, H. molestiis, H. niontaniis, H.
occidentalis and H. riograndensis (Chamberlin 1935; Hoff
1945; Hoff & Clawson 1952; Hoff 1956b; Hoff & Bolsterli
1956; Muchmore 1994). Moreover, the new species described
below clearly demonstrates the labile nature of this feature,
with the male having a strongly denticulate bs on both
chelicerae, but the two females having an acuminate bs. It
would seem that this feature should be used with considerable
caution, and that the nature of the spermathecae is the only
feature that can be reliably used to separate Hesperochernes
from Chernes.
Although Muchmore (1974) was able to confirm the generic
placement of several species from the U.S.A. and Canada
[H. laurae, H. mimidus Chamberlin 1952, H. mirabilis (Banks
1895), H. molestus Hoff 1956, H. occidentalis (Hoff and
Bolsterli 1956). H. riograndensis Hoff and Clawson 1952, H.
tamiae Beier 1930, and H. iitahensis Hoff and Clawson 1952],
he was not able to ascertain whether others were correctly
placed [H. canadensis Hoff 1945, H. montanus Chamberlin
1935, H. pcdlipes (Banks 1893), H. paludis (Moles 1914), H.
thomomysi Hoff 1948, and H. imicolor (Banks 1908)]. The
same can be said of the Central American and Asian species
currently included in Hesperochernes, H. globosus (Ellingsen
1910), H. twnidus Beier 1933 and H. inusitatus Hoff 1946 from
Mexico, H. vesper tilionis Beier 1976 from Dominican Repub-
lic, and H. shinjoensis Sato 1983 from Japan, as the morphology
of the spermathecae has not yet been ascertained (Ellingsen
1910; Beier 1933; Hoff 1946a; Beier 1976; Sato 1983).
Species of Hesperochernes are frequently collected in caves
or are associated with other animals. The cave-dwelling species
include three eyeless species that have long slender pedipalps
consistent with strong troglomorphisms, H. holsingeri, H.
mirabilis and H. occidentalis, as well as the new eyeless species
described below that has long legs but has robust pedipalps.
The species associated with rodents include H. mimidus, H.
molestus, H. riograndensis, H. tamiae, H. thomomysi and H.
utahensis (Beier 1930; Hoff 1945, 1946b; Chamberlin 1952;
Hoff & Clawson 1952; Hoff 1956b), while H. vespertilionis was
collected within a bat roost (Beier 1976). Hesperochernes
laurae and H. imicolor were found within both wasp’s and
ant’s nests (Banks 1908; Chamberlin 1924; Hoff 1947),
respectively, H. montanus was found in a bird’s nest
(Chamberlin 1935), and H. tumidus was collected “lying on
the ground in pods of Inga sp.” (translated from the original
German) (Beier 1933). The poorly described and most likely
misplaced H. paludis was taken from both rotten poplar tree
logs on the ground and live standing poplar trees (Moles
1914), and the only species recorded from outside of North
America, H. shinjoensis from northern Japan, was collected
from under tree bark (Sato 1983). The other species lack any
habitat data.
Hesperochernes hradyhaughi sp. nov.
uni:lsid:zoobank.org:act:5419D319-EF22-4722-926F-lF8EC
080400B
Figs. 15-26
Material examined. — Types. U.S.A.: Arizona: Mohave
County: holotype male, PARA- 1001 Cave, Grand Canyon-
Parashant National Monument, ca. UTM 0264500 N, 4060700
E, Zone 12S, baited pitfall trap 3B, 20 August 2007, J.J. Wynne
(MNA); 1 female, same data as holotype except baited pitfall
trap 5 A (MNA); 1 female, same data as holotype except
opportunistic, mid cave, 13 August 2005 (NMA).
Etymology. — This species is named for Jeff Bradybaugh,
former superintendent of Grand Canyon-Parashant National
Monument and an advocate for cave research, conservation
and management both on Parashant and within the National
Park Service.
Diagnosis. — Hesperochernes hradyhaughi most closely re-
sembles three other species of the genus that are also
completely eyeless and have long slender legs [e.g. femur +
patella IV 5.19 (male), 5.37-5.56 (female) x longer than
broad], H. mirabilis, H. holsingeri and H. riograndensis.
Hesperochernes bradyhaughi lacks the slender pedipalps
characteristic of H. mirabilis and H. holsingeri, and the male
chela of H. hradybaughi is markedly swollen, especially on the
dorsal face (Fig. 21 ), unlike the male of H. riograndensis which
is not swollen. It is also substantially larger than H.
riograndensis, e.g., chela (without pedicel) of H. riograndensis
is 0.956 (male), 0.970 (female) mm, whereas H. hradybaughi is
1.434 (male), 1.502-1.510 (female) mm.
Description. — Adults: Color: pedipalps and carapace dark
red-brown, legs light red-brown, tergites yellow-brown,
sternites pale yellow-brown.
Chelicera: with 5 setae on hand and 1 subdistal seta on
movable finger (Fig. 23); setae Is and is acuminate, es and bs
dentate, sbs denticulate in female, acuminate in male; with 2
dorsal lyrifissures and 1 ventral lyrifissure; galea of <S and ?
with 6 rami; rallum of 4 blades, the 2 distal blades with several
212
THE JOURNAL OF ARACHNOLOGY
Figures 15-20. — Hesperoclieriies hradybaiighi, sp. nov.: 15. Body, dorsal, male holotype; 16. Body, ventral, male holotype; 17. Carapace,
dorsal, male holotype; 18. Body, dorsal, female paratype; 19. Body, ventral, female paratype; 20. Left chela, lateral, male holotype.
serrations on leading edge, other blades smooth; serrtila
exterior with 18 (d), 17 (?) blades; lamina exterior present.
Pedipalp (Fig. 24): surfaces of trochanter, femur, patella
and chelal hand coarsely granulate, chela fingers mostly
smooth; patella with 5 small sub-basal lyrifissures; trochanter
1.84 (d), 1.86-1.88 (9), femur 3.17 (d), 2.95-3.09 (9), patella
2.62 (d), 2.54-2.66 (9), chela (with pedicel) 3.07 (d), 3.23-3.34
(9), chela (without pedicel) 2.83 (d), 2.98-3.09 (9), hand 1.49
(d), 1.34-1.64 (9) X longer than broad, movable finger 0.93
(d), 0.86-0.96 (9) X longer than hand. Fixed chelal finger with
8 trichobothria, movable chelal finger with 4 trichobothria
(Figs. 21, 22): eh and esb situated basally, ib and ist
subbasally, est and ish submedially, et and it subdistally, isb
situated midway between ist and it, and et slightly distal to if, t
situated subdistally, st situated closer to t than to sb. Venom
apparatus only present in movable chelal finger, venom ducts
long, terminating in nodus ramosus distal to st (Figs. 21, 22).
Fixed finger with 2 large sensillae on retrolateral face, and 2 on
prolateral face; movable chelal finger with sensilla slightly
proximal to sh in male and slightly distal to sb in female, with
2 receptors. Chela of male without mound. Chelal teeth
pointed and slightly retrorse, basal teeth more rounded; fixed
finger with 44 (cJ), 48 (9) teeth, plus 1 1 (^), 9 (9) retrolateral
and 10 (cJ), 7 (9) prolateral accessory teeth; movable finger
with 46 (cJ), 50 (9) teeth, plus 9 (cJ, 9) retrolateral and 6 (<3), 4 (9)
prolateral accessory teeth.
Carapace (Fig. 17): coarsely granulate, 1.15 {£), 0.98-1.10
(9) X longer than broad; without eyes or eyespots; with 100
(5), 83 (9) setae, arranged with 61 (cJ), 42 (9) (including 6 near
anterior margin) in anterior zone, 25 ((J), 34 (9) in median
zone, and 14 (13), 17 (9) in posterior zone; with 2 deep furrows,
posterior furrow situated slightly closer to posterior carapace
margin than to anterior furrow.
Coxal region: maxillae granulate; manducatory process
somewhat acute, with 2 apical acuminate setae, 1 small sub-
oral seta and 37 {<3), 32 (9) additional setae; median maxillary
lyrifissure rounded and situated submedially; posterior max-
illary lyrifissure rounded. Leg coxae smooth; chaetotaxy of
coxae I-IV; <3, 18: 19: 23: ca. 60; 9, 18: 21: 25: ca. 65.
Legs: very slender; junction between femora and patellae I
and 11 strongly oblique to long axis; junction between femora
and patellae III and IV very angulate; femora III and IV much
smaller than patellae III and IV; femur + patella of leg IV 5.19
(>3), 5.37-5.56 (9) X longer than broad; all tarsi with slit
sensillum on raised mound; male leg I not modified; tarsi III
and IV without tactile seta, but with paired subdistal setae;
subterminal tarsal setae arcuate and acute; claws simple;
arolium about same length as claws, not divided.
Abdomen: tergites 1-X and sternites IV-X of male and
female with median suture line fully dividing each segment.
Tergal chaetotaxy; 3, 1 1: 12: 1 1: 18; 19: 18; 20; 18: 17: 18: 13:2;
9, 12: 13: 13: 17: 17; 18: 19; 19: 21: 16: 14: 2; uniseriate, except
HARVEY & WYNNE TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
213
Figures 21-26. — Hesperochernes hradyhaughi, sp. nov.: 21. Left chela, lateral, male holotype; 22. Left chela, lateral, female paratype; 23.
Chelicera, dorsal, female paratype; 24. Right pedipalp, dorsal, male holotype; 25. Left leg IV, male holotype; 26. Spermathecae, female paratype.
Scale lines = 0.1 mm (Fig. 23), 0.2 mm (Fig. 26), 0.5 mm (Figs. 21, 22, 24, 25).
for medial and lateral discal seta on tergites IV-IX; setae
thickened and strongly dentate. Sternal chaetotaxy: <3, 30: (3) 22
[2 + 2] (3): ( 1 ) 8 ( 1 ): 1 9: 2 1 : 2 1 : 20: 20: 1 6: 8 (arranged T6T): 2; ?,
ca. 40: (3) 10 (3): (1) 5 (1): 14: 21: 20: 20: 18: 16: 11 (arranged
T9T): 2; uniseriate, except for lateral discal seta on sternites
VII-X; setae of anterior sternites acicular, becoming progres-
sively more denticulate on posterior sternites. Spiracles with
helix. Anal plates (tergite XII and sternite XII) situated between
tergite XI and sternite XI, anal setae not denticulate. Pleural
membrane wrinkled and somewhat stellate; without any setae.
Genitalia: male of the chernetid type. Female (Fig. 26): with
a pair of long thin-walled spermathecae terminating in
rounded sacs.
Dimensions: Male holotype: Body length 3.11. Pedipalps:
trochanter 0.518/0.282, femur 974/0.307, patella 0.824/0.314,
chela (with pedicel) 1.552/0.506, chela (without pedicel) 1.434,
hand length 0.756, movable finger length 0.704. Chelicera
0.322/0.165, movable finger length 0.252. Carapace 0.956/
0.830. Leg I: femur 0.268/0.161^, patella 0.495/0.136, tibia
0.503/0.102, tarsus 0.495/0.079. Leg IV: femur + patella 0.883/
0.170, tibia 0.778/0.107, tarsus 0.557/0.085.
Female (paratype lodged in MNA) followed by other
female (where applicable): Body length 2.82 (4.21). Pedipalps:
trochanter 0.552/0.294 (0.566/0.304), femur 1.034/0.335 ( 1.042/
0.353), patella 0.904/0.340 (0.942/0.371), chela (with pedicel)
1.624/0.486 (1.635/0.506), chela (without pedicel) 1.502
214
THE JOURNAL OF ARACHNOLOGY
( 1.510), hand length 0.797 (0.698), movable finger length 0.768
(0.816). Chelicera 0.327/0.152, movable finger length 0.244.
Carapace 1.040/0.944 (1.000/1.021). Leg I: femur 0.300/0.182,
patella 0.540/0.146, tibia 0.56/0.108, tarsus 0.520/0.079. Leg
IV: femur + patella 1.010/0.188 (1.000/0.180), tibia 0.83o7
0.121, tarsus 0.580/0.084.
Remarks. — As stated in the diagnosis, H. bradyhaughi
appears to be most similar to H. riograndensis but differs in
being substantially larger and with a markedly swollen male
chela, especially on the dorsal face. The only known location
of H. riograndensis is located 670 km ESE of Parashant, and
the microhabitat of both species differs with H. bradyhaughi
being found in a cave and H. riograndensis collected from the
nest of a kangaroo rat (Heteromyidae: Dipodomys) (Hoff &
Clawson 1952). Given the lack of eyes and eyespots, we
consider H. bradyhaughi to be a troglobite.
Tuherochernes Muchmore
Tuberochernes Muchmore 1997:206-207.
Type species. — Tuberochernes aalbui Muchmore 1997, by
original designation.
Diagnosis. — Tuherochernes differs from all other chernetid
genera by the combined presence of a distinct medium-sized
mound on the prolateral face of the pedipalpal chela of males,
and four blades in the cheliceral rallum.
Remarks. — The genus Tuherochernes was described by
Muchmore (1997) for two species of cave-dwelling pseudo-
scorpions from southwestern U.S.A., T. aalbui and T. uhicki,
but the discovery of a third species, also from a cave in
southwestern U.S.A., does not necessitate an alteration of the
original description apart from the nature of the tactile seta of
leg IV. Muchmore (1997) observed that the tactile seta of leg
IV was “short, distally located” and “variably acuminate or
finely denticulate”. Close examination of the posterior tarsi of
the new species described below does not reveal a tactile seta
of this nature, and we suggest this feature appears to be
variable within the genus.
The most obvious feature that distinguishes Tuberochernes
is the presence of a medium-sized mound on the prolateral
margin of the chelal hand in males (Muchmore 1997). In this
respect, it resembles several other chernetid genera, including
males of Mirochernes Beier 1930 and Bituherochernes Much-
more 1974, and both males and females of Interchernes
Muchmore 1980 and Petterchernes Heurtault 1986, which
were distinguished from Tuherochernes by Muchmore (1997).
Bituherochernes further differs from Tuherochernes by a
mound being also present on the pedipalpal patella. The
function of the mound has not been ascertained, but the
mound of T cohni has 5 small pores, which may be responsible
for discharging fiiiids, possibly during sexual interactions with
females.
Tuherochernes cohni sp. nov.
urn:lsid:zoobank.org:act:12896B35-DDlC-4E0B-B66F-F9B
30170D476
Figs. 27-37
Material examined. — Type: U.S.A.: Arizona: Mohave
County: holotype male, PARA- 1001 Cave, Grand Canyon-
Parashant National Monument, ca. UTM 0264500 N,
4060700 E, Zone 12S, the deeper extent of the twilight zone
(near the dark zone), opportunistic collecting, 13 August 2005,
J.J. Wynne (MNA).
Etymology, — This species is named for the late Dr.
Theodore “Ted” Cohn. Cohn was an Orthopterist and the
leading authority who identified the new genus of rhaphido-
phorid cricket known from PARA- 1001 Cave. Dr. Cohn
passed away in November 2013 at age 82. He was a passionate
educator and entomologist.
Diagnosis. — Tuherochernes cohni differs from the other two
species of the genus, T. aalbui and T. uhicki, by the more
anteriorly positioned mound on the pedipalpal chela.
Description. — Adult male: Color: pedipalps and carapace
dark red-brown, legs light red-brown, tergites yellow-brown,
sternites pale yellow-brown.
Chelicera: with 6 setae on hand and 1 subdistal seta on
movable finger (Fig. 32); setae es, sbs and bs dentate, Is and is
acuminate; with 2 dorsal lyrifissures and 1 ventral lyrifissure;
galea broken; rallum of 4 blades, the most distal blade with
several serrations on leading edge, other blades smooth;
serrula exterior with 17 blades; lamina exterior present.
Pedipalp (Fig. 33): surfaces of trochanter, femur, patella
and chelal hand coarsely granulate, chela fingers mostly
smooth; patella with 5 small sub-basal lyrifissures; trochanter
1.73, femur 2.83, patella 2.88, chela (with pedicel) 3.39, chela
(without pedicel) 3.11, hand 1.40 X longer than broad,
movable finger 1.23 X longer than hand. Fixed chelal finger
with 8 trichobothria, movable chelal finger with 4 trichobo-
thria (Fig. 31): eb and esb situated basally, ih and ist
subbasally, est and isb submedially, et and it subdistally, ish
situated midway between ist and it, and et slightly distal to if, t
situated subdistally, st situated much closer to t than to sb.
Venom apparatus only present in movable chelal finger,
venom ducts long, terminating in nodus ramosus midway at
level of St (Fig. 31). Fixed finger with 3 sensillae on retrolateral
face, and 1 on prolateral face; movable chelal finger with
sensilla slightly distal to sb, with 2 receptors. Chela with
prominent, medium-sized mound on prolateral face (Figs. 30,
34), with 5 small pores. Chelal teeth pointed and slightly
retrorse, basal teeth more rounded; fixed finger with 37 teeth,
plus 7 retrolateral and 3 prolateral accessory teeth; movable
finger with 42 teeth, plus 4 retrolateral and 0 prolateral
accessory teeth.
Carapace (Fig. 29): coarsely granulate, 1.19 X longer than
broad; without eyes or eyespots; with 96 setae, arranged with
54 (including 6 near anterior margin) in anterior zone, 28 in
median zone, and 14 in posterior zone; with 2 deep furrows,
posterior furrow situated closer to posterior carapace margin
than to anterior furrow.
Coxal region: maxillae granulate; manducatory process
somewhat acute, with 2 apical acuminate setae, 1 small sub-
oral seta and 25 additional setae; median maxillary lyrifissure
rounded and situated submedially; posterior maxillary lyr-
ifissure rounded. Leg coxae smooth; chaetotaxy of coxae I-IV:
13: 12: 14: 34.
Legs (Figs. 35-37): junction between femora and patellae I
and II strongly oblique to long axis; junction between femora
and patellae III and IV very angulate; femora III and IV much
smaller than patellae III and IV; femur -i- patella of leg IV 4.03
X longer than broad; all tarsi with slit sensillum on raised
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
215
Figures 27-30. — Tuherochernes cohni, sp. nov., male liolotype: 27. Body, dorsal; 28. Body, ventral; 29. Carapace, dorsal; 30. Right
chela, dorsal.
mound; leg I modified with tibia thickened, tarsus slightly
curved and ventral margins of patella and tibia with coarse
granulation; tarsi III and IV without tactile seta, but with
paired subdistal setae; subterminal tarsal setae arcuate and
acute; claws simple; arolium about same length as claws, not
divided.
Abdomen: tergites II-X and sternites V-X of with median
suture line fully dividing each segment. Tergal chaetotaxy: 15:
20: 20: 20: 22: 22: 21: 21: 22: 17: 10: 2; uniseriate, except for
medial and lateral discal seta on tergites IV-IX; setae
thickened and strongly dentate. Sternal chaetotaxy: 51: (0) 8
[2 + 2] (0): (1)8(1): 12: 16: 17: 18: 17: 14: 8 (arranged T6T): 2;
uniseriate, except for lateral discal seta on sternites IV-XI;
setae of anterior sternites acicular, becoming progressively
more denticulate on posterior sternites. Spiracles with helix.
Anal plates (tergite XII and sternite XII) situated between
tergite XI and sternite XI, anal setae denticulate. Pleural
membrane longitudinally striate; without any setae.
Genitalia: of the chernetid type.
Dimensions: male holotype: Body length 3.38. Pedipalps:
trochanter 0.576/0.332, femur 0.944/0.334, patella 0.910/0.316,
chela (with pedicel) 1.390/0.410, chela (without pedicel) 1.276,
hand length 0.573, movable finger length 0.704. Chelicera
0.333/0.134, movable finger length 0.240. Carapace 1.009/
0.848. Leg I: femur 0.305/0.249, patella 0.560/0.253, tibia
0.621/0.174, tarsus 0.442/0.089. Leg IV: femur + patella 0.859/
0.213, tibia 0.692/0.134, tarsus 0.533/0.954.
Remarks. — Tuherochernes cohni possesses some very slight
modifications consistent with troglomorphic adaptations of
which the most prominent is the complete lack of eyes
(Fig. 29) and the slightly elongated leg segments. Thus, this
animal is considered a troglobite. It appears to bear a closer
resemblance to T. ubicki from a cave in the Santa Rita
Mountains, Arizona (610 km), than to T. aalhiii from a cave in
the Inyo National Forest, California (415 km), due to the
similarly expanded tibia I in males of the two Arizona species.
DISCUSSION
Our review of the pseudoscorpions detected within the caves
of Grand Canyon-Parashant National Monument has re-
vealed a modest fauna of three species: Larca cavicola (family
Larcidae), Hesperochernes bradybuughi and Tuherochernes
cohni (both in the family Chernetidae). All show modifications
consistent with obligate existence in cave environments, but
none show the classic signs of extreme troglomorphism found
in many cave-adapted pseudoscorpions (e.g. Heurtault 1994;
Flarvey et al. 2000). Both species of Chernetidae lack eyes and
have long slender legs, which appear to be troglomorphic
modifications due to their subterranean existence, although
their pedipalps do not appear to be modified compared to
epigean species of the genus. Other subterranean species of
Hesperochernes with thin legs and no eyespots — H. holsingeri
from Indiana, H. mirabilis from Alabama, Georgia, Indiana,
Kentucky, Ohio, Tennessee and Virginia, and H. occidentalis
from Arkansas, Missouri, Oklahoma and Texas — appear to be
more highly modified as they have elongate pedipalps. Both
new species described from the Parashant may represent short-
range endemic species as defined by Harvey (2002) and Harvey
216 THE JOURNAL OF ARACHNOLOGY
Figures .^Tuherochemes colmi, sp. nov., male holotype: 31. Left chela, lateral; 32. Chelicera, dorsal; 33. Right pedipalp, dorsal; 34. Left
chela, detail of mound, ventral; 35. Left tarsus IV; 36. Left I; 37. Left leg IV. Scale lines = 0.2 mm (Figs. 32, 34, 35), 0.5 mm (Figs. 31, 33, 36, 37).
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
217
et al. (2011) due to their highly restricted distributions.
Although the junior author and colleagues sampled all known
caves on Parashant, they detected these new species in only
one cave (PARA- 1001 Cave).
Larca cavicola appears to be less cave-adapted than the
others, as it retains eyes. However, the pedipalps are
noticeably thinner than epigean species of the genus,
suggesting moderate morphological modifications to the cave
environment. Larca cavicola was found in PARA-3503 and
PARA-2204 Caves and has been found in Cave of the Domes,
a small cave situated within Grand Canyon National Park,
Coconino County (Muchmore 1981). Although this cave is
also located in the Grand Canyon region, it lies on the south
side of the Colorado River some 160 km from the Parashant
caves, and we suggest these populations are genetically
isolated from each other.
The only known locality of Hesperochernes hradybaugln and
Tiiherochernes cohni is PARA- 1001. This is the second most
biologically diverse cave, and the most biologically significant
cave on the monument. It supports the largest known cricket
roost in Arizona, which represents an undescribed genus of
rhaphidophorid cave cricket, cf Ceuthophilus n. gen. n. sp.,
Cohn & Swanson, unpublished data; (Wynne & Voyles 2014).
Its population contributes significantly to the nutrient loading
via cricket guano, cricket eggs and nymphs, as well as deceased
individuals at various life stages. In other regions, the
ecological importance of crickets on cave ecosystems is well
documented (e.g., Barr 1967; Howarth 1983; Taylor 2003;
Culver 2005; Poulson 2005). Given the size of the roost, we
suggest that cf Ceuthophilus n. gen. n. sp. represents a keystone
species with the presence of this animal supporting at least
four cave-adapted species including a short-range endemic and
troglomorphic leiodid beetle, Ptomaphagus parashant (Peck &
Wynne 2013), an undescribed species of troglomorphic
centipede (family Anopsobiidae; Wynne, unpublished data),
and the two pseudoscorpion species described here. To date,
P. parashant, the anopsobiid centipede, and the two new
pseudoscorpion species have been detected only in PARA-
1001 Cave. Two other caves on the monument, with similar
deep zone like conditions, were sampled using the same
systematic sampling design are within a 9.7 km radius of
PARA- 1001; neither of these new pseiidoscorpions species
were detected at these caves.
Management Implications. — We recommend the same man-
agement strategies proposed by Peck & Wynne (2013) be
maintained for PARA- 1001 Cave. This cave should not be
gated given its south-facing entrance and entrance structure,
and it should remain closed to recreational use. PARA- 1001 is
considered the second most biologically diverse cave on the
monument and supports the greatest diversity of troglo-
morphic arthropod species. Presently, all of these animals
(including the two new pseudoscorpion species described here)
are known to occur only within PARA- 1001 Cave. Maintain-
ing the management strategies suggested by Peck & Wynne
(2013) should aid in the long-term persistence of these
presumed short-range endemic arthropods.
ACKNOWLEDGMENTS
Special thanks to Jennifer Eox, Eathan McIntyre, Ray
Klein and Rosie Pepito of Grand Canyon-Parashant National
Monument, Danielle Nelson and Matt Johnson with the
Colorado Plateau Research Station, and Neil Cobb of the
Colorado Plateau Museum of Arthropod Biodiversity for
administrative and logistical support. Tama and John Cassidy,
Michael Gowan, John Kalman, Ty Spatta and Kyle Voyles
assisted with fieldwork. The San Bernardino Cave Search and
Rescue Team, Jon Jasper and Kyle Voyles, remained on
emergency stand-by during field operations. Dave Decker and
Kyle Voyles provided descriptions regarding the geological
and structural characteristics of the study caves. Dale Pate and
two anonymous reviewers provided suggestions leading to the
improvement of this manuscript. The Explorers Club recog-
nized two of these research trips as flag expeditions. Fieldwork
was funded through a Colorado Plateau CESU cooperative
agreement between the National Park Service and Northern
Arizona University.
LITERATURE CITED
Aalbu, R.L., A.D. Smith & C.A. Triplehorn. 2012. A revision of the
Eteodes {subgenus Cavenieleodes) with new species and notes on
cave breeding Eleodes (Tenebrionidae: Amphidorini). Annales
Zoologica 62:199-216.
Ashmole, N.P., P. Oromi, M.J. Ashmole & J.L. Martin. 1992.
Primary faunal succession in volcanic terrain: lava and cave studies
on the Canary Islands. Biological Journal of the Linnean Society
46:207-234.
Banks, N. 1908. The pseudoscorpions of Texas. Bulletin of the
Wisconsin Natural History Society 6:39M2.
Barber, H.S. 1931. Traps for cave inhabiting insects. Journal of the
Mitchell Society 46:259-266.
Barr, T.C. Jr. 1967. Observations on the ecology of caves. American
Naturalist 101:475-491.
Beier, M. 1930. Die Pseudoskorpione des Wiener Naturhistorischen
Museums. III. Annalen des Naturhistorischen Museums in Wien
44:199-222.
Beier, M. 1933. Pseudoskorpione aus Mexiko. Zoologischer Anzeiger
104:91-101.
Beier, M. 1939a. Die Pseudoscorpioniden-Fauna der iberischen
Halbinsel. Zoologische Jahrbiicher, Abteilung fiir Systematik,
Okologie und Geographie der Tiere 72:157-202.
Beier, M. 1939b. The Pseudoscorpionidea collected by the Percy
Sladen Trust Expedition to Lake Titicaca. Annals and Magazine of
Natural History (11) 3:288-290.
Beier, M. 1947. Zur Kenntnis der Pseudoscorpionidenfauna des
siidlichen Afrika, insbesondere der siidwest- und si'idafrikanischen
Trockengebiete. Eos, Madrid 23:285-339.
Beier, M. 1962. Pseudoscorpioniden aus der Namib-Wiiste. Annals of
the Transvaal Museum 24:223-230.
Beier, M. 1973. Weiteres zur Kenntnis der Pseudoscorpioniden
Siidwestafrikas. Cimbebasia, A 2:97-101.
Beier, M. 1976. Pseudoscorpione von der Dominicanischen Republik
(Insel Haiti). Revue Suisse de Zoologie 83:45-58.
Benedict, E.M. & D.R. Malcolm. 1978. Some garypoid false
scorpions from western North America (Pseudoscorpionida:
Garypidae and Olpiidae). Journal of Arachnology 5:113-132.
Chamberlin, J.C. 1924. Hesperochernes laurae, a new species of false
scorpion from California inhabiting the nest of Vespa. Pan-Pacific
Entomologist 1:89-92.
Chamberlin, J.C. 1930. A synoptic classification of the false scorpions
or chela-spinners, with a report on a cosmopolitan collection of the
same. Part II. The Diplosphyronida (Arachnida-Chelonethida).
Annals and Magazine of Natural History (10) 5:1-48, 585-620.
Chamberlin, J.C. 1931. The arachnid order Chelonethida. Stanford
University Publications, Biological Sciences 7(1): 1-284.
218
THE JOURNAL OF ARACHNOLOGY
Chamberlin, J.C. 1935. A new species of false scorpion (Hesper-
ochernes) from a bird's nest in Montana (Arachnida — Chelo-
nethida). Pan-Pacific Entomologist 11:37-39.
Chamberlin, J.C. 1943. The taxonomy of the false scorpion genus
Synsphyrofuis with remarks of the sporadic loss of stability in generally
constant morphological characters (Arachnida: Chelonethida). An-
nals of the Entomological Society of America 36:486-500.
Chamberlin, J.C. 1952. New and little-known false scorpions
(Arachnida. Chelonethida) from Monterey County, California.
Bulletin of the American Museum of Natural History 99:259-312.
Culver, D.C. 2005. Species interactions. Pp. 539-543. In Encyclopedia
of Caves. (D.C. Culver & W.B. White, eds.). Elsevier, Burlington,
Massachusetts.
Ellingsen, E. 1910. Die Pseudoskorpione des Berliner Museums.
Mitteilung aus dem Zoologischen Museum in Berlin 4:357-423.
Gardini. G. 1983. Ltirca ilalica n. sp. cavernicola dell’Appennino
Abruzzese (Pseudoscorpionida, Garypidae) (Pseudoscorpioni d’lta-
lia XV). Bollettino della Societa Entomologica Italiana 1 15:63-69.
Harvey, M.S. 1986. The Australian Geogarypidae, new status, with a
review of the generic classification (Arachnida: Pseudoscorpio-
nida). Australian Journal of Zoology 34:753-778.
Harvey, M.S. 1987a. Redescriptions of Geogarypiis hncculentus Beier
and G. pustiilatiis Beier (Geogarypidae: Pseudoscorpionida).
Bulletin of the British Arachnological Society 7:137-141.
Harvey, M.S. 1987b. A revision of the genus Synsphyrontis
Chamberlin (Garypidae: Pseudoscorpionida: Arachnida). Austra-
lian Journal of Zoology. Supplementary Series 126:1-99.
Harvey, M.S. 1992. The phylogeny and classification of the
Pseudoscorpionida (Chelicerata: Arachnida). Invertebrate Taxon-
omy 6:1373-1435.
Harvey, M.S. 2002. Short-range endemism in the Australian fauna:
some examples from non-marine environments. Invertebrate
Systematics 16:555-570.
Harvey, M.S. 2011. Two new species of Synsphyroniis (Pseudoscor-
piones: Garypidae) from southern Western Australian granite
landforms. Records of the Western Australian Museum 26:11-22.
Harvey, M.S. & K.L. Edward. 2007. A review of the pseudoscorpion
genus Ideoblothnis (Pseudoscorpiones, Syarinidae) from western
and northern Australia. Journal of Natural History 41:445^72.
Harvey, M.S. & W.B. Muchmore. 2013. The systematics of the
pseudoscorpion family Ideoroncidae (Pseudoscorpiones, Neobi-
sioidea) in the New World. Journal of Arachnology 41:229-290.
Harvey, M.S., P.B. Ratnaweera, P.V. Randeniya & M.R. Wijesinghe.
2012. A new species of the pseudoscorpion genus Megachernes
(Pseudoscorpiones: Chernetidae) associated with a threatened Sri
Lankan rainforest rodent, with a review of host associations of
Megachernes. Journal of Natural History 46:2519-2535.
Harvey, M.S., M.G. Rix, V.W. Framenau, Z.R. Hamilton, M.S.
Johnson, R.J. Teale, G. Humphreys & W.F. Humphreys. 2011.
Protecting the innocent: studying short-range endemic taxa
enhances conservation outcomes. Invertebrate Systematics 25:
1 10.
Harvey. M.S., W.A. Shear & H. Hoch. 2000. Onychophora,
Arachnida, myriapods and Insecta. Pp. 79-94. In Subterranean
ecosystems. (H. Wilkens, D.C. Culver & W.F. Humphreys, eds.).
Elsevier, Amsterdam.
Henderickx, H. & V. Vets. 2002. A new Larca (Arachnida:
Pseudoscorpiones: Larcidae) from Crete. Bulletin of the British
Arachnological Society 12:280-282.
Heurtault, J. 1994. Pseudoscorpions. Pp. 185-196. In Encyclopaedia
biospeologica. (C. Juberthie & V. Decu, eds.). Vol. I. Societe de
Biospeologie, Moulis and Bucarest.
Hoff. C.C. 1945. Ile.sperochernes canadensis, a new chernetid pseudo-
scorpion from Canada. American Museum Novitates 1273:1-4.
Hoff. C.C. 1946a. New pseudoscorpions, chiefiy neotropical, of the
suborder Monosphyronida. American Museum Novitates 1318:1-32.
Hoff, C.C. 1946b. A study of the type collections of some
pseudoscorpions originally described by Nathan Banks. Journal
of the Washington Academy of Sciences 36:195-205.
Hoff, C.C. 1947. The species of the pseudoscorpion genus Chelanops
described by Banks. Bulletin of the Museum of Comparative
Zoology 98:471-550.
Hoff, C.C. 1950. Pseudoescorpionidos nuevos o poco conocidos de la
Argentina (Arachnida, Pseudoscorpionida). Arthropoda, Buenos
Aires 1:225-237.
Hoff, C.C. 1956a. Diplosphyronid pseudoscorpions from New
Mexico. American Museum Novitates 1780:1-49.
Hoff, C.C. 1956b. Pseudoscorpions of the family Chernetidae from
New Mexico. American Museum Novitates 1800:1-66.
Hoff, C.C. 1961. Pseudoscorpions from Colorado. Bulletin of the
American Museum of Natural History 122:409^64.
Hoff, C.C. & J.E. Bolsterli. 1956. Pseudoscorpions of the Mississippi
River drainage basin area. Transactions of the American
Microscopical Society 75:155-179.
Hoff, C.C. & D.L. Clawson. 1952. Pseudoscorpions from rodent
nests. American Museum Novitates 1585:1-38.
Howarth, F.G. 1980. The zoogeography of specialized cave animals: a
bioclimatic model. Evolution 34:394^06.
Howarth, F.G. 1982. Bioclimatic and geological factors governing the
evolution and distribution of Hawaiian cave insects. Entoniologia
Generalis 8:17-26.
Howarth, F.G. 1983. Ecology of cave arthropods. Annual Review of
Entomology 28:365-389.
Judson, M.L.I. 2007. A new and endangered species of the pseudo-
scorpion genus Lagynochthonius from a cave in Vietnam, with notes
on chelal morphology and the composition of the Tyrannochthoniini
(Arachnida, Chelonethi, Chthoniidae). Zootaxa 1627:53-68.
Mahnert, V. 1982. Die Pseudoskorpione (Arachnida) Kenyas, IV.
Garypidae. Annales Historico-Naturales Musei Nationalis Hun-
garici 74:307-329.
Mahnert, V. 1988. Zwei neue Garypininae-Arten (Pseudoscorpiones:
Olpiidae) aus Afrika mit Bemerkungen zu den Gattungen Serianus
Chamberlin und Paraserianus Beier. Stuttgarter Beitriige zur
Naturkunde (A) 420:1-11.
Mockford. E.L. 2009. Systematics of North American species of
Sphaeropsocidae (Psocoptera). Proceedings of the Entomological
Society of Washington 11:666-685.
Moles, M. 1914. A pseudoscorpion from Poplar trees. Journal of
Entomology and Zoology, Pomona College 6:81-83.
Muchmore, W.B. 1974. Clarification of the genera Hesperochernes
and Dinocheirus (Pseudoscorpionida, Chernetidae). Journal of
Arachnology 2:25-36.
Muchmore, W.B. 1981. Cavernicolous species of Larca, Archeolarca
and Pseudogarypiis with notes on the genera, (Pseudoscorpionida,
Garypidae and Pseudogarypidae). Journal of Arachnology 9:47-
60.
Muchmore, W.B. 1982. The genus Anagarypus (Pseudoscorpionida:
Garypidae). Pacific Insects 24:159-163.
Muchmore, W.B. 1984. New cavernicolous pseudoscorpions from
California (Pseudoscorpionida, Chthoniidae and Garypidae).
Journal of Arachnology 12:171-175.
Muchmore, W.B. 1990. Pseudoscorpionida. Pp. 503-527. In Soil
biology guide. (D.L. Dindal, ed.). John Wiley and Sons, New York.
Muchmore, W.B. 1994. Some pseudoscorpions (Arachnida: Pseudos-
corpionida) from caves in Ohio and Indiana, U.S.A. Transactions
of the American Microscopical Society 113:316-324.
Muchmore, W.B. 1996. A remarkable new genus and species of
Pseudoscorpionida (Syarinidae) from a cave in Arizona. South-
western Naturalist 41:145 148.
Muchmore, W.B. 1997. Tnherochernes (Pseudoscorpionida, Cherne-
tidae), a new genus with species in caves in California and Arizona.
Journal of Arachnology 25:206-212.
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
219
Muchmore, W.B. & R.B. Pape. 1999. Description of an eyeless,
cavernicolous Alhiorix (Pseiidoscorpionida: Ideoroncidae) in Ar-
izona, with observations on its biology and ecology. Southwestern
Naturalist 44:138-147.
Peck, S.B. & J.J. Wynne. 2013. Ptomaphagus parashcmt Peck and
Wynne, new species (Coleoptera: Leiodidae: Cholevinae: Ptoma-
phagini): the most troglomorphic cholevine beetle known from
western North America. The Coleopterists Bulletin 67:309-317.
Poulson, T.L. 2005. Food sources. Pp. 255-264. In Encyclopedia of
Caves. (D.C. Culver & W.B. White, eds.). Elsevier, Burlington, MA.
Sato, H. 1983. Hesperochemes shinjoensis, a new pseiidoscorpion
(Chernetidae) from Japan. Bulletin of the Biogeographical Society
of Japan 38:31-34.
Shear, W.A., S.J. Taylor, J.J. Wynne & J.K. Krejca. 2009. Cave
millipeds of the United States. VIII. New genera and species of
polydesmidan millipeds from caves in the southwestern United
States (Diplopoda, Polydesmida, Polydesmidae and Macrosterno-
desmidae). Zootaxa 2151:47-65.
Taylor, S.J. 2003. America, North: Biospeleology. Pp. 45^9. In
Encyclopedia of Caves and Karst Science. (J. Gunn, ed.). Fitzroy
Dearborn, New York, NY.
Wynne, J.J. & K.D. Voyles. 2014. Cave-dwelling arthropods and
vertebrates of North Rim Grand Canyon, with notes on ecology
and management. Western North American Naturalist 74:1-17.
Zaragoza, J.A. 2005. Two new cave-dwelling Lavca species from the
south-east of Spain (Arachnida, Pseudoscorpiones, Larcidae).
Revue Suisse de Zoologie 112:195-213.
Manuscript received 25 May 2014, revised 10 July 2014.
2014. The Journal of Arachnology 42:220-232
A new genus and a new species of scorpion (Scorpiones: Buthidae) from southeastern Mexico
Oscar F. Francke', Rolando Teruel- and Carlos Eduardo Santibanez-L6pez‘: ’Coleccion Nacional de Aracnidos,
Departamento de Zoologia, Instituto de Biologia, Universidad Nacional Autonoma de Mexico, Apto. Postal 70-153,
C. P. 04510, Mexico, D. F., Mexico. E-mail: offb@ib.unam.mx; -Centro Oriental de Ecosistemas y Biodiversidad
(BIOECO), Museo de Historia Natural “Tomas Romay”; Jose A. Saco # 601, esquina a Barnada, Santiago de Cuba
90100, Cuba
Abstract. Chaneke fogoso gen. nov. et sp. nov., are described based on specimens collected near the coast in southeastern
Guerrero, Mexico. The genus is characterized by the peculiar rhomboida! shape of the subaculear tubercle, and the lack of
at least one trichobothrium on the femur, patella and chela of the pedipalp, which make it the second known buthid genus
with decreasing neobothriotaxy on those three pedipalpal segments, together with Alayotityus Armas 1973. Tityopsis ciliciae
Armas & Martin-Frias 1998, from Oaxaca, Mexico, is transferred to the new genus, resulting in Chaneke aliciae (Armas &
Martin-Frias 1998), comb. nov. A cladistic analysis including all other New World “microbuthids” with decreasing
neobothriotaxy, with 30 morphological characters, indicates that Chaneke is monophyletic, clearly distinct from
Alayotityus Armas 1973 (from eastern Cuba) and Tityopsis Armas 1974 (from western Cuba).
Keywords: Decreasing neobothriotaxy, femur, patella, chela
The scorpion family Buthidae C. L. Koch 1837 contains
approximately 90 genera (Ove-Rein 2014), approximately two-
thirds of which have the (3 trichobothrial pattern on the
pedipalp femur, and a third of which have the a trichobothrial
pattern (Vachon 1975). In the New World, there are 1 1 buthid
genera represented, one with the P pattern and the remaining
10 with the a pattern. Six of those genera are orthobothrio-
taxic: femur with 11 trichobothria ( = t), patella with 13 t,
chela with 15 x; and four genera have decreasing neobothrio-
taxy ( = less than the “full” compliment noted above) on some
or all of their species. Alayotityus Armas 1973 lacks femoral x
and patellar x r/-.; Mesotityus Gonzalez-Sponga 1981 lacks
patellar x ch and chela x Eby Microtityus Kjellesvig-Waering
1966 has variable femoral and chelal trichobothrial numbers,
but the patella is always orthobothriotaxic (x r/? present);
Zahiiis Thorell 1893 lacks femoral x d? and chela x esb, but its
three species have patellar x dj present, although reduced in
size ( = petite), and chela x Ebj present.
The genus Tityopsis Armas 1974 has two species from
western Cuba that are orthobothriotaxic, and a Mexican
species that, although it was originally described as being
orthobothriotaxic (Armas & Martin-Frias 1998), was recently
redescribed and shown to be neobothriotaxic (Vidal-Acosta &
Francke 2009). Another neobothriotaxic species was recently
collected in the state of Guerrero, Mexico (Figs. 1, 2), which is
undoubtedly congeneric with Tityopsis aliciae Armas &
Martin-Frias 1998, from the state of Oaxaca (Fig. 3); these
two Mexican species differ from Tityopsis in being neobo-
thriotaxic. The objectives of this contribution are: (a) to
analyze the phylogenetic relationships of the two neobothrio-
taxic Mexican species with other New World buthids which
have an a trichobothrial pattern on the femur, (b) to describe a
new genus for those two Mexican species, and (c) to describe
the new species from Guerrero.
METHODS
Specimens. — The specimens used in this study are lodged
in the following institutions: American Museum of Natural
History, New York, USA (AMNH); Centro Oriental de
Ecosistemas y Biodiversidad, Santiago de Cuba, Cuba
(BIOECO); Coleccion Nacional de Aracnidos, Univ. Nacional
Autonoma de Mexico, Mexico, D. F. (CNAN); Laboratorio
de Entoniologia, Instituto de Diagnostico y Referenda
Epidemiologicos, Secretaria de Salud, Mexico, D. F (IN-
DRE); private collection Rolando O. Teruel, Cuba (ROT).
Specimens examined are listed in Appendix 1 , including the
first known male of T aliciae. Nomenclature and mensuration
for the most part follow Stahnke (1970), with the following
exceptions: metasomal carinal terminology after Francke
(1977), carinal terminology of pedipalp femur and patella
after Acosta et al. (2008) and trichobothrial terminology after
Vachon (1974, 1975). Observations, measurements and
drawings were made using a Nikon SMZ800 stereomicroscope
fitted with lOX ocular micrometer and camera lucida;
photographs were made using a Nikon Coolpix SIO adapted
to the same microscope.
Taxon sampling. — The cladistic analysis presented is based
on 25 temiinal taxa (Appendix 1). Trees were rooted using the
out-group method (Watrous &. Wheeler 1981; Farris 1982;
Nixon & Carpenter 1993). The in-group includes all New World
genera of the family Buthidae with non-imbricated rows of
denticles on the pedipalp chela fingers and which lack
supernumerary denticles along those rows. Three taxa which
have supernumerary denticles are used as out-groups: Rhopa-
liinis jimceus (Herbst 1880); Centruroides exilicauda (Wood
1863), type species of the genus; and Centruroides gracilis
(Latreille 1804), a rather divergent taxon from the type species
of the genus. The tree was rooted with Ananteris platnicki
Lourenpo 1993, which is the New World genus of buthids with a
femoral P trichobothrial pattern and thus distantly related.
Character matrix. — Character data were edited using
WinClada, version 1.00.08 (Nixon 2002). The character matrix
(Appendix 2) comprises 30 characters, eight coded into
multistates and 22 coded into binary states. All characters
(Appendix 3) are informative and are included in all the
analyses and statistics. Multistate characters were treated as
220
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
221
Figure 1. — Habitat at type locality of Cliaiieke fogoso gen. nov. et
sp. nov.
unordered/noii-additive (Fitch 1971), defended by invoking
the principle of indifference, which asserts that if there is
no apparent reason for considering one event to be more
probable than its alternatives, then all should be considered
equiprobable (Wilkinson 1992).
Cladistic analyses. — Analyses were conducted with parsimo-
ny and equal weighting or implied weighting with six values of
the concavity constant (k) = 1, 3, 10, 30, 60 and 100, to assess
the effect of weighting against homoplasious characters (as in
Prendini et al. 2010). All analyses were conducted with TNT ver
1.1 (Goloboff et al. 2008), using a driven search combining three
of the new technology algorithms (excluding ratchet) using a
script file modified from Dimitrov et al. (2013) and Santibanez-
Lopez et al. (in press): hold 90000; rseedl; xm: noverb nokeep:
rat: it 0 up 4 down 4 an 0 man 36 give 99 ecpia; dri: it 10 fit 1.00 rfi
0.20 ant 0 man 36 give 99 xfa 3.00 ecjiia: sect: slack 20: sec: mins
45 maxs 45 self 43 incr 75 minf 10 god 75 drift 6 glob 5 dglob 10
rou 3 xss 10- 14+2 noxev noeq; tf: roii 5 minf 3 best ke nochoo
swap: xm : level 10 nochk rep 50 fn.se 3 dri 10 rss c.ss no.wss mult
nodump conse 5 conf 75 nogive notarg iipda aiitoc 3 xmix; xm;
xmult:;. The relative support for each node was calculated in
TNT using 1000 Jackknife pseudoreplicates (for equal weight-
ing) and symmetric resampling (for implied weighting) with
heuristic searches, consisting of ten random addition sequences,
followed by ten iterations of tree bisection-reconnection,
retaining one tree at each iteration (Dimitrov et al. 2013), and
Figure 2. — Live habitus of Clianeke fogo.so gen. nov. et sp. nov..
dorsal view, paratype = (CNAN).
Bremer support (Bremer 1994), searching suboptimal trees up
to six steps longer, retaining 1000 trees at each iteration. A
preferred hypothesis was selected among the alternative
topologies recovered by the analysis with equal weighting.
RESULTS
Cladistic analyses. — The analysis with equal weighting
produced two most parsimonious trees (strict consensus tree
shown in Fig. 4, Table 2). The monophyly of Chaneke gen.
nov. was recovered by high jackknife and Bremer support
values, and it was placed as sister group of the genus
Alayotityus. Chaneke gen. nov. was supported by the following
characters: (1) the lateral ocelli small and hidden from dorsal
view by a crest (char. 2); (2) carapace without keels (char. 4);
(3) one tergal carinae (char. 5); (4) male genital papillae
without a distinct, fleshy point (char. 7); (5) subaculear
tubercle trapezoidal, with two granules (char. 18); (6) males
with basal lobe on movable finger (char. 20); (7) femoral i i3
petite (char. 25) and (8) by the absence of chela x Eb^ (char. 27;
see figure 1 1 ). Genus Tityopsis was recovered monophyletic
with high jackknife and Bremer support values, and it was
placed as sister of the clade formed by genera Zabins,
Microtityns, Chaneke and Alayotityus (see Fig. 4).
The analyses with implied weighting under four values of the
concavity constant (k = 10, 30, 60 and 100) recovered two trees.
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Map of Oaxaca and Guerrero area plotting known locality records for the two species of Cluineke gen. nov.: Chaneke fogoso, sp.
nov. (circle), Chaneke aliciae (Armas & Martin-Frias), comb. nov. (square).
with the same topologies as in the analysis with equal weighting
(Table 2). However, analyses with implied weighting under two
values of the concavity constant (A' = 1 and 3) recovered three
most parsimonious trees (strict consensus shown in Fig. 5;
Table 2). The monophyly of Chaneke gen. nov. was recovered
with high jackknife and Bremer support values, and it was
placed as a sister group of the clade formed by genera Tityopsis,
Microtityus, Zahhis and Alayotityus as follows: (Chaneke gen.
nov. (Tityopsis (Microtityus (Zahius + Alayotityus)))). Under
those two analyses (k - 1 and 3), Chaneke gen. nov. was
supported by the following characters (1) the trapezoidal shape
of the carapace (char. 0); (2) the lateral ocelli small, dorsally
covered by a crest, visible in frontal aspect (char. 2); (3)
carapace without keels (char. 4); (4) male genital papillae
without a distinct, fleshy point (char. 7); (5-6) males and
females with a whitish patch on sternite (chars. 10; 14); (7) males
with basal lobe on movable finger (char. 20).
None of these analyses recovered Chaneke gen. nov. as sister
group of Tityopsis, and the creation of this new genus, along
with the transfer of Tityopsis aliciae ( = Chaneke aliciae, new
combination) to the new genus, are well supported. The
preferred tree is the strict consensus from the analyses without
weighting and those recovered with concavity values of k = 10,
30, 60 and 100 (Fig. 4), which place Chaneke as sister group of
Alayotityus. These two genera share: (1) males with whitish
patch on sternite III (char. 10); (2) females with whitish patch on
sternite III (char. 14); (3) femoral t (3 petite (char. 24); and (4)
patella i d? absent (char. 26). However, the position of Chaneke
gen. nov. within the family remains unresolved pending a
further study with the inclusion of more genera of buthids.
SYSTEMATICS
Family Buthidae C.L. Koch 1837
Genus Chaneke, gen. nov.
Tityopsis (in part): Armas & Martin-Frias 1998:45; Vidal-
Acosta & Francke 2009:338.
Type species. — Chaneke fogoso. sp. nov.
Other included species. — Chaneke aliciae (Armas & Martin-
Frias, 1998), comb. nov.
Etymology. — “Chanekes” are legendary creatures in Mex-
ican folklore, dating to Aztec times. They are conceived as
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
223
Figure 4. — Strict consensus tree from two equally parsimonious trees (length, 69; Cl, 0.652; RI, 0.878; Fit, 24.55) obtained by the analysis of
30 morphological characters for 25 species in 1 1 buthid scorpion genera, with equal weighting, and with weighting concavity values of k= 10, 30,
60 and 100. Unambiguous morphological synapomorphies optimized on branches: black squares indicate synapomorphies, white squares
indicate homoplasies; numbers above squares indicate characters, numbers below indicate states (see Appendix 3). Jackknife values greater than
50% indicated above branches. Bremer support values indicated below branches.
small, sprite-like beings, elemental forces and guardians of
nature. It is used as a noun in apposition, and is considered
masculine in gender.
Diagnosis. — Relatively small-sized buthid scorpions (adults
approx. 2 cm long — Table 1) with decreasing neobothriotaxy
A ot: pedipalp femur lacking x rA, patella lacking x ch, chela
lacking x Ebs- The eight known species of Alayotityus lack
femoral x d2 and patellar x d2, but have chelal x Ebs\ the three
known species of Zabius lack femoral x d2, but have patellar x
r/2 and chelal x Eby, the two known species of Tityopsis are
224
THE JOURNAL OF ARACHNOLOGY
— Ananteris platnicki
“ Tityus bahiensis
18 19 21
1 1 1
— Centruroides exilicauda
19 24
^ — Centruroides gracilis
1 18
3 0
Rhopalurus junceus
13 15
— Tityus columbianus
— Tityus clathratus
11.
' Mesotityus vondangeli
99
0 2 4 7 10 14 20 I — Chaneke aliciae
28
Chaneke fogoso
Tityopsis inaequalis
Tityopsis inexpectata
Microtityus (M.) rickyi
Microtityus (P.) jaumei
Zabius birabeni
Zabius gaucho
Zabius fuscus
Alayotityus delacruzi
Alayotityus granma
Alayotityus juraguaensis
Alayotityus sierramaestrae
Alayotityus feti
Alayotityus lapidicola
Alayotityus nanus
Alayotityus pallidus
Figure 5. — Strict consensus tree from three most parsimonious trees (length, 71; Cl, 0.634; RI, 0.867; Fit, 24.35; Adjusted Homoplasy, 5.65)
obtained by the analysis of 30 morphological characters for 25 species in 1 1 buthid scorpion genera, with weighting concavity values of L = 1 and
3. Unambiguous morphological synapomorphies optimized on branches: black squares indicate synapomorphies, white squares indicate
homoplasies; numbers above squares indicate characters, numbers below indicate states (see Appendix 3). Jackknife values greater than 50%
indicated above branches. Bremer support values indicated below branches.
9S
10 12 13 14 24 Z
“Q H H OOO”
12 2 10 0
0.50
28
0
orthobothriotaxic. Tergites with a single, median longitudinal
Carina; whereas Alayotityus and Zabius have three carinae,
Tityopsis only one, and Microtityus three or five. Metasomal
segment V without lateral carinae; Zabius and Microtityus also
lack such carinae, Alayotityus and Tityopsis always have well
defined lateral carinae. Subaculear tubercle very large and
rhomboid in lateral view, considerably deeper than wide;
Alayotityus, Tityopsis and Zabius all have a subaculear
tubercle which may be obsolete to moderately developed,
but is always blunt conical. Fixed finger of the pedipalp chela
with 9-10 slightly imbricated rows of denticles; Alayotityus
also has 9-10, Zabius and Tityopsis have 1 1-12. Dentition on
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
225
Table 1. — Measurements in mm of Chaneke fogoso sp. nov. L =
length, W = width.
Holotype
Paratype
Paratype
Paratype
male
male
female
female
Total
L
19.7
20.6
21.3
20.2
Carapace
L
2.8
2.9
3
2.9
W
2.4
2.3
2.5
2.4
Mesosoma
L
6.5
6.7
7.3
7.3
Metasoma
L
10.4
II
11
10
I
L
1.5
1.6
1.6
1.5
W
1.7
1.7
1.7
1.6
II
L
1.9
2
2
1.8
W
1.6
1.5
1.5
1.4
III
L
2
2.1
2.2
2
W
1.5
1.5
1.5
1.3
IV
L
2.3
2.4
2.4
2.2
W
1.5
1.5
1.4
1.3
V
L
2.7
2.9
2.8
2.5
W
1.5
1.5
1.4
1.3
Telson
L
2.4
2.5
2.6
2.3
W
1
1.1
1.1
1.1
Pedipalp
L
9.4
9.7
10.3
9.7
Femur
L
2.3
2.4
2.5
2.4
W
0.8
0.9
0.9
0.9
Patella
L
2.7
2.7
3
2.8
W
1.1
1.2
1.2
1.2
Chela
L
4.1
4.6
4.8
4.5
W
1.5
1.6
1.3
1.3
the fingers of the pedipalp chela without supernumerary
denticles flanking the primary rows (Figs. 9B, C).
Distribution. — Known only from the Mexican states of
Guerrero and Oaxaca, along the southern Pacific Coast
(Fig. 3).
Chaneke fogoso, sp. nov.
Figures 1-6, 8-11 Table 1
Type data. — MEXICO: Guerrero: Municipio de Copala:
Holotype adult S, Microondas Fogos (approx. 15 km ESE
Copala), 16° 33.992'N, 98° 53.301 'W, 103 m, 31 Aug 2008,
U.V. detection, O.F. Francke, H. Montano, C. Santibahez &
A. Valdez (CNAN T-0630). Paratypes: 19 adult <3, 1 subadult
3, 3 adult ?, 3 subadult ?, 2 juveniles, same data as holotype (1
3, 1 $ each at AMNH and BIOECO; remainder at CNAN T-
0631); 1 adult 3 (U.V.), 1 adult ? (sifting leaf litter), same
locality, 6-7 July 2008, O.F. Francke, C. Santibanez & A.
Quijano (CNAN T-0632); 1 subadult 3 (U.V.), same locality,
26 June 2007, O.F. Francke, L. Escalante, J. Ballesteros & H.
Montano (CNAN T-0633).
Diagnosis. — Chaneke fogoso has 10 primary rows of
denticles on both fixed and movable fingers of the pedipalp
chela, whereas Ch. aliciae has only nine. Pectinal tooth count
on males 9-1 1 (mode = 10), on females 8-9 (tied); C/;. fogoso
lacks T Esh on the manus and x esb on the fixed finger of the
pedipalp chela, whereas Ch. aliciae has x Esh and x esb present.
In addition, Ch. fogoso is in general smaller and has a less
robust metasoma than Ch. aliciae (Figs. 6, 7), but also
possesses the smooth, whitish patch of sternite V remarkably
larger and bulkier in adults of both sexes.
Table 2. — Tree statistics for phylogenetic analysis of 25 species in
10 New World buthid scorpion genera. Length, consistency index
(Cl), retention index (RI), Fit and adjusted homoplasy (AH) of most
parsimonious trees (MPTs) obtained by the analyses of the
morphological under equal weighting (EW) and implied weighting
(IW), with six concavity values (k).
MP
L
Cl
RI
FIT
AH
EW
2
69
0.652
0.878
24.55
IW
o
O
II
2
69
0.652
0.878
29.76
0.24
IW
O
SO
II
2
69
0.652
0.878
29.61
0.39
IW
o
II
2
69
0.652
0.878
29.24
0.76
IW
k=10
2
69
0.652
0.878
27.91
2.09
IW
k=3
3
70
0.643
0.872
24.6
5.4
IW
k=l
3
70
0.643
0.872
24.6
5.4
Etymology. — The specific name is a noun in apposition,
“fogoso” in Spanish means “fiery”, “feisty” or “lit-on-fire”,
befitting the generic name; in addition, it alludes to the type
locality.
Description. — Holotype male (Figs. 6A, B): Coloration:
Base color light yellow (straw-colored). Prosoma: carapace
with dense, variegated fuscosity (Figs. 6A, C); venter pale
yellow (Figs. 6B, D). Mesosoma: tergites I-VI with two
complete, transverse fuscous bands — one on all of pre-tergite,
the other on distal one-half of post-tergite; tergite VII with
pre-tergite infuscate, and post-tergite with middle, posterior
and lateral areas infuscate; ventrally pale yellow. Metasomal
segments I-IV faintly, uniformly infuscate on ventromedian,
posterior one-halves of ventrolateral and lateral inframedian,
and distally on lateral supramedian intercarinal spaces;
segment V and telson straw colored. Chelicerae not infuscate.
Pedipalps with diffuse, uniform fuscosity, dorsally on tro-
chanter, femur and patella; fingers on chela pale reddish
brown, feebly infuscate. Legs infuscate on prolateral regions.
Carapace: Coarsely, densely granulose throughout (Fig. 8 A).
Anterior margin bilobed, with shallow median notch; with four
short, blunt-tipped setae. Three subequal ocelli on each side.
Median eyes slightly anterior to one-half the carapace length.
Two moderately strong, longitudinal, submedian carinae on
posterior one-fifth. Ventrally with numerous reddish setae of
various sizes, some pointed, some blunt.
Mesosoma: Tergites with pre-tergite densely, minutely
granulose; anterior one-half of post-tergite sparsely granulose,
shiny; posterior one-half densely, coarsely granulose, matte.
One coarsely granulose median carinae present on distal one-
half of post-tergites I-VI. Tergite VII paramedian and lateral
carinae well-developed, coarsely granulose. Sternum subpen-
tagonal (Figs. 6B, D); with deep indentation posteromedially;
three pairs of setae. Genital opercula completely separated,
with five and six setae respectively; genital papillae without
sharp, pointed end. Pectinal basal piece wider than long, with
shallow anteromedian notch; posterior margin straight
(Fig. 8B). Pectinal tooth count 9-10. Sternites moderately
granulose, with scattered reddish setae throughout; stigmata
small, oval-elongate. Sternite III with two anterolateral
depressions underneath the pectines (where these structures
presumably fit when the animal is at rest). Sternite V with a
conspicuous, circular, white, shiny patch medially along
posterior margin (Fig. 6B). Sternite VII submedian carinae
226
THE JOURNAL OF ARACHNOLOGY
Figure 6. — Chaneke fogoso gen. nov. et sp. nov., habitus, dorsal aspect (A, C) and ventral aspect (B, D). A, B. Holotype S (CNAN); C, D.
Paratype ? (CNAN). Scale bar = 5 mm.
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
227
Figure 7. — Chaneke aliciae (Armas & Mardn-Frias 1998), comb, nov., habitus, dorsal aspect (A, C) and ventral aspect (B, D). A, B. <3
(CNAN); C, D. $ (CNAN). Scale bar = 5 mm.
granulose, well-defined and reaching posterior margin; lateral
carinae barely discernible as short row of five granules
submedially, absent on basal and distal thirds.
Metasoma; Segments I-FV with dorsolateral, lateral supra-
median, ventrolateral and ventral submedian carinae strong,
crenulate; lateral inframedian carinae complete, crenulate
on I-II, absent on III-IV; intercarinal spaces moderately
granulose. Segment V (Fig. 9A) dorsolateral, ventrolateral
and ventromedian carinae strong, granulose; lateral carinae
absent; intercarinal spaces densely, coarsely granulose. Telson
globose; ventrally weakly to vestigially granulose; subaculear
tubercle flat, crest-like, its width same as that of base of
aculeus, ending in a small finger-like projection that points
towards middle of aculeus (Fig. 9A).
Chelicera: Fixed finger with three dorsal teeth; on right side
basal tooth is a bicusp, on left side a sharp monocusp;
ventrally with a single small tooth at level of middle dorsal
tooth. Movable finger with distal tines subequal; dorsally with
228
THE JOURNAL OF ARACHNOLOGY
Figure 8. — Cluineke fogoso gen. nov. et sp. nov., holotype 3 (CNAN). A. Carapace, dorsal aspect; B. Pectinosternal region. Scale bars =
0.5 mm.
a basal bicusp characteristic of the family; ventrally with two
small teeth.
Pedipalp: Femur with prodorsal, retrodorsal, anteromedian
and proventral carinae strong, granulose; intercarinal spaces
moderately to densely granulose, with few clavate setae
distally. Neobothriotaxia A alpha: r/j absent, /? and 4 petite
(Fig. lOA). Tibia heptacarinate, all carinae strong, granulose;
dorsal intercarinal spaces densely granulose, others moderate-
ly to sparsely so, with scattered clavate setae throughout.
Neobothriotaxia A: absent, no petite trichobothria
(Figs. IOC, D). Chela with nine carinae, smooth to feebly
crenulate; intercarinal spaces with moderately dense, small
granulation; with moderately dense, clavate setae throughout,
including both fingers. Movable finger with 10 imbricated
principal rows of granules, fianked by 1 1 inner and nine outer
accessory granules (Fig. 9B), the apical subrow (excluded
from counts) is composed by four granules located just basal
to the terminal denticle. Fixed finger with 10 imbricated
principal rows of granules, flanked by 1 1 inner and nine outer
accessory granules (Fig. 9C). Neobothriotaxia A: lacking Ebj,
Esh and esh (Figs. 1 1 A, B).
Legs: Tibial spurs absent on all legs; prolateral and
retrolateral pedal spurs present on all legs. Patellae and tibiae
with scattered clavate setae; tarsi with moderately dense,
pointed setae.
Variability, — Pectinal tooth counts varied as follows: on
males three combs with nine teeth (7.5%), 22 with 10 (55.0%)
and six with 1 1 (37.5%); on females six combs with eight teeth
(50%) and six with nine (50%).
Variation, — Pedipalp finger dentition was analyzed on six
males and six females (both right and left fingers checked for
each specimen). The number of denticle rows on the fixed
finger was 10 on the 24 fingers checked; the number of inner
accessory granules was 10 on females (10 fingers with 10
granules, two fingers with 11) and 11 on males (two fingers
with 10 granules and 10 fingers with 11 granules), and the
number of outer accessory granules was 10 with no apparent
sexual dimorphism (three fingers with nine granules and 21
fingers with 10). The number of denticle rows on the movable
finger was 1 1 on the 24 fingers counted; the number of inner
accessory granules was 1 1 on females (nine fingers with 1 1
granules and three fingers with 12) and 12 on males (12 out of
12), and the number of outer accessory granules was 11 with
no apparent sexual dimorphism (20 fingers with 1 1 granules,
four fingers [two male, two female] with 12 granules).
Distribution. — This species is only known from the type
locality in the state of Guerrero (Fig. 3).
Remarks. — The locality where the new species was collected
is a well-conserved, land-locked area; it is a small isolated hill
(approx. 200 m high) along the coastal plains and has a
microwave relay station on top. It is in private property,
surrounded by pasture-land and scattered cultivation plots.
The original vegetation on the plain and lower slopes is
tropical deciduous scrub forest, whereas the upper reaches
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
229
Figure 9. — Chaneke fogoso gen. nov. et sp. nov.: holotype cJ (CNAN). A. Lateral aspect of distal portion of metasoma; B. Pedipalp chela
movable finger showing dentition pattern; C. Pedipalp chela fixed finger showing dentition pattern. Scale bars = 0.5 mm.
Figure 10. — Chaneke fogoso gen. nov. et sp. nov.; holotype <3 (CNAN). A. Dorsal aspect of pedipalp femur, showing trichobothria (d2
missing); B. Frontal aspect of pedipalp femur; C. Dorsal aspect of pedipalp patella; D. Posterior aspect of pedipalp patella. Scale bars = 1 mm.
230
THE JOURNAL OF ARACHNOLOGY
Figure ! 1 . — Clumeke fogoso gen. nov. et sp. nov.: holotype <3 (CNAN). A. External aspect of pedipalp chela showing trichobothria; B. Ventral
aspect of pedipalp manus. Scale bars = 1 mm.
receive more moisture and have a mixed tropical lowland
forest component. The upper habitat contains numerous large
boulders, and in protected places the leaf-litter can reach 0.3-
0.4 m in depth (Fig. 1). Most of the specimens were collected
after abundant rains.
Chaneke aliciae (Armas & Martin-Frias 1998), comb. nov.
Figures 3-5, 7
Tityopsis aliciae Armas & Martin-Frias 1998:45-49; Santiba-
nez-Lopez & Ponce-Saavedra 2009:321; Vidal-Acosta &
Francke 2009:333-339.
Type data. — MEXICO: Oaxaccr. Municipio de Santo
Domingo Tehuantepec: Holotype subadult $, [16.31°N,
95.23°W], 30 June 1938, no collector (CNAN-T0173); 1 adult
?, Tehuantepec, Cima street #61, under bricks [16.31°N,
95.23°W], 12 Jan 2006, no collector (INDRE); 1 adult d,
alrededores de Colonia Emiliano Zapata, 16.32026°N,
95.27899°W, 80 m, R. Paredes, C. Santibahez, A. Valdez
(CNAN); 1 adult ?, 2 subadult $, km 23.5 road Salina Cruz to
La Ventosa, 16.39754°N, 95.10094°W, 20 m, C. Santibahez, R.
Monjaraz, A. Valdez, M. Puentes (CNAN).
Diagnosis. — Chaneke aliciae has nine primary rows of
denticles on both fixed and movable fingers of the pedipalp
chela, whereas Ch. fogoso has ten. Pectinal tooth count on
males 10-11, on females 8-9; Ch. aliciae bears x Esh on the
manus and x esh on the fixed finger of the pedipalp chela,
whereas Ch. fogo.so lacks x Esh and x esh. The sexual
secondary dimorphism is slight (as usual for the other
closely-related genera): adult males can be recognized by their
more distally incrassate pedipalp chelae and metasoma,
smaller mesosoma (Pig. 7), presence of genital papillae, and
slight but consistently higher pectinal tooth counts.
Distribution. — This species is only known from the Santo
Domingo Tehuantepec area, in the state of Oaxaca (Fig. 3).
ACKNOWLEDGMENTS
We are grateful to the owners of the ranch surrounding
Microondas Pogos for permission to camp and collect on
repeated occasions on their property. We thank H. Montano, J.
Ballesteros, A. Valdez, A. Quijano, R. Paredes, R. Monjaraz,
M. Fuentes and L. Escalante for their efforts in the field. Diego
Barrales assisted with the photography. Finally, the Associate
Editor and two anonymous reviewers made valuable recom-
mendations to improve this contribution. Collections were done
under “Scientific Collector pennit” FAUT-0175, to OFF from
the SEMARNAT, Mexico.
LITERATURE CITED
Acosta, L.E., D.M. Candido, E.H. Buckup & A.D. Brescovit. 2008.
Description of Zahius gaiicho (Scorpiones, Buthidae), a new species
from southern Brazil, with an update about the generic diagnosis.
Journal of Arachnology 36:491-501.
Armas, L.F. de & E. Martin-Frias. 1998. Presencia del genero
Tityopsis en Mexico y descripcion de una especie nueva (Scor-
piones: Buthidae). Anales de la Escuela Nacional de Ciencias
Biologicas, Mexico 43:45-49.
Bremer, K. 1994. Branch support and tree stability. Cladistics 10:295-304.
Dimitrov, D., L. Lopardo, G. Giribet, M. Arnedo, F. Alvarez-Padilla
& G. Hormiga. 2013. Tangled in a sparse spider web; Single origin
of orb weavers and their spinning work unravelled by denser
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
231
taxonomic sampling. Proceedings of the Royal Society B
279:1341-1350.
Farris, J.S. 1982. Outgroups and parsimony. Systematic Zoology
31:328-334.
Fitch, W.M. 1971. Toward defining the course of evolution:
Minimum change for a specific tree topology. Systematic Zoology
20:406-416.
Francke, O.F. 1977. Scorpions of the genus Diplocentrus from
Oaxaca, Mexico. Journal of Arachnology 4:145-200.
Goloboff, P.A., J.S. Farris & K.C. Nixon. 2008. TNT, a free program
for phylogenetic analysis. Cladistics 24:774-786.
Nixon, K.C. 2002. WinClada, Version 1.00.08. Computer software
and documentation. Online at http://www.cladistics.com [Accessed
on July 2009]
Nixon, K.C. & J.M. Carpenter. 1993. On outgroups. Cladistics
9:413^26.
Ove-Rein, J. 2014. The Scorpion Files. Trondheim: Norwegian
University of Science and Technology. Online at http://www.
ntnu.no/ub/scorpion-fiies/
Prendini, L., O.F. Francke & V. Vignoli. 2010. Troglomorphism,
trichobothriotaxy and typhlochactid phylogeny (Scorpiones,
Chactoidea): more evidence that troglobitism is not an evolution-
ary dead-end. Cladistics 25:1-24.
Santibaiiez-Lopez, C.E. & J. Ponce-Saavedra. 2009. A new species of
Centruroides (Scorpiones: Buthidae) from the northern mountain
range of Oaxaca, Mexico. Revista Mexicana de Biodiversidad
80:321-331.
Santibanez-Lopez, C.E., O.F. Francke & L. Prendini. In Press.
Phylogeny of the North American scorpion genus Diplocentrus
Peters, 1861 (Scorpiones: Diplocentridae) based on morphology,
nuclear and mitocondrial DNA. Arthropod Systematics and
Phylogeny.
Stahnke, H.L. 1970. Scorpion nomenclature and mensuration.
Entomological News 81:297-316.
Vachon, M. 1974. Etude des caracteres utilises pour classer les
families et les genres de Scorpions (Arachnides). 1. La trichobo-
thriotaxie en Arachnologie, Sigles trichobothriaux et types de
trichobothriotaxie chez les Scorpions. Bulletin du Museum
National d’Histoire Naturelle, Paris, (3), 140 (Zool. 104), mai-juin
1973:857-958. (Date on the cover 1973, published January 3i,
1974; see footnote on p. 958).
Vachon, M. 1975. Sur I’utilisation de la trichobothriotaxie de bras des
pedipalpes des Scorpions (Arachnides) dans le classement des
genres de la familla des Buthidae Simon. C. R. Academie des
Sciences Paris, Ser. D 281:1597-1599.
Vidal-Acosta, V. & O.F. Francke. 2009. Redescripcion de Tityopsis
aliciae Armas y Martin-Frias (Scorpiones, Buthidae). Revista
Mexicana de Biodiversidad 80:333-339.
Watrous, L.E. & Q.D. Wheeler. 1981. The out-group comparison
method of character analysis. Systematic Zoology 30:1-11.
Wilkinson, M. 1992. Ordered versus unordered characters. Cladistics
8:375-385.
Manuscript received 8 May 2013, revised August 11 2014.
Appendix 1. — Specimens examined and/or references consulted
during the construction of the character matrix.
1. Ananteris platnicki Lourengo 1993. COSTA RICA: Provincia
Puntarenas: Quepos: El Silencio: Sendero Las Cataratas, 50-
100 m, 6 Sept 2000, L. F. de Armas, C. Viquez, 1 <? (RTO: Sco-
0446). Peninsula de Osa: Puerto Jimenez: Rio Agujas: Estacion
Agujas: Sendero Zamia, 300 m., 2-4 Oct 1997, A. Azofeifa, 1 ?
(RTO: Sco-0189). Provincia Liinou: Reserva Vegetal Hitoy
Cerere: Valle de la Estrella, 4 March 1999, W. Arana, 1 $
(RTO: Sco-0190). Isla Uvita, May-July 2000, A. Berrocol, 1 ?
(RTO: Sco-0191).
2. Alayotityus delacruzi Armas 1973. CUBA: Santiago de Cuba:
Playa Siboney: Cueva de Los Majaes, 27 March 1998, R.
Teruel, N. Navarro, 10 3, 3 9, 6 juv. topotypes (RTO). 18 May
2002, R. Teruel, M. Sobrino, 2 d, 4 9 topotypes (CNAN).
3. Alayotityus feti Teruel 2004. CUBA: Santiago de Cuba: La
Socapa, 26 March 1999, R. Teruel, 1 3 holotype, 6 d, 8 9
paratypes (RTO).
4. Alayotityus granma Armas 1984. CUBA: Granma: Niqiiero: El
Guafe, 2 km al norte de Cabo Cruz, 9-1 1 July 2000, R. Teruel,
L. Montano, Y. Cala, R. Escalona, 8 16 9, 3 juv. topotypes
(RTO).
5. Alayotityus juraguaensis Armas 1973. CUBA: Santiago de
Cuba: Playa Juragua, 6-7 March 1992, R. Teruel, 1 d, 1 9, 8
juv. topotypes (RTO). Same data except 3 July 1992, R.
Teruel, R. Ermus, 1 <3, 2 9 topotypes (RTO).
6. Alayotityus lapidicola Teruel 2002. CUBA: Santiago de Cuba:
Tercer Frente: La Pimienta, 20 April 2000, R. Teruel, R. Vina,
A. Fong, 1 3 holotype, 5 9 paratypes (RTO).
7. Alayotityus nanus Armas 1973. CUBA: Santiago de Cuba:
Puerto Boniato, 9 March 2003, R. Teruel, Y. Perez, 2 3, 5 9
topotypes (BIOECO). Santiago de Cuba: 300 m N El Cobre, 9
Sept 2000, R. Teruel, Y. Perez, 2 3, 5 9 (CNAN).
8. Alayotityus pallidus Teruel 2002. CUBA: Santiago de Cuba:
Julio A. Mella: La Cantera, II March 1999, R. Teruel, 1 3
holotype, 2 3, 1 9, 1 juv. paratypes (RTO). 26 Sept 2003, R.
Teruel, L. F. de Armas, 6 3, 3 9, 8 juv. topotypes (RTO).
9. Alayotityus sierramaestrae Armas 1973. CUBA: Santiago de
Cuba: Guama: Rio La Mula, 15 June 2003, R. Teruel, Y.
Perez, 2 9 (CNAN). 12-21 June 2005, R. Teruel, K. Blanco, A.
Pupo, 6 3, 8 9, 7 juv. (RTO)
10. Centruroides gracilis (Latreille 1804). CUBA: Santiago de
Cuba: Santiago de Cuba city, 28 April 2000, R. Teruel, Y.
Perez, 3 3, 3 9 (CNAN).
11. Centruroides exilicauda (Wood 1863). MEXICO: Baja Cali-
fornia Sur: Loreto, 13 km W to San Javier, provisional dirt
road, 25° 58.817'N, 111° 27.21 1'W, 26 June 2008 (H.
Montano, E. Gonzalez). 17 3, 14 9 (CNAN).
12. Chaneke aliciae (Armas & Martin-Frias 1998). [see material
studied above]
13. Chaneke fogoso Francke, Teruel & Santibaiiez-Lopez 2014.
[see original description above].
14. Mesotityus vondangeli Gonzalez-Sponga 1981. VENEZUELA:
Aragua Estate: Henry Pittier National Park: Rio Cata (±
100 m a.s.L), night search with UVL, upstream from the dam,
6 April 2006, F. J. M. Rojas-Runjaic, 2 3 (lES).
15. Microtityus ( Microtityus) r/c/cj/ Kjellesvig-Waering 1966. [see
Kjellesvig-Waering, 1996].
16. Microtityus ( Parvabsoniis) jatimei Armas 1974. CUBA:
Santiago de Cuba: Playa Siboney, 18 May 2002, R. Teruel,
M. Sobrino, 3 3, 3 9 (CNAN). CUBA: Santiago de Cuba: Playa
Verraco, 4 May 2006, R. Teruel, F. Cala, 9 3, 6 9, 1 juv.
(RTO).
17. Rhopalurus jimceus (Herbst 1800). CUBA: Camagiiey: Siba-
nicii, 20 Feb 1996, R. Teruel, 2 3, 2 9, 10 juv. (CNAN). Same
data except 2 Jan 1997, R. Teruel, A. Basulto, 6 3, 7 9, 5 juv.
(RTO).
18. Tityopsis inaequalis (Armas 1974). CUBA: Pinar del Rio: San
Cristobal: Mameyai, 16 Feb 1981, L. F. de Armas, 1 3 (RTO).
CUBA: Pinar del Rio: Vinales: Hoyo de Fania, 6 Dec 1984, L.
V. Moreno, J. Novo, 1 9 (RTO).
232
THE JOURNAL OF ARACHNOLOGY
19. Tityopsis uiexpectata (Moreno 1940). CUBA: Ciudad de La
Habaiia: Bosque de La Habana. 8-20 Jan 2005, R. Teriiel, D.
Ortiz, 1 d, 4 9, 2 juv. (RTO).
20. Tityiis hahiensis (Perty 1833). BRASIL: Sao Paulo: Sao Paulo,
no date (no colector). 1 cJ, 3 9 (CNAN).
21. Tityus dathratiis C.L. Koch 1844. VENEZUELA: Bolivar
Estate: Cedeno: Gtianiamo (6°05'N-66°02'W, 150 m a.s.l.), no
further data, 4 3, 1 9 (RTO: Sco-0508).
22. Tityus coliiitihiaiius (Thorell 1876). COLOMBIA: Boyacd
Department: Chiquinquira (2,550 ni a.s.l.), under rocks, in
sandy soil, 3 March 2007, L. F. Garcia, 10 3, 9 9, 1 juv. (RTO:
Sco-0372).
23. Zahius biraheni Mello-Leitao 1938. [see Acosta et al. 2008].
24. Zabiiis gauclio Acosta, Candido, Backup & Brescovit 2008 [see
Acosta et al. 2008].
25. Zabius fiiseiis (Thorell 1876) ARGENTINA: Cordoba: La
Cumbre, February 1997, L. Coronel, I 3 (RTO: Sco-0192).
[see also Acosta et al. 2008].
Appendix 2. Distribution of 30 morphological characters (0-29)
scored for a cladistic analysis of 25 species in 1 1 new world buthid
scorpion genera with a trichobothrial pattern. Characters states are
scored 0-5. ? (unknown). Refer to Appendix 1 for material examined
and Appendix 3 for character descriptions.
Allan teris platnieki 0200100010
Mesotityus vondangeli 0101000010
Tityus hahiensis 0101000000
Tityus colunihianus 0101000010
Tityus clathratus 0101000010
Centruroides 0101000000
exilicauda
Centruroides graeilis
Rhopalunis juneeiis
A layotityus delacruzi
Alayotityiis feti
A layotityus grannui
Alayotityiis
0101000000
0301000000
0002011000
0002011000
0002011000
0002011000
jiiragiiaensis
Alayotityiis lapidlcola
Alayotityiis nanus
A layotityus pallidus
Alayotityiis
0002011000
0002011000
0002011000
0002011000
sierraniaestrae
Clianeke alieiae
Clianeke fogoso
Microtityiis ( M. }
rickyi
Microtityiis ( P. )
jaiiniei
Tityopsis inaequalis
Tityopsis inexpectata
Zahius birabeui
Zahius gauclio
Zahius fuscus
1112101100
1112101100
1102021001
1102011001
0102001010
0102001010
0002011000
0002011000
0002011000
1010000040
0011011054
0000000024
0011010024
0011010054
0000000011
0000000012
0000000001
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
111111105
1111111052
0031011042
0011011042
0133011133
0133011133
0111011134
7171011134
0111011134
0011111110
0001010010
1011011110
0011011110
0011011110
1111011110
1111111110
1111011110
0010020111
0010020101
0010020111
0010020111
0010020101
0010020101
0010020101
0010020111
21010010011
1010010001
0001121111
0000121111
0011121111
0011121111
1010121111
7010121111
1010121111
Appendix 3. — List of 30 morphological characters scored for 21
species of New World buthids with a trichobothrial pattern.
Prosonia
0. Carapace shape: trapezoidal (0), triangular (1).
1. Lateral ocelli: two pairs (0), three pairs (1), five pairs (2).
2. Lateral ocelli large, prominent, clearly visible in dorsal aspect
(0), lateral ocelli small, dorsally covered by a crest, visible in
frontal aspect (1).
3. Anterior margin: straight (0), V-notched (1), bilobed (2).
4. Carapace with distinct keels present (0), absent (1).
Mesosonia
5. Tergal carinae: one (0), three (1), five (2).
6. Distal granules on tergites: do not exceed posterior margin (0),
do exceed posterior margin (1).
7. Males with genital papillae with a terminal fieshy, sharp,
distinct point present (0), absent (1).
8. Females with basal intermediate lamella of pectines: normal
(0) , dilated ( 1 ).
9. Females with basal pectinal plate with posterior margin:
normal (0), expanded ( 1 ).
10. Males with whitish patch on sternite III: absent (0), present (1).
1 1. Males with posteromedian area of sternite HI: level (0), raised
and granular ( 1 ).
12. Males with whitish patches on sternite V: absent (0), one
posteromedian, usually oval or heart-shaped ( 1 ), two, trans-
verse and oval (2), three, one posteromedian heart-shaped and
two smaller laterally (3).
13. Females with whitish patch on sternite V: absent (0), one
posteromedian, usually oval or heart-shaped ( 1 ), two, conical
and widely separated (2), three, one posteromedian heart-
shaped and two smaller laterally (3).
14. Females with whitish patch on sternite III: absent (0), present
(1) .
15. Lateral carinae on sternites IV-VI: absent (0), present [two or
four] (1).
16. Respiratory stigmata: long and narrow (0), oval to round (1).
Metasonia
17. Lateral carinae on segment V: absent (0), present (1).
18. Subaculear tubercle: absent (0), smooth spine (1), spinoid with
granules (2), conical (3), crest-like, (4), trapezoidal, with two
granules (5).
Pedipalps
19. Number of denticle rows on pedipalp fingers: eight (0), nine or
ten (1), eleven or twelve (2), thirteen or more (3).
20. Males with basal lobe on movable finger: absent (0), present
(1).
21. Supernumerary denticles on fingers: absent (0), present (1).
22. Terminal macrochaeta on fingers: absent (0), present (1).
23. Femoral i d2: absent (0), present (1).
24. Femoral t 13: petite (0), normal (1).
25. Femoral i 4: absent (0), petite (1), normal (2).
26. Patella i d2 : absent (0), present (1).
27. Chela t Eb3 : absent (0), present (1).
28. Fixed finger t esb: absent (0), present (1).
29. Throughout body, hollow macrochaetae with truncated apex:
absent (0), present (1).
2014. The Journal of Arachnology 42:233-239
Description of Samx buxtoni (Gravely 1915) (Arachnida: Amblypygi: Charinidae) and a new case of
parthenogenesis in Amblypygi from Singapore
Michael Seiter' and Jonas WolfF: 'Group of Arthropod Ecology and Behavior, Division of Plant Protection,
Department of Crop Sciences, University of Natural Resources and Life Sciences, Peter Jordan StraBe 82, 1 190 Vienna,
Austria. E-mail: michael.seiter@boku.ac.at; -Zoological Institute, Functional Morphology and Biomechanics,
University of Kiel, Am Botanischen Garten 9, 24118 Kiel, Germany
Abstract. The type material of Samx buxtoni (Gravely 1915) cannot be located and has to be considered as lost. Therefore, a
description compiled from a population in Singapore is provided, including morphological and taxonomical details presented for
the first time. Comparisons with closely related species are supplied. Furthermore, we describe the occurrence of parthenogenesis
in a population of S. buxtoni, representing the first case of asexual reproduction in a member of the genus Samx Simon 1892.
Keywords: Whip spiders, asexual reproduction, Southeast Asia
Amblypygi, popularly called whip spiders, are characterized
by their dorso-ventrally flattened body and strong, raptorial
pedipalps armed with spines. The first pair of legs is extremely
elongated and antenniform. These body appendages serve
important multisensory functions and play important roles
during mating, hunting, and antagonistic behavior (Weygoldt
2000). According to Prendini (2011), recent Amblypygi
currently include five families, 17 genera and 161 species.
Harvey (2013) mentioned 186 species and at the last count
(Seiter & Horweg 2013), the group expanded by two newly
described species of the genus Heterophrynus Pocock 1894
(Giupponi & Kury 2013) and one species of the genus Phrynus
Lamarck 1801 (Armas et al. 2013), elevating the number to 189
species. In Southeast Asia, the whip spider fauna includes four
families (Charinidae, Charontidae, Phrynidae and Phrynichi-
dae), with Sarax Simon 1892 (Charinidae) being the most
diverse genus. Its 17 species are distributed in continental and
insular Southeast Asia and Oceania with Papua New Guinea
as the most eastern occurrence and India at the most western
(Harvey 2003, 2013; Giupponi & Miranda 2012). Harvey
(2003) further listed Sarax mediterraneus Delle Cave 1986
from Greece which is still included in Harvey (2013) and
would, therefore, represent the most western distributed
species of the genus Sarax Simon 1892. However, Weygoldt
(2005) wrote about this doubtful record “[...] Therefore 1
suppose that somebody confused specimens and labels and
erroneously replaced three Charinus specimens by three Sarax
specimens (Weygoldt 2005: 12-13). Since then, nobody
discovered the error and correctly identified these specific
specimens, which are held in the SMF (Senckenberg-Museum,
Frankfurt am Main, Germany). If S. mediterraneus is a valid
species, the genus would contain 18 species.
Parthenogenesis in Amblypygi is reported from two species,
both belonging to the family Charinidae: Charinus acosta
(Quintero 1893) and Charinus ioanniticus (Kritscher 1959)
(Armas 2000, 2005; Weygoldt 2005, 2007). Charinus acosta
occurs in Cuba and is reported from, different places through
the country (Teruel 2011). Charinus ioanniticus is distributed
around parts of the eastern border of the Mediterranean and
represents the sole amblypygid occurring in Europe, if the
reported occurrence of S. mediterraneus is truly due to a
misidentification. The European populations of C. ioanniticus
are located on the Greek islands of Rhodes, living in
subterranean passages of the ancient city of Rhodes, and
Kos (Kritscher 1959; Weygoldt 2005). The population on
Rhodes is an all-female population that reproduces parthe-
nogenetically (Weygoldt 2007). Charinus ioanniticus has also
been reported from Turkey (Kovafik & Vlasta 1996; Weygoldt
2005; Seyyar & Demir 2007), Israel (Rosin & Shulov 1960)
and Egypt (El-Hennawy 2002), however all these reported
populations reproduce sexually and males are present.
Sarax buxtoni (Gravely 1915) was first described under the
name Phrynichosarax buxtoni with the type locality in Kubang
Tiga cave, Perlis, Malaysia. Weygoldt (2000) considered
Phrynichosarax to be a junior synonym of Sarax and transferred
P. buxtoni to Sarax. Harvey (2003) transferred all of the
remaining taxa from Phrynichosarax to Sarax. The diagnostic
characters of the family Charinidae and the genus Sarax are
discussed and revised in Rahmadi et al. (2010). In Singapore,
two species of the genus Sarax occur: S. buxtoni and Sarax
singaporae Gravely 1911, the latter distributed in Malaysia and
Singapore (the type locality is the Singapore Botanic Garden)
(Harvey 2003). Weygoldt (2002) described the spenn transfer
and the mating behavior of S. buxtoni collected in Singapore,
but without clear description of the locality (“outskirts of
Singapore” mentioned as the collection site). Furthermore, the
author used the moderate description and poor figures of
Gravely (191 1, 1915) to identify the species. The type material of
this study could not be found, and the former identification is
unreliable because of the incomplete description of S. buxtoni by
Gravely (1911, 1915). Considering the incorrectly identified
material of Weygoldt’s study about the sexual reproduction of
this species and our data about asexual reproduction in this
species, here we provide (i) a detailed description of Sarax
buxtoni from Singapore and (ii) a report of the first case of
parthenogenesis in a Sarax species, which is the first known case
of asexually reproducing amblypygids in Southeast Asia.
METHODS
Specimens of Sarax buxtoni were collected in Singapore,
North West District, near Turf Club at 1° 19' 29.47"N, 103°
47' 25.97"E in a small park within the city. The specimens were
found under an artificial stone cairn next to a small runlet.
233
THE JOURNAL OF ARACHNOLOGY
234
Figure 1. — Photographs of living adult Sarax individuals in standard plastic terraria. A: S. buxtoni, female. B; S. singaporae, female right,
male left (NHMW 21893). Note the sexual dimorphism in the length of the pedipalps.
This was the only stony place in an area of one square
kilometer. Here, within half of a square meter, many female
specimens were found living next to each other, sitting on the
underside of stones in a very humid environment, protected
from the sun and rain by the vegetation. Sarax singaporae was
found in similar microhabitats in Singapore, South West
District, on the outskirts of Singapore, Jurong Bird Park at
1° 19' 7.34"N, 103° 42' 23.19"E. Nevertheless, this species was
not found in high densities like S. buxtoni and was found to
live mainly under stones and also in the leaf litter.
In the laboratory, we reared both species in plastic terraria of
different sizes using standard methods. The enclosures contained a
2 cm deep layer of soil and pieces of bark in which the specimens
could hide. Food consisted of cricket nymphs, Acheta domestica
(Linnaeus 1758) and fruit flies, Drosophila melanogaster Meigen
1830. We kept all individuals under the same conditions (T = 26-
27°C; RH = 65-75%) and fed them at the same intervals every
seven days. Offspring were separated just after leaving the backs of
the females and were raised under the same conditions as adults.
All dead individuals were stored in 70% ethyl alcohol. Specimens
were studied, measured and photographed under a stereomicro-
scope (Leica M205A) equipped with a Leica DFC420 camera, and
digital images were processed using Adobe Photoshop 8.0.
The specimens were identified using the key and description
of Gravely (1911, 1915) and compared with the voucher
material from Weygoldt (2002). Nomenclature of the pedi-
palpal spines follows Quintero (1983a), modified according to
Shultz (1990): pedipalps are divided into trochanter, femur,
patella, tibia and tarsus (distitarsus+pretarsus or claw).
Abbreviations. — NHMW = Natural History Museum
Vienna, SMF = Senckenberg Museum Frankfurt, SMNS =
Staatliches Museum fiir Naturkunde Stuttgart, leg. = legit
(collected), det. = determinavit (determined), syn = synony-
mized, d = male / ? = female.
Material examined. — Sarax buxtoni: Holotype of Sarax
hatuensis Roewer 1962: Malaysia: 3 ?, 6 juveniles, Selangor,
Batu caves (in different parts of the cave), 1959/60, leg. H.E.
McClure (SMF 9913906 - RII/13906/51 - 68). Republic of
Singapore: 4 $ adult (wild caught), 1 $ juvenile (wild caught),
Singapore, North West District, near Turf Club, 1° 19'
29.47"N, 103° 47' 25.97"E, 14 September 2010, leg. and det. M.
Seiter (NHMW 21891);! ? adult (captive bred), 3 9 juvenile
(captive bred), same data (NHMW 21892).
Sarax singaporae: Republic of Singapore: 1 d adult (wild
caught), Singapore, South West District, outskirts of Singa-
pore, near Jurong Bird Park, 1° 19' 7.34"N, 103° 42' 23.19"E,
14 September 2010, leg. and det. M. Seiter (NHMW 21893);
2 9 adult, 1 d adult (wild caught), same data except 2009, leg.
S. Huber, det. M. Seiter (NHMW 21894); 3 9 adult, 2 d adult,
2 juveniles (wild caught), same data except 27 June 1992, leg.
S. Huber, det. M. Seiter (SMNS).
SYSTEMATICS
Family Charinidae Quintero 1986
Genus Sarax Simon 1892
Sarax buxtoni (Gravely 1915)
(Figs. lA, 2-3)
Phrynichosarax buxtoni Gravdy 1915: 439-440, Fig. 4; Mello-
Leitao 1931: 52 (as Phrynicosarax [sic] buxtoni); Speijer
1937: 173; Weygoldt 1994: 244.
Sarax batiiensis Roewer 1962: 519-520, Figs. 3a-b (syn. by
Kraus 1970: 178).
Sarax buxtoni (Gravely): Harvey 2003: 8.
Diagnosis. — Sarax buxtoni can be distinguished from the
closest geographical and morphological related species Sarax
singaporae by the following characters: (i) chelicera: dorsum
with five fine lateral setae in S. singaporae and none in S.
buxtoni (Figs. 21, L); (ii) moveable hand on the chelicera: in S.
singaporae with three highly cuspid teeth not equal in size,
instead of equal size and rounded (Figs. 21, L); (iii) sternum
SEITER & WOLFF— PARTHENOGENESIS IN SAHAX BUXTONI
235
Figure 2. — A-D, H, I, J: Sarax buxtoni, female; E-G, K, L, M: Sarax singaporae (F, G, L male; K, M female). A: habitus, dorsal. B, F:
pedipalp, dorsal. C, G: pedipalp, ventral; dorsal spines of femur and patella numbered, tr: trochanter; fe: femur; pa: patella; ti: ibia; ta: tarsus. D,
E: Basitibia and distitibia of walking leg IV, dorsal; trichobothria marked; basitibia (bt = basitibial), distitibia (bf: basofrontal; be: basocaudal;
sbf: subbasofrontal; scl-x: series caudal and trichobothria, sfl-x: series frontal and trichobothria). H, K: prosoma, ventral; sternae numbered in
H. I, L: chelicera. J, M: pedipalp, distal parts, prolateral. Arrowheads indicate diagnostic characters in 5. singaporae, ti: tibia; dta: distitarsus;
pta: pretarsus (claw). Arrowheads indicate diagnostic characters; scale bar: A-C, F, G: 1 mm, D, E, H, I: 0.5 mm.
236
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Images of the distal pedipalp in Sai ax hiixtoni, adult female. Scale bars; I mm. A: An individual with normal spination on the right
pedipalp tibia and distitarsus (SMF 9913906 - RII/13906/51 - 68). B: Another individual with an anomaly on the right pedipalp, indicated
by arrow.
ventrally: with three visible sternites (second and third one
rounded with apical paired setae) in S. siugaporae instead of
four (Figs. 2H, K); (iv) pedipalp tibia spination on the antero
dorsal margin: proximal spine only 1/3 longer than distal one
in S. siugaporae, and without clear shared basin (Figs. 2J, M);
and (v) pedipalp tarsus spination on the antero dorsal margin:
about equal in size in S. siugaporae instead of the proximal one
more than half of the length of the distal one (Figs. 2J, M).
Description of adult female (from Singapore). — Coloratiou
( iu alcohol): Chelicerae, pedipalps and carapace yellowish.
Legs light colored (Fig. 2D); iu life: Pedipalps and carapace
light reddish. Opisthosoma light brown with light lines. Legs
light brown to reddish.
Carapace (Figs. lA, 2A).' Carapace ratio width to length
about 2:1.4; surface finely granulated without setiferous
tubercles; median sulcus present with three sulci laterally on
each half of the carapace reaching to the edge of the flange;
fiange wide and bend upward; anterior margin rounded, with
six fine large frontal setae and several small ones. Median eyes
without setae, tubercle black, arranged more or less in an oval
form with prominent fovea; eyes facing antero-laterally.
Figure 4. — Sarux siugaporae (SMNS): adult female, pedipalp
distitarsus. Arrow indicates diagnostic character, illustrating the
typical spination. Scale bar: 1 mm.
Lateral eyes close to the lateral margin of carapace, distance
between lateral eyes about diameter of lateral eye, normal
pigmentation. Frontal process triangular, visible from above.
Prosouial steruiiui (Fig. 2H).- First sternite (tritosternum)
elongated with paired apical, median and strong basal setae;
second sternite less elongated but more than the following
ones, with paired apical setae and one median seta; third
sternite rounded and flattened with paired apical setae; fourth
sternite (metasternum) visible with 1 seta in the middle.
Opisthosoma (Figs. lA, 2A).- Light brown, each tergite with
a marginal yellow line, light-brown spots on either side of
middle line.
Chelicera (Fig. 21).' Dorsum smooth with one fine frontal seta.
Basal segment with four teeth. Lowennost tooth largest, and
uppennost tooth is bicuspid, with upper cusp larger than lower
one. Outer surface with small blunt tooth opposite bicuspid tooth;
moveable hand with three teeth about equal in size.
Pedipalp: short and stout. Trochanter (Figs. 2B, C) with
several small setiferous tubercles on antero-dorsal margin, one
spine and nine setiferous tubercles ventrally; ventral anterior
apophysis equipped with several prominent setiferous tubercles.
Femur (Fig. 2B, C) with four major spines antero-dorsally
(length F3 > FI > F2 > F4), one minor spine between F2-F3,
one minor spine between F3-F4, several setiferous tubercles
and small tubercles; femur with four major antero-ventral
spines (length FI > FII > Fill > FIV), small tubercles present.
Patella (Fig. 2B, C), antero-dorsal face with four major spines
(length PI > P2 > P3 > P4), with two minor spines, several
setiferous tubercles and small tubercles; patella with three major
spines (length PI > PII > Pill > PIV), several setiferous
tubercles and small tubercles. Tarsus (Fig. 2J) with two major
spines on antero-dorsal margin, length of proximal spine more
than half length of distal one, one minor spine proximally,
several setiferous tubercles and small tubercles; antero-dorsal
margin with one major spine, several setiferous tubercles and
small tubercles; distitarsus (dta) and claw (pta) divided, with
two denticles on antero-dorsal margin, proximal denticle more
than half length of distal one, distal one more curved towards
the base as the proximal one; cleaning organ ventrally with
around 30 modified hairs, several blunt setae on inner surface of
tarsus, apotele present.
Legs: Tibiae II and III 4-segmented; basitibia IV 3-
segmented; fourth segment with ht close to distal margin, he
in middle of /^/’and .y/7/’(Fig. 2D), pulvilli present.
SEITER & WOLFF— PARTHENOGENESIS IN SARAX BUXTONl
237
Table 1. — Reproductive events, dated, of consecutively numbered, wild-caught, female Sarax huxtoni and, in the cases of #2/1 and #2/2,
captive-born female progeny of #2. Shaded entries indicate hatches of individuals from brood sacs produced after the parent had molted.
Individuals #5-#9 produced brood sacs but it cannot be guaranteed that these individuals had not been previously inseminated. Most of the
captive-hatched offspring died several days after molting, but two of them ultimately produced progeny without first being inseminated (#2/1
and # 2/2). E = brood sac visible; M = molted; H = hatched; iiD = no data available.
Female ID
Sequence of events
#1
E 09.12.2011
M 24.03.2011
E 02.06.2011
H
24.07.2011
#2
E 09.12.2011
H 22.01.2011
#2/1
M 16.04.2011
M 16.07.2011
iiD
H
03.01.2014
#2/2
M 22.04.2011
M 30.07.2011
nD
H
12.12.2013
#3
M 02.01.2011
E 03.04.2011
H 25.05.2011
#4
E 29.10.2010
#5
E 05.11.2010
H 06.01.2011
E 04.03.2011
#6
E 13.11.2010
#7
E 19.11.2010
H 12.01.2011
#8
E 17.11.2010
#9
E 09.12.2010
Genitalia: Covered ventrally with genital operculum slightly
concave apically, paired with two tubes projecting medially.
Measurements. — Largest female (n=J): Body length
7.29 mm. Carapace length: 2.78 mm, width: 4.07 mm. Median
eyes to anterior margin of carapace 0.18 mm. Distance
between lateral eyes 2.17 mm. Pedipalps: femur 2.49 mm,
patella 2.58 mm, basitarsus 1.28 mm, distitarsus and pretarsus
(claw) 1.71 mm.
Remarks. — The largest specimen of the nine specimens of S.
buxtoni from Batu Cave (SMF 9913906 - RII/1 3906/5 1-68)
has a notable anomaly. The pedipalp spination has been used
extensively for systematic research and is an important
character. Therefore the special spination of the right tarsus
should be mentioned (Fig. 3B). Usually S. buxtoni has two
spines on each distitarsus: large and conspicuous, the distal
one about twice as long as the proximal one, the distal one is
more curved near its base than is the proximal one (Fig. 3A).
This especially large female bears three spines on the right
pedipalp finger instead of two. The distal spines are about
twice as long as the proximal one and the intermediary spine is
one fifth smaller than the proximal one (length Till > I > 11).
All three spines are equally curved. The rest of the spination is
similar to the Singapore all-female population described here.
Parthenogenesis. — Nine adult females were used for this
study. All of them produced at least one brood sac but only
three of them can be guaranteed not to have been inseminated
prior to brood sac production (Table 1). However, the
possibility that only females were selectively caught is very
low and can be disregarded. Three of the wild caught females
molted and then produced a fertile brood. Of the hatching
praenymphs (Table 1: #1, #2, #3), two individuals reached
adulthood and reproduced independently, completely isolated
from other individuals since birth. It should be mentioned,
that several brood sacs were dropped and eaten by the females
over time. Many of the praenymphs died during the first days,
or did not eat Drosophila or small cricket nymphs.
DISCUSSION
The following discussion is subdivided into the three major
parts of this paper.
Description. — Gravely (1911) reported the discovery of a
new subspecies of Sarax sarawakensis: S. s. singaporae, from
Singapore. Later Gravely (1915) elevated this taxon to species
rank under the generic name Phrynichosarax singaporae. In
the same paper, based on two individuals (one adult female,
one immature), Gravely (1915) described a new species,
Phrynichosarax huxtoni, with the type locality in Kubang
Tiga cave, Peiiis, Malaysia. The original description is rather
basic with a poor figure of the distitarsus spination intended to
distinguish it from other species. For the description of S.
huxtoni, we wanted to guarantee the validity and acceptance of
the specimen used here. However, since the type specimen
cannot be located, we decided to provide a detailed
description. As the type locality is located in mainland
Malaysia, we have limited our description to our specimen
from Singapore. Here, we present for the first time a complete
description of S. buxtoni with a demonstration of basic
differences from the closely related S. singaporae.
Parthenogenesis. — Parthenogenesis is well known among
arachnids, including: mites (Acari), harvestmen (Opiliones),
true spiders (Araneae: Araneomorpliae), pseudoscorpions
(Pseudoscorpiones) and scorpions (Scorpiones). However, so
far, parthenogenesis in whip spiders has only been reported in
two species: Charinus acosta and C. ioanniticus (Armas 2000;
Weygoldt 2007). It is reported that during molting whip
spiders lose all stored spermatozoa (Weygoldt 1999). Yet to
insure that sperm storage during molting events can be ruled
out, we raised S. huxtoni specimens for two generations
isolated from one another. Based on the observation of newly
collected female specimens raised in captivity for two
generations, we found that S. buxtoni is capable of partheno-
genetic reproduction. The description of sexual reproduction
in S. singaporae [misidentified by Weygoldt (2002) as S.
buxtoni\ from Singapore is now established. We argue that the
specimens used by Weygoldt (2002) were wrongly identified
based on our diagnosis above (Fig. 4). So the former described
sexual behavior in this study belongs to S. singaporae and not
S. buxtoni. Thus there is no male known from S. huxtoni
populations because the type material cannot be found and is
unavailable for study. However, our data do not allow us to
determine whether this population is facultatively or obligately
reproducing asexually. The type material consisted of two
specimens: one adult female and one immature specimen not
sexed. This sample size is rather low, though we cannot say if
238
THE JOURNAL OF ARACHNOLOGY
the type locality is also a parthenogenetic population or not.
Nevertheless, it could be possible that the population
described here is facultatively reproducing asexually with a
low prevalence or absence of males. Because of the location of
the presumed all-female population in a small park, com-
pletely isolated by the city and concrete roads, a possible
restriction to parthenogenetic reproduction could be compa-
rable to the “insular parthenogenesis” described by Cuellar
(1977, 1994).
Testing if females from this population can reproduce with
males from other populations would verify if these females are
obligately parthenogenetic or not. Conversely, it would be
interesting to check if isolated females of other S. buxtoni
populations, in which both sexes occur, are able to give birth
without insemination to determine if facultative parthenogen-
esis is a common trait of S. buxtoni. Of interest is the fact that
many of the praenymphs died during the first few days after
emergence. We can argue that it is usually very tricky to raise
and breed such small species over several generations, so this
case is unlikely to be associated directly with possible
deficiency caused by all-female brood resulted from non-
fertilized eggs (as it is usual for thelytokous parthenogenesis).
Anomaly. — A similar case of asymmetrical spine transfor-
mation in the genus Sarax was yet unknown and, therefore,
can be considered as very uncommon. Only a few asymmetries
and anomalies are documented in recent literature, e.g.
Paraphrynus aztecus (Pocock 1894) (as P. azteca [sic]) has
bifid spines (Quintero 1983b). Here an adult male from
Oaxaca, Mexico exhibited a transformation of spines III and
V of the right pedipalp patella into bifid apophyses. In
contrast the left pedipalp showed normal spination. Rowland
(1973) reported an unidentified Paraphrynus Moreno 1940
species from Mexico with different length of spines on the
pedipalp. Another case was documented by Baptista &
Giupponi (2002) where asymmetry in the number of pseudo-
articles of the basitibia in Charinus troglobius Baptista &
Giupponi 2002 (four in general, but five in the right leg of
two males) occurred. Armas & Gonzalez (2001) showed
different examples of anomalies in the pedipalps of Phrynus
eucharis Armas & Gonzalez 2001, P. hispaniolae Armas &
Gonzalez 2001 and P. marginemaculatiis C.L. Koch 1840 from
the Dominican Republic. The first author (MS) observed a
Paraphrynus species, most likely P. mexicanus (Biliniek 1867)
from Mexico, with bifid spines similar to the documented
single P. aztecus specimen. Nevertheless, the anomaly
observed in the S. buxtoni specimen is very uncommon and
even deviates from the basic definition of the genus Sarax:
pedipalp tibia with two spines, the distal one larger than the
proximal one (Fig. 3B).
ACKNOWLEDGMENTS
First, we are greatly indebted to Rolando Teruel (BIOECO,
Cuba) for his kind continuous support. We also thank
Siegfried Huber (Oberuhldingen, Germany) and Peter Wey-
goldt (Freiburg, Germany) for their lifelong contribution on
whip spiders and their support whenever we ask for it.
Stanislav Gorb (University of Kiel, Germany) is acknowl-
edged for giving us access to microscopy devices. Further,
we thank Frederic Schramm (Marburg, Germany) and an
anonymous reviewer for their detailed peer-review.
LITERATURE CITED
Armas, L.F. de. 2000. Parthenogenesis in Amblypygi (Arachnida).
Avicennia 12/13:133-134.
Armas, L.F. de. 2005. Notas sobra la biologi'a reproductiva del
amblipigido partenogenetico Charinus acosta (Quintero, 1983)
(Amblypygi: Charinidae). Boletin de la Sociedad Entomologica
Aragonesa 36:271-273.
Armas, L.F. de. & A.P. Gonzalez. 2001. Los amblipigos de Republica
Dominicana (Arachnida: Amblypygi). Revista Iberica de Aracno-
logia 3:47-66.
Armas, L.F. de., C. Viquez & R.E. Trujillo. 2013. Nueva especie de
Phrynus Lamarck, 1801 (Amblypygi: Phrynidae) de Guatemala y
Honduras. Revista Iberica de Aracnologia 23:25-31.
Baptista, R.L.C. & A.P. Giupponi. 2002. A new troglomorphic
Charinus from Brazil (Arachnida: Amblypygi: Charinidae). Revista
Iberica de Aracnologia 6:105-110.
Cuellar, O. 1977. Animal parthenogenesis. Science 197:837-843.
Cuellar, O. 1994. Biogeography of parthenogenetic animals. Biogeo-
graphica 70:1-13.
El-Hennawy, H.K. 2002. The first record of Amblypygi from Egypt.
Journal of Arachnology 30:452M53.
Giupponi, A.P. & A. Kury. 2013. Two new species of Heterophrynus
Pocock, 1894 from Colombia with distribution notes and a new
synonymy (Arachnida: Amblypygi: Phrynidae). Zootaxa 3647:
329-342.
Giupponi, A.P. & G.S. Miranda. 2012. A new species of Sarax
Simon, 1892 from the Philippines (Arachnida: Amblypygi:
Charinidae). Anais da Academia Brasileira de Ciencias 84:
165-173.
Gravely, F.H. 1911. Notes on Pedipalpi in the collection of the Indian
Museum. 1. New Pedipalpi from Ceylon. Records of the Indian
Museum 6:33-36.
Gravely, F.H. 1915. A revision of the Oriental subfamilies of
Tarantulidae (order Pedipalpi). Records of the Indian Museum
11:433-455.
Harvey, M.S. 2003. Catalogue of the smaller arachnid orders of the
world: Amblypygi, Uropygi, Schizomida, Palpigradi, Ricinulei and
Solifugae. CSIRO Publishing Huntingdon, Collingwood, Victoria,
Australia.
Harvey, M.S. 2013. Whip spiders of the World, version 1.0. Western
Australian Museum, Perth. Online at http://museum.wa.gov.au/
catalogues-beta/whip-spiders [accessed 06 March 2014],
Kovarik, F. & D. Vlasta. 1996. First record of Amblypygi
(Charinidae: Charinus ioanniticus) from Turkey. Klapalekiana
32:57-58.
Kraus, O. 1970. Genitalmorphologie und Systematik der Amblypygi
(Arachnida). Bulletin du Museum National d’Histoire Naturelle,
Paris 41:176-180.
Kritscher, E. 1959. Ergebnisse der von Dr. O. Paget und Dr. E.
Kritscher auf Rhodes durchgefuhrten zoologischen Exkursionen,
II Pedipalpi (Amblypygi). Annalen des Naturhistorischen Muse-
ums Wien 63:453M57.
Mello-Leitao, C. 1931. Pedipalpos do Brasil e algumas notas sobre a
ordem. Archives do Museu Nacional 33:7-72.
Prendini, L. 2011. Order Amblypygi Thorell, 1883. In Animal
Biodiversity: an Outline of Higher-level Classification and Survey
of Taxonomic Richness. (Z.-Q. Zhang, ed.). Zootaxa 3148:154.
Quintero, D. Jr. 1983a. Revision of the amblypygid spiders of Cuba
and their relationships with the Caribbean and continental
American amblypygid fauna. Studies on the Fauna of Curasao
and other Caribbean Islands 65:1-54.
Quintero, D. Jr. 1983b. Bifid spines in Paraphrynus azteca (Pocock)
(Amblypygi: Phrynidae). Journal of Arachnology 11:99-100.
Rahmadi, C., M.S. Harvey & J. Kojinia. 2010. Whip spiders of the
genus Sarax Simon, 1892 (Amblypygi: Charinidae) from Borneo
Island. Zootaxa 2612:1-21.
SEITER & WOLFF^PARTHENOGENESIS IN SAMAY BUXTONI
239
Roewer, C.F. 1962. Einige Arachniden aus den Batu Caves in
Malaya. Pacific Insects 4:517-520.
Rosin, R. & A. Shulov. 1960. Representatives of the order Amblypygi
(Arachnida) found in Israel. Bulletin of the Research Council of
Israel 9B: 167-168.
Rowland, J.M. 1973. Two new troglobitic Amblypygid of the genus
Tarantula from Mexican Caves (Arachnida). Bulletin of the
Association for Mexican Cave Studies 5:123-128.
Seiter, M. & C. Horweg. 2013. The whip spiders collection
(Arachnida, Amblypygi) held in the Natural History Museum
Vienna, Austria. Arachnologische Mitteilungen 46:47-53.
Seyyar, O. & H. Demir. 2007. A new locality for Charinus ioanniticus
(Kritscher, 1959) (Amblypygi: Charinidae) in Turkey. Serket 10:
109-111.
Shultz, J.W. 1990. Evolutionary morphology and phylogeny of
Arachnida. Cladistics 6:1-38.
Speijer, E.A.M. 1937. A collection of pedipalps from the Raffles
Museum. Bulletin of the Raffles Museum 13:171-175.
Teruel, R. 2011. Nuevos registros de Charinus acosta (Quintero, 1983)
en Cuba (Amblypygi: Charinidae). Boletin de la Sociedad
Entomologica Aragonesa 49:345-346.
Weygoldt, P. 1994. Amblypygi. Pp. 241-247. In Encyclopaedia
Biospeologica. (C. Juberthie & V. Decu, eds.). Societe de
Biospeologie: Moulis and Bucarest.
Weygoldt, P. 1999. Spermatophores and evolution of female genitalia
in whip spiders (Chelicerata, Amblypygi). Journal of Arachnology
27:103-116.
Weygoldt, P. 2000. Whip Spiders: Their Biology, Morphology and
Systematics. Apollo Books, Sternstrup.
Weygoldt, P. 2002. Sperm transfer and spermatophore morphology of
the whip spiders Sarax buxtoni, S. brachydactylus (Charinidae),
Charon cf. grayi, and Stygophrynus brevispina nov. spec. (Charonti-
dae) (Chelicerata, Amblypygi). Zoologischer Anzeiger 241:131-148.
Weygoldt, P. 2005. Biogeography, systematic position, and repro-
duction of Charinus ioanniticus (Kritscher 1959), with the
description of a new species from Pakistan (Chelicerata, Ambly-
pygi, Charinidae). Senckenbergiana Biologica 85:43-56.
Weygoldt, P. 2007. Parthenogenesis and reproduction in Charinus
ioanniticus (Kritscher, 1959) (Chelicerate, A^mblypygi, Charinidae).
Bulletin of the British Arachnological Society 14:81-84.
Manuscript received 7 March 2014, revised II August 2014.
2014. The Journal of Arachnology 42:240-247
The new spider genus Arctenus^ an afrotropkal representative of the Calocteninae (Araneae: Ctenidae)
Daniele Polotow' and Rudy Jocque-: 'Bill and Maria Peck Research Fellow, Arachnology, California Academy of
Sciences, San Francisco, CA 94118, USA. E-mail: danielepolotow@gmail.com; -Royal Museum for Central Africa,
Tervuren, Belgium
Abstract. Arctenus gen. nov. is proposed to include the type species A. taitensis sp. nov. from the Taita Hills in Kenya.
This ctenid species appears to be the first representative of the Calocteninae in the African continent. Results of a
parsimony analysis of morphological and behavioral characters indicated that the new species cannot be placed in any
known genus and therefore validated the creation of the new genus whose autapomorphies are considered hypotheses for
the genus synapomorphies. The phylogenetic relationships of the new genus are discussed and a distribution map of the
unique species is presented.
Keywords: Kenya, systematics, Taita Hills, taxonomy, cladistic analysis, phylogenetic analysis
The family Ctenidae Keyserling 1977 is composed of small
to large sized spiders (total body length of 4-40 mm), which do
not build a snare web to catch prey. They are wandering and
active predators, usually found in the litter layer, on tree
trunks and in lower vegetation. Most of them are nocturnal,
hiding during the day in the litter or in small cracks in the soil
or on tree trunks. To date, the family comprises more than 480
described species in 40 genera (Platnick 2014) and are
distributed mostly in tropical and temperate forests all over
the world. Ctenidae can be diagnosed by the ocular
arrangement 2-4-2 (Silva 2003).
The Afrotropical region holds 132 Ctenidae species, distrib-
uted in ten genera: Africacterms Hyatt 1954, Anahita Karsch
1879, Apolania Simon 1898, Ctenus Walckenaer, 1805, Peta-
loctenus Jocque & Steyn 1997, Thoriosa Simon 1910, Trogloc-
tenus Lessert 1935, Viridasius Simon 1889 and Viilsor Simon
1889 (Platnick 2014). Ctenus contains the largest number of
species (more than 70). The recent redescription of the
Neotropical type species, Ctenus dubius Walckenaer 1805, by
Brescovit & Simo (2007), and results of several cladistic analyses
(Silva 2003; Polotow & Brescovit 2009, 2014) indicated that the
genus is polyphyletic as currently delimited.
Recent collecting expeditions in the Kenyan Taita Hills, the
northernmost part of the Eastern Arc, yielded several
specimens identified as Ctenidae. The species was mentioned
by Jocque (2009) as a possible member of the genus
Pseudoctenus Caporiacco 1949, but that genus proved to
belong to the Zoropsidae Bertkau 1882.
The specimens collected in the Taita Hills cannot be assigned
to any of the Afrotropical Ctenidae genera. The presence of
several elongated spines on tibiae and metatarsi I and II and the
absence of a pair of terminal spines on tibiae I and 11 suggested a
relationship of the Taita Hills species with Africactenus, Anahita,
or Petaloctenus. However, the diagnostic characters of the male
palp and epigynum of these three genera prove otherwise. So far,
only five Ctenidae species have been described from Kenya:
Ctenus elgonensis Benoit 1978 (Benoit 1978: Fig. 2a-c), C. holmi
Benoit 1978 (Benoit 1978: Fig. 3a-b), C kenyamontanus Benoit
1978 (Benoit 1978: Fig. la-c), C modestus Simon 1897 (Benoit
1978: Fig. 3c; Benoit 1979: Fig. 24) and C. noctuabundus Arts
1912 (Benoit 1979: Fig. 10). The species collected in the Taita
Hills is clearly different from all these type specimens.
Here we describe this species and include it in the most
recent cladistic analysis based on morphological characters of
Ctenidae (Polotow & Brescovit 2014), to test the relationships
with the remaining species of the family. As a result, we
propose a new genus, Arctenus gen. nov., to accommodate
Arctenus taitensis sp. nov., and we discuss its phylogenetic
placement in Ctenidae.
METHODS
Morphological observations and illustrations were made
using Wild MIO and M5 microscopes. Photographs of the
habitus were taken with a Leica MZ16 binoclar microscope
using the LAS automontage software. For SEM, specimens
were cleaned ultrasonically, gold coated, and then examined
and photographed with a JEOL 6480 LV scanning electron
microscope at the Royal Museum for Central Africa,
Tervuren, Belgium (MRAC). We detached the epigynum
from the abdomen and submerged it in methyl salicylate to
clear the internal structures. All measurements are in
millimeters. The material examined belongs to the MRAC
(curator R. Jocque).
The morphological matrix comprises 72 species and 89
characters described in detail in Polotow & Brescovit (2014).
For the present analysis, we added one terminal taxon: A.
taitensis sp. nov., male and female from Mbololo Forest, Taita
Hills, Kenya, VI. 1999, D. Van den Spiegel coll. (MRAC
228739). Mesquite, version 2.75 (Maddison & Maddison 201 1)
was used to build and edit the character matrix. Non-
applicable and unknown states are presented as and ‘?’,
respectively. All characters were equally weighted and all
multistate characters were coded as non-additive. Character
coding for the new species was as follows:
Arctenus taitensis: 0000 1001100100011100011 00000000-
000000 1211 000000000 1 1 00000 110105011 00023 1 4 1 000000 1 ? 1 ?
??0?
The parsimony analysis was performed with the same
methodology described in Polotow & Brescovit (2014). The
Diva-GIS version 5. 2. 0.2 (http://www.diva-gis.org) was used
to make the maps.
The following abbreviations were used: ALE, anterior
lateral eyes; AME, anterior median eyes; C, conductor; CD,
copulatory ducts; CO, copulatory opening; Cy, cymbium; E,
240
POLOTOW & }OCQlJE—ARCTENUS, A NEW AFROTROPICAL SPIDER GENUS
241
Tengella radiata
Zoropsis spinimana
Nothroctenus marshii
Acanthoctenus spiniger
Viracucha andicola
Acanthocteninae
Celaetycheus flavostriatus
Arctenus taitensis
Caloctenus gracilitarsis
Toca bossanova
Gephyroctenus philodromoides
31
0.12 I 63
0,14
Calocteninae
0.05
53
0.17
0,02
99
Acantheis laetus
Enoploctenus inazensis
12 I Enoploctenus miserabilis
Enoploctenus cyclothorax
Viridasius fasciatus
Vulsor Isaloensis
Asthenoctenus borellii
Asthenoctenus tarsalls
Asthenoctenus bulimus
Leptoctenus aff agalenoides
— Anahita centralis
0,07
Acantheinae
Viridasiinae
Cteninae
0.09
0 04
Anahita aff mamma
Anahita blandini
Ctenus curvipes
Ctenus sinuatipes
Ctenus erythrochelis
Ctenus velox
Ctenus Immortalis
Ctenus fallax
Ctenus eminens
Ctenus pergulanus
Ctenus villasboasi
Ctenus satanas
A
0,29
Phoneutria fera
Phoneutria nigriventer
Ctenus rectipes
Ctenus pauloterral
— Ctenus nigritus
— Ctenus manauara
■ Ctenus villasboasi
• Ctenus satanas
Ctenus fallax
• Ctenus eminens
■ Ctenus pergulanus
-Phoneutria
- Ctenus
E;
Ctenus dubius
Ctenus crulsi
Ctenus amphora
Ctenus minor
Ctenus medlus
Ctenus paubrasil
Ctenus fernandae
66 I Ctenus ornatus
- Ctenus vehemens
51
0.04
0,14
Ctenus inaja
Leptoctenus paradoxus
Leptoctenus byrrhus
Ohvida modestus
90 I Ohvida vernatis
Ohvida fulvorufa
■f
0.13
0.05
40
0 14
0.32
Thoriosa sp.
Thoriosa taurina
Trogloctenus faget
Amauropelma trueloves
Amauropelma torbjorni
Ctenus lejeunei
Ctenus amanensis
Centroctenus ocelliventer
Centroctenus acara
99 I Africactenus decorosus
Africactenus monitor
Petaloctenus bossema
Petaloctenus songan
Ctenus longipes
Ctenus similis
66 I Parabatinga brevipes
- Parabatinga sp. nov.
- Isoctenus coxalis
- Isoctenus folliifer
0.52
54
0.19
91 I
0.25
Figure 1. — Consensus tree under implied weights for constant of concavity k; = 3. Rectangle shows Cteninae clade. Support values for groups
expressed as GC frequency differences (top) and Bremer support in units of fit X 100 (bottom).
242
THE JOURNAL OF ARACHNOLOGY
64 66 82 83 84
5 1111
Celaetycheus flavostriatus
8 9 17 23 62 71 73 74 85 86
'-<><K>0-«-«hCK>-0-#H
111112 14 11
Calocteninae
Caloctenus gracilitarsis
40 64
3 1
Toca bossanova
Gephyroctenus philodromoides
Figure 2. — Calocteninae clade of the consensus tree under implied weights for constant of concavity k=3. Character changes mapped on
branches. Black circles indicate non-homoplastic synapomorphies. White circles indicate homoplastic synapomorphies.
embolus; FD, fertilization ducts; LP, lateral process; LS,
lateral sector; MA, median apophysis; MS, median sector;
MTP, membranous tegular process; PLE, posterior lateral
eyes; PME, posterior median eyes; RCP, retrolateral cymbial
process; RTA, retrolateral tibial apophysis; S, spermathecae;
TF, transversal furrow; Ti, tibia; VTA, ventral tibial
apophysis; VTP, ventral tibial process.
PHYLOGENETICS
The parsimony analysis under equal weight resulted in 141
most parsimonious trees, with 235 steps (Cl = 50; RI = 83). In
the strict consensus, 14 nodes collapsed, resulting in a tree with
295 steps (Cl = 40; RI = 75). The implied weighting analyses
with concavity values from 1 to 6 were performed in the data
set, and we obtained the same two trees in each analysis, with
235 steps (Cl = 50; RI = 83). The strict consensus of the two
trees obtained by the concavities analysis resulted in one
collapsed node and the same tree of 236 steps (Fig. 1; Cl = 50;
RI = 83).
These results are congruent with the phylogeny of Polotow
and Brescovit (2014), except for the position of two clades at
the base of the clade F (Polotow & Brescovit 2014: Fig. 3),
with the clade formed by Ctemts fallax Steyn & Van der
Donckt 2003, C. eminens Arts 1912, and C. pergukmus Arts
1912 in the basal part of the clade (Fig. lA). Arctenus taitensis
sp. nov. appears as a representative of Calocteninae, sister
group of the clade formed by Caloctenus Keyserling 1877,
Toca Polotow & Brescovit 2009 and Gephyroctenus Mello-
Leitao 1936 (Fig. 1). The strict consensus of the two trees
obtained by the implied weighting analysis with k = 3 was
chosen as the working hypothesis and these results are
described below (Fig. 1). Here, we describe only the phyloge-
netic relationships of the Calocteninae Simon 1897 clade
(Fig. 2). For detailed results of the remaining subfamilies see
Polotow and Brescovit (2014).
Calocteninae (Fig. 2) is supported by three non-homoplas-
tic synapomorphies: labium wider than long (character 66),
reduced posterior median spinnerets (character 82) and
presence of a row of thick anal setae (character 84). This
clade is also supported by two homoplastic synapomorphies:
presence of five retromarginal teeth (character 64) and
posterior median spinnerets with three or fewer cylindrical
gland spigots (character 83). Celaetycheus Simon 1897 appears
as the basal clade, sister group of the remaining caloctenines
(Fig. 2) and is supported by two homoplastic synapomor-
phies: conductor laminar and folded (character 40) and five
pairs of ventral spines on tibia I and II (character 72). The
clade formed by Arctenus gen. nov., Caloctenus, Gephyrocte-
nus and Toca is supported by three non-homoplastic
synapomorphies: reduced ALE lenses (character 62), the
presence of three or more prolateral spines on femur I
(character 71) and presence of leaf-shaped setae on the
Figures 3, 4. — Arctenus — taitensis sp. nov.: 3. Habitus; 4. Frontal view of the carapace. Scale bars = 1 mm.
POLOTOW & JOCQVE— A RCTENUS, A NEW AFROTROPICAL SPIDER GENUS
243
abdominal dorsum (character 86). The clade is also supported
by seven homoplastic synapomorphies: presence of ventral
tibial apophysis (character 8), bifid RTA (character 9), median
retrolateral cymbial process (character 17), embolus fixed by
membranous region (character 23), distal pair of spines on
tibia I at a distance from the apical margin of the tibia
(character 73), presence of four or more ventral spines on
metatarsus I and II (character 74), and presence of modified
abdominal setae (character 85).
Arctenus gen. nov. appears as sister group of the clade
formed by Calocteniis, Gephyroctenus and Toca. Arctenus
taitensis sp. nov. presents three homoplastic autapomorphies:
cymbium with scopulae (character 18), conductor laminar,
wider than long (character 40) and presence of a membranous
tegular process (character 41). Arctenus is the first represen-
tative of the Calocteninae in the African continent.
The clade formed by Caloctenus, Gephyroctenus and Toca is
supported by four homoplastic synapomorphies: loss of
ventral tibial process (character 12), loss of lateral sector
processes of epigynum (character 52), cephalothorax divided
into a pars tlioracica and a pars cephalica by a V-shaped
depression (character 63), and four retromarginal teeth
(character 64).
The Caloctenus clade is supported by the absence of a
membrane connecting the embolus and tegulum (character
23). The sister group relation of Gephyroctenus and Toca is
based on the unique single folded epigynum configuration
(character 42) and four homoplastic synapomorphies: conical
or rounded retrolateral tibial apophysis (character 9), retro-
basal cymbial process (character 17), cylindrical embolus
(character 22) and abdominal dorsum with club-shaped setae
(character 87).
The Gephyroctenus terminal branch is supported by the
presence of a unique retrolateral cymbial process, covering the
retrolateral surface as a laminar process (character 17) and a
homoplastic membranous tegular process (character 41). The
terminal branch formed by Toca species is supported by a
unique conductor, partially covering the tegulum (character
40) and the presence of five retromarginal teeth (character 64).
TAXONOMY
Ctenidae Keyserling 1877
Calocteninae Simon 1897
Arctenus new genus
Type species. — Arctenus taitensis sp. nov.
Etymology. — The generic name is a combination of “arc,”
referring to the Eastern Arc Mountains, and ""CtenusT
Diagnosis. — Males of Arctenus gen. nov. can be distin-
guished from the other Calocteninae by the long hairs on the
base of the RTA, the large and thick embolus with a subdistal
projection and bifid tip, and presence of a dorsal cymbial
scopula (Figs. 11,12) on the male palp. Females of Arctenus
gen. nov. can be distinguished from the remaining Calocteni-
nae by the median field with an anterior transverse furrow
(Fig. 13).
Description. — Ecribellate ctenids. Total body length (males
and females) 5.90-7.20. Carapace pale brown with longitudi-
nal lighter stripe from eyes to posterior carapace margin;
chelicerae, labium, endites, sternum and legs pale brown;
chelicerae with longitudinal dark markings and femur of legs
with dark spots (Figs. 3,4); posterior median and lateral eyes
on black tubercles (Fig. 4). Dorsum of abdomen with
longitudinal white stripe (Fig. 3), venter pale brown. Eyes
arranged in ctenoid pattern, 2-4-2 (Fig. 4). Chelicerae with five
retromarginal teeth (Fig. 5) and three promarginal teeth.
Labium short, wider than long. Fovea short, positioned in
posterior third of carapace. Tarsal claws with eight teeth, four
proximal teeth short and four distal teeth elongated and slight
sinuous (Fig. 9). Trichobothrial base with two transversal
grooves (Fig. 7). Tarsal organ rounded, projecting, with drop-
shaped aperture (Fig. 8). Legs I and II with numerous pairs of
elongated spines on femur, tibia, and metatarsus. Trochanters
slightly notched. Abdomen oval. Male palp: tibia with RTA,
ventral tibial process and additional ventral tibial projection;
RTA with two distal projections and elongated hairs at base;
cymbium with retrolateral median projection and dorsal
scopulae; subtegulum prolateral; median apophysis hook-
shaped; embolus with subdistal projection and bifid tip;
hyaline projection at base of embolus; conductor short, its
tip covering embolus (Figs. 6,11,12). Epigynum: divided into
median field and two lateral fields; median field with anterior
transverse furrow; lateral field with short lateral process;
broad copulatory ducts and spermathecae rounded, situated
posteriorly; fertilization ducts short, emerging from base of
spermathecae (Figs. 13,14). The specimens were found with an
epigynal plug covering the copulatory opening (Fig. 10).
Composition. — Only the type species, Arctenus taitensis sp.
nov.
Distribution. — Kenya (Figs. 15,16). The calculated expected
distribution of the species (Diva GIS) is restricted to the Taita
Hills. Extensive collections in other parts of the Eastern Arc
(Usambara, Ulugura and Uzungwa Mts., mainly in the
Zoological Museum of the University of Copenhagen,
courtesy of N. Scharff) did indeed not reveal the presence of
the species there.
Arctenus taitensis new species
Figs. 3-16
Type material. — Male holotype from Mbololo Forest, Taita
Hills (1580 m), 03°19'S 38°27'E, Kenya, 22.VL1999, D. Van
den Spiegel coll., (MRAC 208839); female paratype from
Chawia Forest, Taita Hills (1850 m), 02°29'S 38°29'E, Kenya,
7.XIL1999, D. Van den Spiegel & J.P. Michiels coll., deposited
in MRAC 209161; male and female paratypes from the same
locality as the holotype (1800-1900 m), 23.VL1999, D. Van
den Spiegel coll. (MRAC 228739).
Additional material examined. — KENYA. Coast Province:
Taita Taveta District, Taita Hills, Mbololo Forest, 03°19'S
38°27'E, 4 females, 23.VL1999, D. Van den Spiegel coll.
(MRAC 208808); Ngangao Forest, 03°20'S 38°22'E, 1 female,
19.VL1999, D. Van den Spiegel coll. (MRAC 208813); Same
locality, 1 female, 1 7-1 8.VL 1999, D. Van den Spiegel coll.
(MRAC 208831); Same locality, 1 female, 19.VL1999. D. Van
den Spiegel coll. (MRAC 208840); Same locality, 2 females,
24.111.2000, C. Warui & R. Jocque coll. (MRAC 209568);
Fururu Forest, 1 female, 9.XIL1999, D. Van den Spiegel &
J.P. Michiels coll. (MRAC 209160); Taita Discovery Center,
03°25'S 38°46'E, 1 female, 27.111.2000, C. Warui «& R. Jocque
coll. (MRAC 209546).
244
THE JOURNAL OF ARACHNOLOGY
Figures 5-10. — Arctemis taitcusis sp. nov.: 5. Left chelicera, detail of the five teeth on retromargin; 6. Male right palp: 7. Trichobothrium.
female, tarsus I; 8. Tarsal organ, female, tarsus I; 9. Tarsal claws, male, leg !1; 10. Epigynum, with epigynal plug.
POLOTOW & JOCQUE— A NEW AEROTROPICAL SPIDER GENUS
245
RTA
VTA
Eigures 1 1-14. — Arctemis laitensis sp. nov.; 1 1-12. Male left palp; 1 1. Ventral view; 12. Retrolateral view; 13-14. Epigynum; 13. Ventral view;
14. Dorsal view. Abbreviations; C, conductor; CD, copulatory duct; CO, copulatory opening; Cy, cymbium; E, embolus; ED, fertilization ducts;
LP, lateral process; LS, lateral sector; MA, median apophysis; MS, median sector; MTP, membranous tegular process; RCP, retrolateral cymbial
projection; RTA, retrolateral tibial apophysis; S, spermatheca; TF, transverse furrow; VTA, ventral tibial apophysis; VTP, ventral tibial process.
Etymology. — The species epithet is an adjective derived
from the type locality.
Diagnosis. — As for the genus.
Description. — Male (MRAC 208839).- Total length 5.90.
Carapace 2.90 long and 2.50 wide. Clypeus 0.11 high. Eye
diameter: AME 0.15, ALE 0.12, PME 0.20, PEE 0.23. Leg
measurements; I: femur 3.70/ patella 1.10/ tibia 3.95/
metatarsus 4.10/ tarsus 2.00/ total 14.85; II: 3.60/ 1.20/ 3.50/
3.50/ 1.40/ 13.20; III: 3.20/ 1.10/ 2.70/ 2.90/ 1.10/ 11.00; IV:
3.90/ 1.10/ 3.30/ 4.30/ 1.45/ 14.05. Leg formula: 1423. Leg
246
THE JOURNAL OF ARACHNOLOGY
Figures 15, 16. — Distribution map of Arctenus taitensis sp. nov. 15. African continent; 16. Detail of southern Kenya and northeast Tanzania.
spination: tibia I with eight pairs of ventral spines; tibia II with
seven pairs of ventral spines; metatarsi I and II with five
ventral pairs of spines; tibia III-IV 2-2-2v 1-lp 1-lr; metatarsi
III-IV 2-2-2v 1-1- Ip 1-1-lr. Coloration and palp: as in genus
description.
Female (MRAC 228739).' Total length 7.20. Carapace 3.10
long and 2.60 wide. Clypeus 0.14 high. Eye diameter: AME
0.18, ALE 0.12, PME 0.28, PLE 0.28. Leg measurements: I:
femur 3.00/ patella 1.30/ tibia 3.00/ metatarsus 2.60/ tarsus
0.95/ total 10.85; II: 3.00/ 1.30/2.60/2.30/0.90/ 10.10; III: 2.60/
I. 10/ 2.10/ 2.30/ 0.90/ 9.00; IV: 3.20/ 1.00/ 2.60/ 3.20/ 1.15/
II. 15. Leg formula: 4123. Leg spination: tibia I and II with
eight ventral pairs of spines; metatarsi I and II with five
ventral pairs of spines each; tibia III 2-2-2v 1-lp 1-lr; tibia IV
2-l-2v 1-lp 1-lr; metatarsi III-IV 2-2-2v 1-1-Ip 1-1-lr.
Coloration and epigynum: as in genus description.
Distribution. — Kenya (Figs. 15,16).
DISCUSSION
The results indicate that Arctenus taitensis, from East
Africa, is closely related to the Neotropical Calocteninae
spiders, in a well supported clade (Fig. 1). Here we describe
Arctenus taitensis as the first true Calocteninae from the
African continent, although there is currently another species
described from Ethiopia, Caloctenus abyssinicus Strand 1917,
which was placed as incertae sedis within Ctenidae by Silva
(2004: 13). The type specimen is lost and the original
description (Strand 1917: 41) is based on an immature female,
with somatic features unusual for the family. Another species,
described from the Seychelles islands, Apolania segnientata
Simon 1898, is also regarded as belonging to the Calocteninae
according to Silva (2003: 30). Until the identity of Caloctenus
abyssinicus is revealed, Arctenus taitensis and Apolania
segnientata remain the only two Afrotropical Calocteninae
species.
The majority, 24 out of the currently 32 species of
Calocteninae (in seven genera, Caloctenus, Gephyroctenus,
Toca, Apolania, Diallonnis Simon 1897, Celaetycheus and
Arctenus), were described in the last 10 years and most of the
specimens were collected recently (Silva 2004; Polotow &
Brescovit 2008, 2009, 2013). This is remarkable, as the shelf
life between discovery and description of new species is on
average 21 years (Fontaine et al. 2012, Miller et al. 2014), and
because it concerns medium sized to large spiders. It shows
that at least the Neotropical and Afrotropical regions, from
which these animals originate, have only superficially been
inventoried even for larger invertebrates. This is particularly
true for members of the family Ctenidae and a fortiori for the
subfamily Calocteninae. Since these spiders are strictly
nocturnal they were overlooked for a long time (Steyn et al.
2002). Only in recent inventories that made use of pitfalls but
mainly of headlamps for night collecting, have these spiders
become common in collections. That Calocteninae appear to
be rare and are apparently restricted to areas with character-
istics of refuges (Seychelles and Eastern Arc for Africa), is
concordant with their basal position in the phylogeny of the
family (Polotow & Brescovit 2014).
ACKNOWLEDGMENTS
Financial support and a doctorate fellowship for this study
were provided by the Funda^ao de Amparo a Pesquisa do
Estado de Sao Paulo — FAPESP (06/55230-7), the Belgian
National Focal Point to the Global Taxonomy Initiative at the
Royal Museum for Central Africa, and a Bill and Maria Peck
Research Fellowship at the California Academy of Sciences.
We would like to thank all curators who kindly lent essential
specimens for this research. We also thank Matjaz Kuntner,
Charles Haddad and an anonymous reviewer for comments
that led to improvements in the manuscript.
LITERATURE CITED
Benoit, P.L.G. 1978. Especes est-africaines du genre Ctenus Walck-
enaer (Araneae, Ctenidae). Revue de Zoologie africaine 92:525-
532.
Benoit, P.L.G. 1979. Etudes sur les Ctenidae africains (Araneae) VIII.
Gen. Ctemis Walck.-groupe abditus. Revue de Zoologie africaine
93:425M44.
Brescovit, A.D. & M. Simo. 2007. On the Brazilian Atlantic Forest
species of the spider genus Ctenus Walckenaer, with the description
of a neotype for C. cluhius Walckenaer (Araneae, Ctenidae,
Cteninae). Bulletin of the British Arachnological Society 14:1-17.
Fontaine, B., A. Perrard & P. Bouchet. 2012. 21 years of shelf life
between discovery and description of new species. Current Biology
22:943-944.
Jocque, R. 2009. A redescription of Pseiuloctenus ineneghetlii
Caporiacco, 1949 (Araneae: Zoropsidae), a poorly known Afro-
tropical spider taxon, with description of a new enigmatic species.
Contributions to Natural History 12:707-721.
POLOTOW & iOCQVE—ARCTENUS, A NEW AFROTROPICAL SPIDER GENUS
247
Maddison, W.P. & D.R. Maddison. 2011. Mesquite: a modular
system for evolutionary analysis. Version 2.75. Online at http;//
mesquiteproject.org
Miller, J., M. Schilthuizen, J. Burmester, L. van der Graaf, V. Merckx
& M. Jocque, et al. 2014. Dispatch from the field: ecology of
ground-web-building spiders with description of a new species.
Biodiversity Data Journal 2:1076.
Platnick, N.I. 2014. The world spider catalog, version 14.5. American
Museum of Natural History. Online at http://research.amnh.org/
entomology/spiders/catalog/index. html DOI: 10.5531/db.iz.0001
(accessed in April, 2014).
Polotow, D. & A.D. Brescovit. 2008. Revision of the Neotropical
spider genus Gephyroctemis (Araneae; Ctenidae: Calocteninae).
Revista Brasileira de Zoologia 25:705-715.
Polotow, D. & A.D. Brescovit. 2009. Description of Toca, a new
neotropical spider genus (Araneae, Ctenidae, Calocteninae).
Journal of Arachnology 37:243-245.
Polotow, D. & A.D. Brescovit. 2013. New species of the Neotropical
spider genus Celaetycheus Simon, 1897 (Araneae: Ctenidae).
Zootaxa 3637:139-157.
Polotow, D. & A.D. Brescovit. 2014. Phylogenetic analysis of the
tropical wolf spider subfamily Cteninae (Arachnida, Araneae,
Ctenidae). Zoological Journal of the Linnean Society 170:333-361.
Silva, D. 2003. Higher-level relationships of the spider family
Ctenidae (Araneae: Ctenoidea). Bulletin of the American Museum
of Natural History 274:1-86.
Silva, D. 2004. Revision of the spider genus Caloctemis Keyserling,
1877 (Araneae, Ctenidae). Revista Peruana de Biologia 11:5-26.
Simon, E. 1897. Histoire naturelle des araignees. Librairie encyclo-
pedique de Roret, Paris 2:1-192.
Simon, E. 1898. Etudes arachnologiques. 29e Memoire. XLVI.
Arachnides recueillis en 1895 par M. le Dr. A. Brauer (de
rUniversite de Marburg) aux lies Sechelles. Annales de la Societe
Entomologique de France 66:370-388.
Steyn, T.L., J.-F. Van der Donckt & R. Jocque. 2002. The Ctenidae
(Araneae) of the rainforests in eastern Cote d'Ivoire. Annales du
Musee royal de I’Afrique centrale (serie Zoologie) 290:129-166.
Strand, E. 1917. Arachnologica varia XXI-XXIV. Archiv fiir
Naturgeschichte 82:39^4.
Manuscript received 14 April 2014, revised 17 June 2014.
2014. The Journal of Arachnology 42:248-256
Chemical defenses in the opilionid infraorder Insidiatores: divergence in chemical defenses between
Triaenonychidae and Travunioidea and within travunioid harvestmen (Opiliones) from eastern and
western North America
W. A. Shear', T. H. Jones-, H, M. Guidry-, S. Derkarabetian^"', C. H. Richart"*"*, M. Minor^ and J. J.
Lewis^: 'Department of Biology, Hampden-Sydney College, Hampden-Sydney, VA 23943, USA. E-mail;
wshear@hsc.edu; -Department of Chemistry, Virginia Military Institute, Lexington, VA 24450, USA; ^Department of
Biology, San Diego State University, San Diego, CA 92182, USA; ''Department of Biology, University of California,
Riverside, Riverside, CA 92521, USA; ^Ecology Group, Institute of Agriculture & Environment, Massey University,
Private Bag 11222, Palmerston North 4442, New Zealand; '’J. Lewis & Associates Biological Consulting, 217 W. Carter
Avenue, Clarksville, IN 47129, USA
Abstract. Live whole specimens of two species of the harvestman Stiperfamily Travunioidea Absolon & Kratchovil 1932
from the eastern United States, eight species from the western United States, six morphospecies of the family
Triaenonychidae Sorensen 1886 from New Zealand, and specimens of the phylogenetically early-diverging North American
triaenonychid Fwmmtaiia dejvchoidor Shear 1977 were extracted in methanol, and the solvent analyzed for components
from their'defensive secretions. The components were then mapped on a recent phylogeny of the taxa. In both eastern
cladonychiid species, Erehonuister flavescens Cope 1872 and Theronuister bnmneus (Banks 1902), the major component
found was anabaseine, an alkaloid related to nicotine. In the western species, Parcmonyclms hrunneus (Banks 1893),
Cryptonuister leviathan Briggs 1969, Speleoniaster lexi Briggs 1974, S. pecki Briggs 1974, Speleonychia sengeri Briggs 1974,
Metanonychiis idahoensis Briggs 1971, Briggsus flavescens (Briggs 1971) and Sclerohiinus nondiniorphicus Briggs 1971, the
major component was N,N-dimethylphenylethylamine, implying that the travunioids from the two regions represent
different phyletic lines. The secretions of the triaenonychid species, members of the genera Soerensenella Pocock 1903 and
Nnncia Loman 1902, were dominated by 4-methyl-3-hexanone, and that of F. depreliendor by phenol. The completely
different chemistry of the two taxa, Travunioidea and Triaenonychidae, implies significant phylogenetic differences, and
the presence of phenol in F. depreliendor may suggest a long period of separate evolution for this species.
Key words: Nicotine, benzothiazole, 2-3' dipyridyl, salicyl alcohol, mellein, N,N-dimethylphenylethylamine, 4-methyl-3-hexanone
Harvestmen, arachnids of the order Opiliones (also known in
North America as daddy-long-legs) defend themselves chemi-
cally with secretions from paired glands in the prosoma, which
open through pores on either side of the body. Information on
the chemical composition of these secretions has accumulated
since the initial studies of Estable et al. (1955) that identified
gonyleptidine, the first defensive substance from a harvestman
to be chemically determined. Developments in the field have
been ably summarized in a chapter by Gnaspini & Hara (2007),
which revealed that research on defensive chemistry in Opiliones
has focused disproportionally on South American gonyleptids
and their relatives (see also Ebttinger et al. 2010). Since the 2007
review, information has been added regarding more disparate
taxa for which the chemistry of the secretions was previously
unknown. Raspotnig et al. (2005) published the first report on
the chemistry of sironids (Cyphophthalmi Simon 1879), and
Jones et al. (2009) added data for a stylocellid. Raspotnig et al.
(2010) provided the first report of secretion chemistry among
Dyspnoi, from Panineimistoma quadripiinctatum (Perty 1833),
and Shear et al. (2010a, b) studied two North American
phalangodids, Bishopella laciniosa (Crosby & Bishop 1924) and
Texella hifiircata (Briggs 1968), and a stygnopsid, Cltiiuptepello-
hiiinis nuuHae (Goodnight & Goodnight 1967). These more
recent developments have been summarized by Raspotnig (2012
[2013]), who also mentioned preliminary results for many
additional harvestman species. Thus while progress has been
made filling taxonomic gaps in our knowledge of harvestman
defensive secretions, much remains to be done.
While these studies focused primarily on reporting the
composition of secretions from individual species, some recent
work has been more analytical. Rocha et al. (2013) discussed
possible chemical pathways for the synthesis of secretion
components. Attempts at a phylogenetic analysis of the
distribution of defensive secretions include those of Caetano
& Machado (2013) and Raspotnig et al. (2014). The hope has
frequently been expressed that data on defensive secretions
may be of value in the phylogenetics and taxonomy of
Opiliones (Hara et al. 2005; Jones et al. 2009; Shear et al.
2010a, b, Fdttinger et al. 2010, Raspotnig 2012 [2013]), but we
see an emerging picture that may be blurred by a great deal of
homoplasy. Indeed, the results of the analyses of the same data
by Caetano & Machado (2013) and Raspotnig et al. (2014)
came to opposite conclusions concerning the polarity of
chemical transformations in Grassatores.
Traditional Opiliones taxonomic groups have now been
robustly supported with genomic data sets (Hedin et al. 2012),
and include the mite-like suborder Cyphophthalmi as sister to
remaining harvestmen, the Phalangida Latrielle 1796. Within
Phalangida, the raptorially-pedipalped Laniatores Thorell
1876 are sister to the Palpatores Thorell 1876, comprised of
the often long-legged suborder Eupnoi Hansen & Sorensen
1904 and the suborder Dyspnoi Hansen & Sorensen 1904. The
division of the suborder Laniatores into two infraorders,
Insidiatores Loman 1900 and Grassatores Kury 2003, was
proposed by Kury (2003) to taxonomically recognize two
divergent phyletic lines of harvestmen. Insidiatores includes
248
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
those taxa presently grouped as Triaenonychidae Sorensen
1886, Synthetonychiidae Forster 1954, and a group of species
of unsettled family-level taxonomy presently referred to as
Travunioidea Absalon & Kratchovil 1932. It is not clear that
Insidiatores as composed is monophyletic (but Grassatores
almost certainly is). Representative Insidiatores examined here
can be seen in Fig. 1.
Synthetonychiidae is a poorly studied but probably
monophyletic taxon including minute harvestmen limited to
New Zealand (Forster 1954, Kury 2007). In some recent
phylogenies, synthetonychiids have been resolved as an
outgroup to the remaining Laniatores (Giribet et al. 2010).
Triaenonychidae is composed of numerous genera and species
that are important, if not dominant, elements of the
harvestman fauna of the southern hemisphere (Australia,
New Zealand, Madagascar, South Africa, and southern South
America [Kury 2007]), but one species, Fumontami deprehen-
dor Shear 1977, is known from the southern Appalachian
Mountains in North America (Shear 1977, Thomas & Hedin
2008). Triaenonychid taxonomy is somewhat problematical
(Mendes & Kury 2008). No triaenonychids had been examined
for the chemistry of their defensive secretions prior to this
study, and synthetonychiids remain unstudied.
Genera and species of the “superfamily” Travunioidea have
been recorded from Europe (Kury & Mendes 2007) and Japan,
but North America appears to host the most diverse and
probably the best understood fauna (Fig. 1; Shear &
Derkarabetian 2008, Derkarabetian et al. 2010, 2011). Only
a single North American species from this phylogenetically
important taxon has been examined from the viewpoint of
chemical defense. Specimens from New Mexico were studied
by Epka et al. (1984); at the time they referred their material
to Sclerobumis rohustiis (Packard 1877), but recent work
(Derkarabetian et al. 2010, 2011; Derkarabetian & Hedin
2014) has shown that at least three additional species occur in
New Mexico, so the exact identity of their specimens is now
unclear. Epka et al. (1984) found an extraordinary array of
molecules in the secretion of S. robustus: N,N-dimethylphe-
nylethylamine, nicotine, bornyl acetate, bornyl propionate,
camphene and limonene.
Raspotnig et al. (2011) examined four species in the
European travunioid genus Holoscotolemon Roewer 1915;
H. jaqueli (Corti 1905), H. oreophUum Martens 1978, H.
lessiniense Martens 1978 and H. imicolor Roewer 1915. They
found that the secretions of H. jacpwti and H. oreophUum were
dominated by nicotine, while that of H. lessiniense primarily
consisted of the similar alkaloid anabaseine. No results were
obtained from adults of H. unicolor.
For this study, we analyzed extracts from 15 species of
Insidiatores from North America and New Zealand. While
our findings for the North American species might have been
predicted from the earlier examinations of Sclerohunus
?robustus and the European species of Holoscotolemon, the
chemistry of the New Zealand forms was quite unexpected.
METHODS
Specimens studied were collected alive and dropped in the
field into vials containing less than 1 ml of USP methanol;
the vials had Teflon-lined caps. Collection localities for the
specimens studied are given in Table 1. All specimens will be
249
placed as vouchers in the collection of the Virginia Museum of
Natural History, Martinsville, Virginia.
Although when it was possible to extract more than one
specimen of a species separately, the results were consistent, in
most cases we were restricted to a single specimen by the rarity
of the species involved and the difficulties in collecting them,
or analyzed extracts from several specimens collected into the
same vial. For this reason, some of our results must be
regarded as preliminary, and we are working to follow up with
additional specimens. However, at the level we are studying,
simply characterizing components without detailed quantita-
tive analysis, previous studies have shown little variation
within species in the composition of their secretions, though
relative amounts of components may differ.
The analysis of the extracts was performed by HMG and
THJ. Gas chromatography-mass spectrometry was carried out
in the El mode using a Shimadzu QP-5000 or QP-2010 GC/
MS equipped with an RTX-5, 30 m X 0.25-mm i.d. column.
The instruments were programmed from 60 ° C to 250 ° C at
10 7min. Identification of components was accomplished
using NIST/EPA/NIH mass spectral library on CD-rom,
version 1.7 (1999) and the NIST/EPA/NIH mass spectral
library version 2.0d (2005).
All chemicals were mapped onto a modified phylogeny
based on the molecular phylogenetic analysis of Derkarabe-
tian et al. (2010), trimmed to include only those genera with
chemical data presented here. An ultrametric tree was used
for character mapping, which was conducted in Mesquite
2.75 using the ancestral state reconstruction module using
parsimony. Additionally, we mapped chemicals onto a
phylogeny including triaenonychids analyzed here and the
genus Holoscotolemon. The taxa were added according to
their placement in the maximum likelihood phylogeny of
Giribet et al. (2010).
RESULTS
Results of the analysis are presented in Tables 2M, and
structural formulae of detected components are shown in
Fig. 2. As seen in Table 2, the major component of the
secretion in both eastern North American travunioid species
{Erebomaster Jlavescens Cope 1872 and Theromaster briinneus
(Banks 1902)) was the alkaloid anabaseine. Minor or trace
components were anabasine (a related alkaloid), phenol,
benzothiazole, salicyl alcohol, 2,3'-dipyridyl and mellein.
Four individuals of T. brunneus were analyzed; no significant
differences were found between individuals, except that salicyl
alcohol was not found in two of the specimens. A specimen of
E. Jlavescens from Indiana was analyzed separately, and six
specimens of the species from Ohio were extracted and
analyzed as a group. The results for E. jlavescens differed
from those for T. brunneus in that trace amounts of 4-
hydroxybenzine-ethanol were found in the E. Jlavescens
extract, and that phenol, anabasine and mellein were minor
components (1-10%) rather than traces (< 1%).
Table 3 summarizes the results from the analyses of extracts
from eight species of travunioids from western North
America. Components in common with the eastern species
were phenol and benzothiazole, and as with the eastern
species, these compounds were present only in trace amounts.
The major component in all western species was N,N-
250
THE JOURNAL OF ARACHNOLOGY
1 mm
0.5 mm
1 mm
1 mm
1 mm
1 mm
1 mm
0.5 mm
1 mm
Figure 1. Representatives of North American Insidiatores. High resolution images for all specimens figured here are available on
Morphbank under publication ID 835667 {http://www.morphbank.net/835667). A. Briggsiis flavesceiis, B. Cryptomaster leviatium, C.
Paranoiiychus hriinneiis, D. Metanoiiycinis ulcilioeitsis, E. Fitmontaiia deprehendor, F. Erehomaster sp., G. Speleomaster lexi, H. Speleomaster
pecki, I. Speleoiiychia sengeri.
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
251
Voucher
Species number
Cryptomaster leviathan 07-177
08-188
07-176
Erebomaster flavescens 07-179
07-180
07- 181
12-336
Theromaster bnmneus 08-211
Speleomaster lexi 08-172
08- 178
Speleomaster pecki 08- 1 74
Speleonychia sengeri 08-175
08-176
08-177
08-179
Paranonychus bnmneus 07-174
07-175
Metanonyclms idahoensis 09-248
Briggsus flavescens 08-190
Nimcia sp. 10-275
Nimcia sp. 10-278
Nimcia sp. 10-279
Soerensenella sp. 10-271
Soerensenella prehensor 10-272
Table 1. — Collecting localities.
Collection localities
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart,
C.Richart (CHR 1354)
OR: Coos Co., Golden and Silver Falls St. Pk., 4 April 2008, S.Derkarabetian, C.Richart (CHR 2029)
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart,
C.Richart (CHR 1335)
IN: Crawford Co., Sibert’s Well Cave (near Wyandotte Cave), 3 mi NE Leavenworth, 19 Nov 2007, J. Lewis
IN: Harrison Co., Devils Graveyard Cave, 7 mi SW Corydon, 19 Nov 2007, J. Lewis
IN: Harrison Co., Devils Graveyard Cave, 7 mi SW Corydon, 19 Nov 2007, J. Lewis
OH: Adams Co., Edge of Appalachia Preserve, 8 June 2011, W. A. Shear
NC: Haywood Co., Cullowhee Mtn. Road at Wolf Creek, 22 October 2008, W. A. Shear
ID: Lincoln Co., Tee Cave, 30 June 2007, A.Richart, C.Richart (CHR 1577)
ID: Lincoln Co., Gwinn Cave, 29 June 2007, A.Richart, C.Richart (CHR 1568)
ID: Butte Co., Beauty Cave, 30 June 2007, A.Richart, C.Richart (CHR 1581)
WA: Klickitat Co., Cheese Cave, 9 June 2007, N.Richart, C.Richart (CHR 1621)
WA: Skamania Co., Cave #27, 9 June 2007, N.Richart, C.Richart (CHR 1622)
WA: Skamania Co., Big Cave, 8 June 2007, N.Richart, C.Richart (CHR 1588)
WA: Skamania Co., Slime Cave (Cave #39) 8 June 2007, N.Richart, C.Richart (CHR 1607)
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart,
C.Richart (CHR 1356)
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart,
C.Richart (CHR 1357)
ID: Shoshone Co., Hobo Cedar Grove, 25 July 2008, C.Richart (CHR 2361)
OR: Clatsop Co., Saddle Mt. Rd. near U.S. 26, 3 April 2008, S.Derkarabetian, C.Richart (CHR 2016)
NZ: South Island, Westland, Dancing Creek, Haast Pass, 11 February 2010, M. Minor
NZ: South Island, Buller, Aratika, 9 February 2010, M. Minor
NZ: South Island, Buller, Springs Junction, 5 February 2010, M. Minor
NZ: North Island, Wanganui, Totara Reserve, 28 March 2010, M. Minor
NZ: North Island, Taupo, Whakapapa Bush, 4 April 2010, M. Minor
dimethylphenylethylamine, with nicotine and N,N-dimethyli-
soamylamine as minor or trace components. An exception
was Briggsus flavescens (Briggs 1971), in which the major
component was phenol, with N,N-dimethylphenylethyIamine
as a minor component and a trace amount of benzothiazole.
This unexpected result came from one small specimen and
requires confirmation.
Table 4 shows results from the analyses of extracts of
triaenonychids. Three small specimens of F. deprehendor were
extracted and analyzed together. Fumontana deprehendor had
phenol as a major component, with traces of salicyl alcohol.
Each record of a New Zealand triaenonychoid represents
either one or two specimens. The major components of the
New Zealand triaenonychoids were quite different from both
F. deprehendor and the travunioids. While the travunioids and
F. deprehendor were dominated by cyclic compounds fre-
quently containing nitrogen, the New Zealand triaenony-
choids showed linear aldehydes, alcohols and ketones. The
secretions were also much less complex, with only one or two
minor or trace components in Nimcia sp.
Results of the character mapping analyses including the
triaenonychids and Holoscotolemon are shown in Fig. 3. This
analysis indicates that if Insidiatores is monophyletic, the
ancestral state for all species is phenol, with changes to 4-
Table 2. — Compounds present in eastern North American travunioids and species of Holoscotolemon (data on Holoscotolemon from
Raspotnig et al. 2011). Plus sign indicates major component, “o” a minor component (<10%) and “t” a trace component (<1%). The
“Unknown” is an undetermined component at m/z = 174.
Fig. 2
Component
Erebomaster
flavescens
Theromaster
bnmneus
Holoscotolemon
jacpietf
Holoscotolemon
lessiniense‘
Holoscotolemon
oreophilum’
1
Phenol
o
t
2
Benzothiazole
t
t
3
Salycyl alcohol
t
t
4
4-Hydroxybenzenethanol
t
5
Anabasine
o
t
6
2,3'-Dipyridyl
t
t
t
7
Anabaseine
+
+
+
8
Mellein
0
t
10
Nicotine
+
+
Unknown*
t
Table 3. — Compounds present in western North American travunioids. Plus sign indicates major component, “o” a minor component (<10%) and “t” a trace component (<1%).
252
THE JOURNAL OF ARACHNOLOGY
+
^ O
+ o ^
+ o o
o
a.
o
o
c
o
a
S
o
o
Cl,
’O
c
c3
N
a>
z
o
-C
p,
o
p:
’2
+
+
+
+
+
o
a
£
5
U
x:
Oh CQ Z Z Z
— ri O
§ ^
^ s
<U O
^ Cl
- s
Q. o
C/5 ^
'O 1)
c o
:3
o i:
a ^
o
u r
I. ^
a
<u
5
2 =
X Cl
(U OJ
O
O
o _ .
^ -i. -L
"o "S ^ ’£ 'S
c o •£ <u a>
e- oo ^
t S
PO ■q' IT)
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
14 15
Figure 2. — Compounds identified in this study. I. Phenol, 2.
Benzothiazole, 3. Salycyl alcohol, 4. 4-Hydroxybenzenethanol, 5.
Anabasine, 6. 2,3'-dipyridryl, 7. Anabaseine, 8. Mellein, 9. N,N-
dimethylphenylethylamine, 10. Nicotine, 11. N,N-dimethylisoaniyla-
mine. 12. 4-methyl-3-hexanone, 13. Methylhexanoate, 14. 4-methyl-3-
hexanol, 15. 4-methyl-3-heptanone.
methyl-3-hexanone in New Zealand triaenonychids and to
N,N-dimethylphenylethylamine in travunioids.
DISCUSSION
The qualitative near-identity of the extracts from E.
flavescens and T. brunneus supports the close phylogenetic
relationship hypothesized on the bases of morphology and
genetics by Derkarabetian et al. (2010). The strong differences
between the secretions of this “eastern clade” and that of the
hypothetical “western clade” of travunioids supports that
distinction.
Raspotnig et al. (2011) found anabaseine as the major
component in the secretion of Holoscotolemon lessiniense, but
nicotine dominated that of H. jaqueti and H. oreopliilimi
(Table 2). These three species appear to be closely related from
morphological evidence and numerous characters, especially
genitalic, place them close to Erehomaster Cope 1872 and
Theromaster Briggs 1969 (Martens 1978). Trace components
in these three species were pyridines with the same core
structure as anabaseine and nicotine. Both chemical and
morphological evidence, therefore, argue for a closer relation-
253
ship of the eastern North American genera with European
Holoscotolemon than with the travunioid genera from western
North America.
For the western travunioids, N,N-dimethylphenylethyla-
mine was the major component in all species except Briggsus
flavescens. Metanonychus klahoensis Briggs 1971 and Scler-
ohunus nondimorphiciis Briggs 1971 had nicotine and N,N-
diethylisoamylamine as minor components, as well as two
unidentified compounds not shown. For the other species,
phenol was present as either a minor component or a trace,
and benzothiazole was found as a trace in Parammyclnis
brunneus (Banks 1893) and Speleonychia .sengeri Briggs 1974.
The complex mixtures found in the eastern cladonychiids and
in S. ?robustus (Epka et al. 1984) were not recovered from the
western species we studied. The complexity of the secretion
extracted from the two eastern cladonychiid species is similar
to that found by Epka et al. (1984) for Sclerobimus ?robustus,
but quite different chemically. New Mexico Sclerobimus Banks
1893 require re-examination.
Both the complexity and the diversity of chemical compo-
sition within Insidiatores is unusual among opilionids, because
in previous studies, similar classes of compounds (though
different molecules) have been found in large taxonomic
groupings. For example, sclerosomatids utilize a variety of
ketones and alcohols, and many Grassatores produce alkyl-
phenols and hydroquinones (Hara et al. 2007, Raspotnig 2012
[2013], Gaetano & Machado 2013, Raspotnig et al. 2014). In
some cases the secretion consists of a single compound (Shear
et al. 2010a, b). However, in the case of the cyphophthalmids,
the two species so far studied show as diverse an array of
molecules as do the travunioids or even more so (Raspotnig et
al. 2005, Jones et al. 2009, Raspotnig 2012 [2013]). Because
cyphophthalmids are sister to all remaining Opiliones, the
scanty data collected so far could be construed to suggest that
early-evolving defensive secretions were complex mixtures,
later winnowed down to only a few, or to single, components.
Evidence against this view is that gonyleptoids, a derived
group, also have complex mixtures, though the compounds
are nearly all methylated and/or ethylated benzoquinones or
alkylphenols (Fottinger et al. 2010, Raspotnig 2012 [2013]).
However, the question that remains unexamined so far is the
extent to which the method of collecting the secretions and the
processing for analysis may have influenced the results; it is
possible that chemical changes in some of the components
could be induced during study, and this could account for the
mixtures obtained.
Results of the character mapping for Travunioidea are
shown in Fig. 4. The various compounds are represented by
numbers that correspond to those in Fig. 2. Two major
findings are seen in the parsimony reconstruction regarding
the chemicals that constitute the major components. First, the
major component N,N-dimethylphenylethylamine (9) was
recovered as the ancestral state for all travunioid genera
included in this analysis. Second, there is a transition from
N,N-dimethylphenylethylamine (9) to anabaseine (7) as the
major component on the branch leading to the eastern
Cladonychiidae (Erebonuister and Theromaster). In addition,
these two genera also possess many other minor or trace
elements that are unique to this lineage, namely salycyl alcohol
(3), anabasine (5), 2,3'-dipyridyl (6) and mellein (8). Also,
254
THE JOURNAL OF ARACHNOLOGY
Phenol
rnFumontana
sSoerensenella prehensor
aSoerensenella sp.
aNuncia sp. Springs Junction 1
aNuncia sp. Springs Junction 2
uNuncia sp. Dancing Creek
sNuncia sp. Aratika
tCryptomaster leviathan
rnSpeleomaster pecki
mSpeleomaster lexi
rnErebomaster flavescens
tTheromaster brunneus
aHoloscotolemon lessiniense
aHoIoscotolemon oreophilum
aHoloscotolemon jaqueti
mBrigssus flavescens
tSpeleonychia sengeri
aParanonychus brnnneiis
aMetanonychus idahoensis
aSclerobunus nondimorphicus
2. Benzothiazole
Fumontana
Soerensenella prehensor
Soerensenella sp.
Nuncia sp. Springs Junction 1
Nuncia sp. Springs Junction 2
Nuncia sp. Dancing Creek
Nuncia sp. Aratika
Cryptomaster leviathan
Speleornaster pecki
Speleomaster lexi
Erebomaster flavescens
Theromaster brunneus
Holoscotolemon lessiniense
Holoscotolemon oreophilum
Holoscotolemon jaqueti
Brigssus flavescens
Speleonychia sengeri
Paranonychus brunneus
Metanonychus idahoensis
Sclerobunus nondimorphicus
9. N,N-dimethylphenylethylamine
sFumontana
^Soerensenella prehensor
^Soerensenella sp.
sNuncia sp. Springs Junction 1
sNuncia sp. Springs Junction 2
[ ^ Nuncia sp. Dancing Creek
I ■ Nuncia sp. Aratika
Cryptomaster leviathan
Speleomaster pecki
Speleomaster lexi
Erebomaster flavescens
Theromaster brunneus
Holoscotolemon lessiniense
^Holoscotolemon oreophilum
I [I nHoloscotolemon jaqueti
l^-am^mBrigssus flavescens
’’“tmm^.mSpeleonychia sengeri
aParanonychus brunneus
mMetanonychus idahoensis
aSclerobunus nondimorphicus
Fumontana
Soerensenella prehensor
Soerensenella sp.
Nuncia sp. Springs Junction 1
Nuncia sp. Springs Junction 2
Nuncia sp. Dancing Creek
Nuncia sp. Aratika
Cryptomaster leviathan
Speleomaster pecki
Speleomaster lexi
Erebomaster flavescens
Theromaster brunneus
Holoscotolemon lessiniense
Holoscotolemon oreophilum
Holoscotolemon jaqueti
Brigssus flavescens
Speleonychia sengeri
Paranonychus brunneus
Metanonychus idahoensis
Sclerobunus nondimorphicus
6,7. 2,3’Dipyridyl and Anabaseine
rnFumontana
aSoerensenella prehensor
sp.
uNuncia sp. Springs Junction 1
aNuncia sp. Springs Junction 2
uNuncia sp. Dancing Creek
uNuncia sp. Aratika
3 Cryptomaster leviathan
aSpeleomaster pecki
ttSpeleomaster lexi
rnErebomaster flavescens
aTheromaster brunneus
rnHoloscotolemon lessiniense
aHoloscotolemon oreophilum
uHoloscotolemon jaqueti
a Brigssus flavescens
aSpeleonychia sengeri
aParanonychus brunneus
aMetanonychus idahoensis
aSclerobunus nondimorphicus
c
10. Nicotine
uFumontana
aSoerensenella prehensor
aSoerensenella sp.
aNuncia sp. Springs Junction 1
aNuncia sp. Springs Junction 2
aNuncia sp. Dancing Creek
aNuncia sp. Aratika
1 Cryptomaster leviathan
aSpeleomaster pecki
aSpeleomaster lexi
nErebomaster flavescens
iTheromaster brunneus
aHoloscotolemon lessiniense
rnHoloscotolemon oreophilum
aHoloscotolemon jaqueti
aBrigssus flavescens
aSpeleonychia sengeri
aParanonychus brunneus
aMetanonychus idahoensis
aSclerobunus nondimorphicus
Figure 3. — Results of chemical character mapping for Insidiatores. Only those chemicals with 2 or more steps are shown. Black = presence,
white = absence.
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
nioidea. Numbers correspond to the chemicals listed in Tables 1 and
2. Boxed numbers above a branch are character gains, those below are
losses. Bold boxes are major components and regular boxes are
minor/trace components. Dashed boxes represent those chemicals
that are equally parsimonious (present/absent) along the branch; but
branches with definite gains for these chemicals are also included.
Boxes with asterisks indicate a change in component concentration
(e.g., change from major to minor).
Erehomaster is the only taxon known to possess 4-hydro-
xybenzenethanol (4). The sclerobunines (Sclerobiiuus and
Metanonychus Briggs 1971) have lost phenol (1) as a
component but have gained both nicotine (10) and N,N-
dimethylisoamylamine (11). Interestingly, two species of
Holoscotolemon also produce nicotine.
Raspotnig (2012 [2013]) discussed at length the possible
phylogenetic and systematic implications of the diversity of
defensive compounds in Opiliones. Overlooking some disso-
nant results, it appears that the suborder Cyphophythalmi can
be characterized by methyl ketones, naphthoquinones and
related compounds. Benzoquinones appear in phalangiid
Eupnoi, and “sclerosomatid compounds" (noncyclic ketones,
alcohols and aldehydes, such as 4-methyl-3-hexanone) are
found in sclerosomatid Eupnoi. Few Dyspnoi have been
examined, but naphthoquinones and anthraquinones have
been found. Grassatores produce predominantly phenols,
benzoquinones and hydroquinones. Insidiatores, up to the
findings of this study, were characterized by nitrogen-
containing alkaloids. Raspotnig (2012 [2013]) is quick to
point out that taxonomic sampling within the Opiliones has
been erratic and many taxa remain unsampled, or known only
from unpublished or preliminary results.
Raspotnig (2012 [2013]) proposed a number of phylogenetic
hypotheses that may be summarized as follows: 1) complex
mixtures of secretions are plesiomorphic compared to uniform
or less diverse mixtures; 2) naphthoquinones and methyl
ketones, as found in cyphophthalmids, are basal; 3) naphtho-
quinones are synapomorphic for a clade Cyphophthalmi +
Palpatores; 4) acyclic compounds in Cyphophthalmi and
Sclerosomatidae may have a common origin; 5) “sclerosoma-
tid compounds” may represent a synapomorphy for Palpa-
tores; 6) a deep chemical divergence separates Insidiatores and
Grassatores; and 7) a link between the chemistry of
Cyphophthalmi -i- Palpatores and Laniatores remains to be
found.
But the phylogenetic signal is not so clear as that. The
dissonant results mentioned above seem to significantly
255
disrupt the characterizations given. Among the anomalies
Raspotnig (2012 [2013]) mentions which require explanation
are the presence of naphthoquinones in some putative
sclerosomatids (Gy as sp.), ketones in some Gonyleptidae
(Grassatores), and now, as a result of our work, methyl
ketones (“sclerosomatid substances”) in Triaenonychidae and
phenol in Fumontana deprehendor, a species that consistently is
recovered in phylogenies as sister to remaining triaenonychids.
At least these latter two make possible a tentative link between
Laniatores and some Palpatores.
Caetano & Machado (2013) conducted a phylogenetic
analysis of the distribution of scent gland chemistry in
Grassatores, and concluded that benzoquinones were ances-
tral, with alkylphenols evolving independently many times.
Using the same data, but a different method of analysis and a
different outgroup, Raspotnig et al. (2014) concluded the
opposite — that benzoquinones were derived and alkylphenols
ancestral. Based on the methods used and the fact that
Raspotnig et al. (2014) used a more appropriate outgroup, we
agree with the latter conclusion. Our finding that phenol is
probably ancestral in Insidiatores (see Fig. 3) reinforces this,
although exact phylogenetic relationships between Insidiatores
and Grassatores remain unclear.
Raspotnig (2012 [2013]) did not attempt to map the known
characters on any established phylogenetic tree of Opiliones.
However, study of his Table 2 (pp. 9-10) and our Fig. 3 seems
to indicate that at least at the present state of knowledge, there
is a great deal of homoplasy present, with various types of
compounds being lost and then regained, or evolving
independently.
In our results for Insidiatores, the most divergent observa-
tion is the presence of 4-methyl-3-hexanone as the major
component in all of the New Zealand triaenonychids we
studied. If we consider Fumontana as a plesiomorphic
outgroup, we have the problem of getting from phenol to
these noncyclic ketones. The travunioids stand alone with the
predominant secretion of either N,N-dimethylphenylethyla-
mine or tobacco alkaloids like nicotine and anabaseine. A
major question, which by extension could be applied to the
entire phylogenetic scheme of this character, is how one gets
from one compound or set of compounds in a supposed
plesiomorphic taxon to a chemically completely different
compound further up in the tree. In other words, is it
reasonable to assume a transition from phenol to 4-methyl-3-
hexanone?
ACKNOWLEDGMENTS
Analysis facilities were provided by the Department of
Chemistry at Virginia Military Institute. WAS thanks Dr.
Fred Coyle for hospitality and guidance in western North
Carolina, and Chris Bedel and the staff of the Edge of
Appalachia Preserve, West Union, Ohio. Participation of
WAS was supported by a grant from the Professional
Development Committee of Hampden-Sydney College. Field-
work in western North America was supported by grants from
the American Arachnological Society Vincent Roth Fund for
Systematic Research. Adrienne Richart, Nicholas Richart,
and William P. Leonard helped secure specimens. Alexa
R. Feist imaged specimens and accessioned images to
MorphBank.
256
THE JOURNAL OF ARACHNOLOGY
LITERATURE CITED
Caetano, D. & G. Machado. 2013. The ecological tale of Gonylepti-
dae (Arachnida, Opiliones) evolution: phylogeny of a Neotropical
lineage of armoured harvestmen using ecological, behavioural and
chemical characters. Cladistics 2013:589-609.
Derkarabetian, S. & M. Hedin. 2014. Integrative taxonomy and
species delimitation in harvestmen: a revision of the western North
American genus Sclerohimus (Opiliones: Laniatores: Travunioi-
dea). PLOS ONE 9:el()4982. doi:10.1371/journal.pone00104982.
Derkarabetian, S., D.B. Steinmann & M. Hedin. 2010. Repeated and
time-correlated morphological convergence in cave-dwelling har-
vestmen (Opiliones, Laniatores) from montane western North
America. PLOS ONE 5:el0388. doi:10.1371/journal.pone.0010388.
Derkarabetian, S., J. Ledford & M. Hedin. 2011. Genetic diversifi-
cation without obvious genitalic morphological divergence in
harvestmen (Opiliones, Laniatores, Sclerohimus robustus) from
montane sky islands of western North America. Molecular
Phylogenetics and Evolution 61:844-853.
Epka, O., J.W. Wheeler, J.C. Cokendolpher & R.M. Duffield. 1984.
N,N-dimethyl- phenylethylamine and bornyl esters from the
harvestman Sclerohimus robustus (Arachnida: Opiliones). Tetrahe-
dron Letters 25:1315-1318.
Estable, C., M.I. Ardao, N.P. Brasil & L.F. Fieser. 1955.
Gonyleptidine. Journal of the American Chemical Society 77:4942.
Fottinger, P., L.E. Acosta, H.J. Leis & G. Raspotnig. 2010.
Benzoquinone-rich exudates from the harvestman Paclirlus paes-
sleri (Opiliones: Gonyleptidae: Pachylinae). Journal of Arachnol-
ogy 38:584-587.
Forster, R.R. 1954. The New Zealand Harvestmen (Sub-order
Laniatores). Canterbury Museum Bulletin 2:1-329.
Giribet, G., L. Vogt, A. Perez Gonzalez, P. Sharma & A.B. Kury.
2010. A multilocus approach to harvestman (Arachnida: Opi-
liones) phylogeny with emphasis on biogeography and the
systematics of Laniatores. Cladistics 26:408-437.
Gnaspini, P. & M.R. Hara. 2007. Defense mechanisms. Pp. 374-399.
Ill Harvestmen, the Biology of Opiliones. (R. Pinto-da-Rocha, G.
Machado & G. Giribet, eds.). Harvard University Press, Cam-
bridge, Massachusetts.
Hara, M., A. Cavalheiro, P. Gnaspini & D. Santos. 2005. A
comparative analysis of the chemical nature of defensive secretions
of Gonyleptidae (Arachnida: Opiliones: Laniatores). Biochemical
Ecology and Systematics 33:1210-1225.
Hedin, M., J. Starrett, S. Akhter, A.L. Schonhofer & J.W. Shultz.
2012. Phylogenomic Resolution of Paleozoic Divergences in
Harvestmen (Arachnida, Opiliones) via Analysis of Next-Gener-
ation Transcriptome Data. PLOS ONE 7(8):e42888. doi:10.1371/
journal. pone. 0042888.
Jones, T., W.A. Shear & G. Giribet. 2009. The chemical defense of a
stylocellid (Arachnida, Opiliones, Stylocellidae), from Sulawesi,
with comparisons to other Cyphophthalmi. Journal of Arachnol-
ogy 37:147-150.
Kury, A.B. 2003. Annotated catalog of the Laniatores of the New
World (Arachnida, Opiliones). Revista Iberica de Aracnologia,
volumen especial monografico 1:1-337.
Kury, A. 2007. Synthetonychiidae Forster, 1954; Travuniidae
Absalon and Kratchovil, 1932; Triaenonychidae Sorensen 1886.
Pp. 235-243. In Harvestmen, the Biology of Opiliones. (R. Pinto-
da-Rocha, G. Machado & G. Giribet, eds.). Harvard University
Press, Cambridge, Massachusetts.
Kury, A.B. & A. Cruz Mendes. 2007. Taxonomic status of the
European genera of Travuniidae (Arachnida, Opiliones, Lania-
tores). Munis Entomology & Zoology 2:1-14.
Mendes, A.C. & A.B. Kury. 2008. Intercontinental Triaenonychi-
dae— the case of Cenitonioiitici (Opiliones: Insidiatores). Journal of
Arachnology 36:273-279.
Raspotnig, G. 2012 (2013). Scent gland chemistry and chemosyste-
matics in harvestmen. Biologia Serbica 34:5-18.
Raspotnig, G., G. Fauler, M. Leis & H.J. Leis. 2005. Chemical
profiles of scent gland secretions in the cyphophthalmid opilionid
harvestmen, Siro duricorius and S. e.xilis. Journal of Chemical
Ecology 31:1353-1368.
Raspotnig, G., V. Leutgib, M. Schaider & C. Komposch. 2010.
Naphthoquinones and antrhroquinones from scent glands of a
dyspnoid harvestman, Parcmeinastoma quadripimctatimi. Journal
of Chemical Ecology 36:158-162.
Raspotnig, G., M. Schaider, P. Fottinger, C. Komposch & 1.
Karaman. 2011. Nitrogen- containing compounds in the scent
gland secretions of European cladonychiid harvestmen (Opiliones,
Laniatores, Travunioidea). Journal of Chemical Ecology 37:
912-921.
Raspotnig, G., M. Bodner, S. Schaffer, S. Koblmiiller, A. Schonhofer
& 1. Karaman. 2014. Chemosystematics in the Opiliones (Arach-
nida): a comment on the evolutionary history of alkylphenols and
benzoquinones in the scent gland secretions of Laniatores.
Cladistics 2014:1-8.
Rocha, D., F. Wouters, D. Zampieri, T. Brocksom, G. Machado &
A. Marsaioli. 2013. Harvestman phenols and benzoquinones:
characterization and biosynthetic pathways. Molecules 18:
11429-11451.
Shear, W.A. 1977. Fimiontana deprelieiidor, n. gen., n. sp., the first
triaenonychid opilionid from eastern North America (Opiliones:
Laniatores: Triaenonychidae). Journal of Arachnology 3:177-183.
Shear, W.A. & S. Dekarabetian. 2008. Nomenclatorial changes in
Triaenonychidae: Sclerohimus parvus Roewer is a junior synonym
of Parammychus hrimiieus (Banks), Mutsimonyclius Suzuki is a
junior synonym of Parmumychus Banks, and Kaolinonychidae
Suzuki is a junior synonym of Paranonychinae Briggs (Opiliones:
Triaenonychidae). Zootaxa 1809:67-68.
Shear, W.A., T.H. Jones & A.J. Snyder. 2010a. Chemical defense of
phalangodid harvestmen: Bisliopella laciniosa and Texella hifurcata
produce 2-inethyl-5- ethylphenol (Opiliones: Grassatores: Phalan-
godidae). Bulletin of the British Arachnologica! Society 15:27-28.
Shear, W.A., A.J. Snyder, T.H. Jones, H.M. Garaffo & N.R.
Andriamaharavo. 2010b. The chemical defense of the Texas cave
harvestman ChimptipeUohimus madlae: first report on the family
Stygnopsidae and on a North American troglobiont harvestman
(Opiliones: Gonyleptoidea). Journal of Arachnology 38:126-127.
Thomas, S.M. & M. Hedin. 2008. Multigenic phylogeographic
divergence in the palaeoendemic southern Applachian opilionid
Fimiontana deprelieiidor Shear (Opiliones, Laniatores, Triaenony-
chidae). Molecular Phylogenetics and Evolution 46:645-658.
Manuscript received / July 2014, revised 4 September 2014.
2014. The Journal of Arachnology 42:257-267
Species differences and geographic variation in the communal roosting behavior of Priomostemma
harvestmen in Central American rainforests
Gregory F. Grether*, Theresa L. AlJer^ Nicole K. Grucky', Abrahm Levi’, Carmen C. Antaky* and Victor R. Townsend, Jr,-:
‘Department of Ecology and Evolntionary Biology, University of California, Los Angeles, California 90095, USA.
E-mail: ggrether@ucla.edu; -Department of Biology, Virginia Wesleyan College, 1584 Wesleyan Drive, Norfolk,
Virginia 23502, USA
Abstract. Many species roost communally but the proximate causes and ultimate functions of this widespread behavior
remain poorly understood. We studied the communal roosts of two undescribed species of harvestmen in the genus
Prionostemma Pocock 1903 at a Caribbean rainforest site in southeastern Nicaragua. The species are quite similar in gross
morphology but differ in body coloration, male genitalia, and roosting behavior. One species roosts primarily on spiny
palms while the other species, which is darker in coloration, roosts inside buttress root cavities. In a mark-recapture study,
the cavity-roosting species had higher levels of individual site fidelity than found previously in the spiny palm-roosting
species, perhaps because suitable cavities are scarcer than spiny palms. The tree cavity aggregations were strongly male-
biased, which our review of the literature suggests is unusual for harvestman roosts. The overall sex ratio of the spiny palm
aggregations was 1:1, but some roost sites were strongly male biased while others were strongly female biased. Removing all
harvestmen from 10 spiny palm roost sites shifted the overall sex ratio toward males on subsequent days, but the sites with
skewed sex ratios remained skewed in the same directions despite complete turnover in roost membership. These results are
discussed in relation to mechanisms of roost formation and possible sex differences in vagility, microhabitat preferences
and sensitivity to disturbance. Both species also occur at La Selva Biological Station in Costa Rica but neither forms
roosting aggregations in spiny palms or tree cavities there. A possible explanation for the geographic variation is that
roosting patterns change over time through cultural drift.
Keywords: Aggregation, conspecific attraction, mark-recapture, Opiliones, sex ratio
Animals in diverse taxonomic groups congregate for the
inactive period of the diurnal cycle, a behavior referred to as
communal roosting (Eiserer 1984; Mallet 1986; Devries et al.
1987; Vulinec 1990; Alcock 1998; Bijleveld et al. 2010).
Communal roosts may offer protection from predators
through dilution or group defenses (Holmberg et al. 1984;
Alcock 1998; Eisner 2004; Willemart & Gnaspini 2004). In
some taxa, communal roosts may also provide thermoregula-
tory benefits (Beauchamp 1999), mating opportunities (Blanco
& Telia 1999), opportunities for food sharing (Wilkinson
1984), or information about the location of food patches
(Beauchamp 1999; Kerth & Reckardt 2003; Bijleveld et al.
2010). Harvestmen (Opiliones) are generally active at night
and roost during the day (reviewed in Machado & Macias-
Ordonez 2007). Some species roost solitarily while others
form aggregations ranging in size from a few individuals to
hundreds (Holmberg et al. 1984; Cockerill 1988; Coddington
et al. 1990; Machado et al. 2000; Willemart & Gnaspini 2004;
Machado & Macias-Ordonez 2007; Wijnhoven et al. 2007;
Wade et al. 2011). The communal roosts of harvestmen can be
dense aggregations, in which most individuals are clinging
to other individuals, or loose aggregations in which most
individuals are in contact with the substrate (reviewed in
Machado & Macias-Ordonez 2007). Some species roost in
caves or other dark places (Holmberg et al. 1984; Willemart &
Gnaspini 2004; Chelini et al. 2011), while other species roost
on the exterior surfaces of rocks or vegetation exposed to
sunlight (Coddington et al. 1990; Grether et al. 2014). The
most frequently proposed functions of Neotropical harvest-
man roosting aggregations are safety from predators, through
dilution and/or chemical defenses, and protection from
desiccation (Coddington et al. 1990; Machado et al. 2000;
Willemart & Gnaspini 2004; Machado & Macias-Ordonez
2007; Grether & Donaldson 2007; Wade et al. 2011; Chelini
et al. 2011).
Studies of intra- and interspecific variation can provide
insights into the proximate causes and ultimate functions
of communal roosts (Chelini et al. 2012). In this paper, we
compare the roosting aggregations of two syntopic species of
Prionostemma Pocock 1903 (Eupnoi: Sclerosomatidae: Ga-
grellinae) harvestmen at Refugio Bartola, a lowland tropical
rainforest site in southeastern Nicaragua. One of the species
usually aggregates on the fronds and trunks of spiny palms
(Arecaceae: Bactris spp., Astrocaryum spp.) in the forest
understory (Fig.l; Donaldson & Grether 2007; Grether &
Donaldson 2007), while the other species aggregates in cavities
at the base of trees (e.g., Fabaceae: Dipteryx panamensis) that
have buttress roots (Fig. 2). Both species form loose aggrega-
tions (Holmberg et al. 1984; Machado & Macias-Ordonez
2007) in which most individuals’ legs are in contact with the
substrate and the legs are flexed. The species are quite similar
in body size and anatomical proportions, but the cavity-
roosting species is notably darker in coloration (Fig. 3). Based
on scanning electron micrographs of male genitalia (Fig. 4),
the same two undescribed species occur at La Selva Biological
Station in Costa Rica (69 km to the SE), although neither is
known to aggregate in spiny palms or tree cavities at La Selva
(see Discussion). Following Proud et al. (2012), we refer to the
species that aggregates in tree cavities at Refugio Bartola as
Prionostemma sp. 1 and to the species that aggregates in spiny
palms as Prionostemma sp. 2.
The population of Prionostemma sp. 2 at Refugio Bartola
has been the subject of several short studies focused on clarifying
the mechanisms of roost formation. Mark-recapture studies
257
258
THE JOURNAL OF ARACHNOLOGY
Figure 1. — Prioiiosteniina roosting aggregations underneath a frond (A) and along the trunk (B) of spiny palms.
established that individual harvestmen are not roost-site faith-
ful (Grether & Donaldson 2007; Teng et al. 2012), and yet
aggregations have formed in the same locations for over 10 years
(Teng et al. 2012; Grether et al. 2014). The long-term use
of specific sites does not appear to be a product of habitat
limitation. Most spiny palms do not attract harvestman aggre-
gations, and those that do are not distinctive in the characteristics
of the palms themselves or microclimate (Grether & Donaldson
2007; Teng et al. 2012). Based on roost site manipulations
and experimental translocations, it has been deduced that these
harvestmen preferentially settle in sites marked with conspecific
scent (Donaldson & Grether 2007; Teng et al. 2012). Thus, the
location of the communal roosts appears to be traditional in
that some sites are used in preference to others only because
conspecifics roosted there in the past (Donaldson & Grether
2007). While the mechanism of roost site selection in Prionos-
temma sp. 2 may result in the repeated use of particular roosting
sites for multiple years, the same mechanism could also cause
populations to drift in roosting microhabitat over longer time
scales. Our finding that the same species is present but does not
roost in spiny palms at La Selva Biological Station provides
tentative support for this cultural drift hypothesis (see Discussion).
GRETHER ET AL.— -VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
259
Figure 2. — Distant (A) and close-up (B) photographs of a tree cavity with a Prionostemma roosting aggregation.
The aggregations of Prionostemma sp. 1 in buttress root
cavities were first discovered at Refugio Bartoia in February
2013 and have not been described previously. To begin to
characterize the roosting behavior of this species, and to
compare it to that of Prionostemma sp. 2, we made structured
behavioral observations and conducted a mark-recapture
study. Comparable data have already been published for
Prionostemma sp. 2 (Donaldson & Grether 2007; Grether &
Donaldson 2007; Teng et al. 2012), so we did not duplicate this
work. Instead, we carried out a removal experiment at spiny
palm aggregation sites (see Grether et al. 2014). In the context
of the species comparison, the primary relevance of the
removal experiment is that it yielded data on Prionostemma sp.
2 roost sex ratios, which have not been reported previously. To
help place our findings into a broader context, we also analyze
data on harvestman roost sex ratios reported in the literature.
METHODS
Study area. — This study was carried out in primary lowland
rainforest at Refugio Bartoia in southeastern Nicaragua
(10.973°N, 84.339°W) from 2-20 February 2013. This private
reserve is contiguous with Indio Maiz Biological Reserve,
the largest remaining tract of primary rainforest in Central
America (ca. 4500 km^). The climate is wet tropical, with
about 4 m of rainfall per year, peak precipitation in June-
August, and a dry season from February-Aprii during which
about 15% of the annual precipitation is recorded (Cody
2000). Approximately 69 m.m of rain fell at Refugio Bartoia
during the study period.
Operational definitions. — We use the term roosting aggre-
gation to refer to groups of two or more individuals resting in
the same “site”. In the case of spiny palm roosts, we consider
all of the spiny palms within 1 m of each other to belong to the
same site (spiny palms tend to grow in clusters with broadly
overlapping fronds). In the case of tree cavity roosts, we
consider a single cavity to be a site. While roosting individuals
of both study species are often close enough together to
have overlapping legs (Figs. 2, 3), we did not use leg overlap
as a criterion for determining aggregation membership (cf.
Willemart & Gnaspini 2004).
Roost measurements and behavioral observations. — Using
flashlights, we searched for harvestman roosts at the base of
1 14 buttressed trees. At the first seven tree cavities in which
Prionostemma roosting aggregations were found, we measured
air temperature, surface temperature, and percent humidity
both within the cavity and outside the cavity using a hygro-
thermometer and infrared thermometer (Extech Instruments
Waltham, MA USA). In addition, we measured the height,
width, depth and compass orientation of the cavity, and the
tree’s circumference at breast height. To characterize the
behavior of the harvestmen in the cavity roosts, we used scan
sampling (Altmann 1974). Under red light, we observed six
of the cavity roosts used in the mark-recapture study for
15 minutes, recording at 1 -minute intervals the number of
harvestmen that were stationary or engaged in the following
behaviors: walking within the cavity; bobbing (moving body
up and down, a likely anti-predator behavior; Holmberg et al.
1984; Grether and Donaldson 2007); ventral rubbing (pressing
260
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Photographs of two Prionostemma species at Refugio
Bartola, Nicaragua. Two female specimens are each shown in dorsal
(A, B), ventral (C, D), and lateral (E, F) views. The female on the left
was found in a tree cavity roost (Prionostemma sp. 1) and the female
on the right was found in a spiny palm roost (Prionostemma sp. 2).
Prionostemma sp. 2 is more uniform and lighter in coloration than
Prionostemma sp. 1. The black coxae (I-III) and red and black
patches on the abdomen of the Prionostemma sp. 1 specimen are
typical of this species. Scale bar = 5 mm.
against substrate and moving body forward, a possible scent-
marking behavior; Donaldson and Grether 2007; Wiilemart
and Hebets 2011); and leg threading (moving leg through
mouth parts, a self-grooming behavior; Edgar 1971; Pereira
et al. 2004; Teng et al. 2012).
Mark-recapture study. — To measure daily turnover in the
tree cavity aggregations, and to check for movement between
nearby tree cavity and spiny palm roosts, we marked and
recaptured harvestmen at seven tree cavity roosts (two other
tree cavity roosts were found too late in the study period to be
included in the mark-recapture study). All harvestmen in a
cavity were captured by hand between 0900 and 1630 h and
placed in a mesh cage (Bioqiiip Products). Individuals that
initially were too deep inside the cavity to be captured were
ilushed out with a stick. The harvestmen were sexed, inspected
for ectoparasitic larval mites, marked on the dorsal surface of
the abdomen with small dots of paint (Marvy Decocolor, ‘
Uchida of America, Torrance, CA) in color combinations i
corresponding to the capture date and location, and then
released in their original cavities. This procedure was carried
out on three consecutive days at each aggregation site and a jj
final recapture was done on the fourth day. On all four days at |
each site, we also searched for marked harvestmen on all j
buttress roots and spiny palms within a 10 m radius. 1
Recaptured individuals were given additional paint dots !
corresponding to the location and date of recapture. During
this study, we marked 257 harvestmen.
Removal experiment. — Concurrent with the mark-recapture !,
study, we captured and removed all of the harvestmen from 10
spiny palm roosts on at least four consecutive days and for up !
to six consecutive days if the site continued to attract new
harvestmen. The animals were captured by hand and held
temporarily in a mesh cage. Individuals that initially were too i
high to be captured were chased down with a wooden pole. I,
The harvestmen were sexed, marked on the dorsal surface of
the abdomen with small dots of paint identifying the capture '
location, and released at least 50 m away from the aggregation
site on the trunk of another spiny palm. During the j
experiment, we removed 989 harvestmen (37-224 per site).
At each removal site, we took a standard set of ro.easure- |
ments, including canopy cover, crown height, spine density, |
and trunk diameter (the first three factors have been found to
correlate with the size of Prionostemma sp. 2 aggregations;
Teng et al. 2012). Canopy cover was measured with a concave
spherical densiometer (Forestry Suppliers Inc, Jackson, MS,
USA). Crown height was measured with a graduated pole, and
trunk diameter was measured with a ruler, on all of the spiny
palms at a site. Spine density was measured by placing a 4 cm^
wire quadrat on the trunk of the palms and counting all spines ;
originating within the quadrat. The quadrat was placed at f
three different heights above the ground (0.8, 1.15, and 1.55 m)
in the four cardinal directions around the trunk. If a site had '!
more than five spiny palms within 1 m of each other, spine j
density was measured on half of the trees chosen at random. Il
One observer made ail measurements of a particular type. Site ||
averages for spine density, crown height and trunk diameter i|
were used in the analysis. ji
Analysis of harvestman communal roost sex ratios from j|
the literature. — We searched the primary literature for reports i
of the sex ratio of harvestman communal roosts. For inclusion li
in our statistical analysis, a report needed to contain one of the l|
following kinds of data on the sex ratio at communal roosts: |
the number of individuals of each sex, the total number of ,
individuals and the sex ratio, or the sex ratio and its standard j
deviation. We did not impose our operational definitions of
terms such as aggregation and roosting site (see above) on I
other studies but instead accepted the definitions used in
the original studies. For example, some researchers define
aggregations as groups of three or more individuals with
overlapping legs (e.g., Wiilemart & Gnaspini 2004). However, j
we do not believe this compromised the validity of our ||
literature review. In cases of multispecies aggregations (e.g., )
Machado & Vasconcelos 1998; Chelini et al. 2012), we :
analyzed the data for each species separately. Because a [
sample size of five is the minimum required to establish ji
whether a sex ratio deviates significantly from 1:1 with a
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
261
Figure 4. — Scanning electron micrographs of male genitalia. The genitalia of the species of Prionosteimna that typically roosts in spiny palms
at Refugio Bartola, Nicaragua (A, B) is very similar to that of Prionostemma sp. 2 (Proud et al. 2010) at La Selva, Costa Rica (E, F) in both shape
and proportion. There is a small difference in the shape of the stylus - in panel F the stylus attenuates but in panel B it does not. Nevertheless,
these are probably the same species. The curling of the alates (winglets) just before the glans on the Nicaraguan specimen (A) is an artifact. The
species that roosts in tree cavities at Refugio Bartola (C, D) is undoubtedly the same species as Prionostemma sp. 1 at La Selva (G, H). The large
structure at the base of the penis (best seen in panel H), the lateral expansions (alates), and the stylus are identical in size and shape, as viewed
from both dorsal (C, G) and ventral perspectives (D, H), to Prionostemma sp. 1 at La Selva. Scale bar = 50 /mi.
binomial test, we excluded sex ratios based on sample sizes
smaller than five. We also excluded sex ratios based on
samples that likely included solitary roosting or non-roosting
harvestmen (e.g., Tsurusaki 2003). Because harvestmen can
live for years as adults (Gnaspini 2007), we did not pool data
from repeated visits to the same sites and instead analyzed
data from different months and seasons separately. In the case
of the study of Mestre and Pinto-da-Rocha (2004), we chose
one month per season that best represented the average sex
ratio of all the months in that season. In the case of the study
of Willemart and Gnaspini (2004), we pooled data from
different aggregation sites but analyzed each collection date
262
THE JOURNAL OF ARACHNOLOGY
Table 1. — Summary of mark-recapture study results. From left to
right: the day of the study, the total number of harvestmen captured,
the number that were unmarked until that day {i.e., not captured
previously), the number that were marked from any previous capture,
the percentage that were marked from any previous capture, the
number returning on the next day, and the percentage returning on
the next day.
Day
Total
Unmarked
Marked
%
Marked
Returning
%
Returning
1
172
172
_
-
96
55.8%
2
141
45
96
68.1%
69
48.9%
3
108
25
83
76.9%
30
27.8%
4
57
15
42
73.7%
-
-
separately because the sex ratio varied significantly within
seasons.
Statistics. — Wilcoxon signed-rank tests were used to com-
pare the microclimate inside and outside of cavities, because
these data are paired by site. Skillings-Mack tests (nonpara-
metric equivalents of repeated measures ANOVAs) were used
to compare the change in harvestman numbers over time,
because there were more than two time points. Binomial tests
were used to compare the observed sex ratios to 0.5. Fisher
exact tests were used to test for associations between nominal
variables (e.g., sex and mite presence). Spearman rank
correlations were used to test for correlations between
continuous variables (e.g., roost sex ratio and canopy cover).
For comparisons involving small sample sizes (e.g., number of
roosts), we computed the P-values by permutation. All
reported F-values are two-tailed. Ranges, means and standard
deviations are provided to facilitate comparisons to other
studies. Stata 12.1 (StataCorp, College Station, TX, USA) was
used for the computations.
RESULTS
Roost characteristics and behavioral observations. — We
found Prionostemma sp. 1 aggregations in nine (7.9%) of 114
buttressed trees examined. Solitary harvestmen of Cosmetidae
species (e.g., Cynorta spp. Koch 1839, Eucynorta spp. Roewer
1912) were often found on the surface of the roots and in the
gaps between them, but the Prionostemma aggregations were
found only in cavities (i.e., holes) just above ground level. The
cavities with Prionostemma aggregations seemed relatively
narrow (mean ± sd, 0.34 ± 0.15 m, n =1) and deep (0.58 ±
0.12 m, n =7), compared to unused cavities. Trees with cavity
roosts ranged in circumference from 1.25-8.14 m (mean ± sd,
3.72 ± 2.38 m, n = 7). Canopy cover readings taken at the
base of the trees ranged from 92.7-96.7% (mean ± sd, 94.4
± 1 .4%, n = 7). The daytime surface temperature was
consistently 1-2 °C lower inside the roosting cavities (mean ±
sd, 25.0 ± 0.8 °C) than immediately outside (mean ± sd, 26.3
± 1.4 °C; Wilcoxon signed-rank test, T — Q,n — 1, P = 0.018).
There were no significant differences in daytime air temper-
ature or humidity inside the roosting cavities (air temperature,
27.0 ± 0.8 °C; humidity, 86.1 ± 6.0%) compared to
immediately outside (air temperature, 27.0 ± 0.8 °C, Wilcoxon
signed-rank test T - 2, n = 1 , P — 0.29; humidity, 88.7 ±
10.3%, T = \, n = 1, P ^ 0.08). During behavioral
observations made at the aggregation sites during the day.
Table 2. — Numbers of females (Nj) and males (N,„) and the sex
ratio, calculated as the proportion female (Pj), at tree cavity roosts on
the first day of the mark-recapture study, sorted from the most male-
biased to the least male-biased. Binomial tests (BT) compare the
observed sex ratio to 0.5. Two-tailed F-values are shown for samples
with n > 5. With a sequential Bonferroni correction for multiple tests
(Holm 1979), across the six T-values in the table, the criterion for
statistical significance at a = 0.05 is P < 0.05.
Tree cavity
Nr
N,„
Pf
P
I
2
18
0.1
0.0004
2
1
8
0.11
0.04
3
3
16
0.16
0.004
4
10
44
0.19
< 0.0001
5
8
28
0.22
0.001
6
8
23
0.26
0.01
7
1
2
0.33
-
most individuals were either stationary (mean of the site scan
sampling means, 77.5%) or bobbing (19.2%). Some individ-
uals were walking within the cavity (2.0%), but no leg-
threading, ventral rubbing, foraging, or reproductive behav-
iors (e.g., mating, egg laying) were observed.
Mark-recapture study. — The maximum daily return of
Prionostemma sp. 1 to the cavity roost where they were
marked (i.e., from one day to the next) ranged from 44.4-
77.4% per site (n — 7; mean ± sd, 59.4 ± 12.1%). Marked
harvestmen were recaptured on 221 occasions and always in
the same cavity where they were originally marked.
Despite the relatively high return rates, capturing and
marking Prionostemma sp. 1 evidently reduced their likelihood
of returning. The total number of Prionostemma found in the
cavity roosts decreased from 172 on the first day to 141 on the
second day, 108 on the third day, and 57 on the fourth day
(Table 1). The change over time in harvestmen numbers was
highly significant (Skillings-Mack test, SM = 15.3, simulation
P < 0.0001). As the total number of harvestmen declined, the
proportion of harvestmen that carried marks from any
previous day’s capture remained relatively stable but the
proportion of harvestmen returning on the next day declined
over time (Table 1).
Because recaptured individuals were given new marks on
each day, we were able to infer that some individuals returned
repeatedly to the same cavity. Of the 57 harvestmen found in
the final recapture, 42 (73.7%) were present on a prior day, 32
(56.1%) were present on at least two prior days, and 17
(29.8%) were present on all three prior days.
Within the 10-m radii of the seven cavity roosts in the mark-
recapture study, there were 35 other buttressed trees and 40 spiny
palms. Prionostemma aggregations were found in one (2.8%) of
these buttressed trees and two (5%) of the spiny palms. Only two
harvestmen in the mark-recapture study were found away from
the buttressed tree where they were marked. One was found on
the trunk of another buttressed tree and the other was found in a
spiny palm aggregation. In both cases, the marked individuals
were within the 10-m radius of the cavity where they were
marked (as opposed the 10-m radius of a different roost cavity).
The sex ratio at cavity roosts was strongly male-biased both
overall (50 females, 207 males, proportion female = 0.24;
binomial test P < 0.0001) and at all seven of the mark-
recapture sites (Table 2; proportion female among all animals
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
263
Table 3. — Numbers of females (N/) and males (N,„) and the proportion female {P/) at spiny palm roosts prior to the first removal and after the
first removal. Roost sites are sorted by Pf prior to the first removal, from the most male-biased to the most female-biased. Binomial tests (BT)
compare the observed sex ratio to 0.5. Fisher’s exact tests compare the pre-removal sex ratio to the post-removal sex ratio. Two-tailed F-values
are shown. With a sequential Bonferroni correction for multiple tests (Holm 1979), across all 30 P-values in the table, the criterion for statistical
significance at oc = 0.05 is P < 0.003.
Spiny
palm
Prior to first removal
After first removal
Fisher 's
exact P
Nr
N,„
Pf
P
Nr
N,„
Pi
P
1
1
24
0.04
< 0.0001
3
9
0.25
0.14
0.09
2
5
37
0.12
< 0.0001
1
18
0.05
0.0008
0.65
3
15
91
0.14
< 0.0001
11
107
0.09
< 0.0001
0.30
4
8
34
0.19
< 0.0001
6
30
0.17
0.0007
1.0
5
17
14
0.55
0.72
28
50
0.36
0.02
0.09
6
58
36
0.62
0.03
13
46
0.22
<0.0001
< 0.0001
7
43
25
0.63
0.04
11
30
0.27
0.004
< 0.0001
8
31
7
0.82
0.0001
17
2
0.89
0.007
0.70
9
56
7
0.89
< 0.0001
41
17
0.71
0.002
0.02
10
16
2
0.89
0.001
15
7
0.68
0.13
0.15
marked, range 0.10-0.28). There was no significant variation
among roost sites in the sex ratio of harvestmen marked
during the first capture (Fisher’s exact test, P = 0.77) or across
all of the harvestmen marked during the study (P = 0.27), nor
did the overall sex ratio change significantly over time from
the first capture to the last recapture (Fisher’s exact test, P -
0.53). Of the 221 recaptures, 50 (22.6%) were female, which
did not differ significantly from the overall sex ratio (binomial
test P = 0.69). Thus, males and females exhibited similar levels
of individual site fidelity.
Figure 5. — Variation in, and effects of the removal treatment on,
the sex ratio at spiny palm roosting sites. Each point represents the
sex ratio (proportion female) before and after the removal treatment
commenced at 10 established aggregation sites. The dashed line has
a slope of 1 and thus points below the line indicate that the sex
ratio decreased after the removal treatment began. See text for
statistical results.
Red ectoparasitic larval mites were found on 21 (8.2%) of
the 257 individuals marked in cavity roosts. The maximum
number of mites per individual was three and most mites (24
of 26) were attached to legs. There was no significant sex
difference in mite prevalence ( 1 6 of 207 males and 5 of 50
females; Fisher’s exact test, P - 0.57). Mite prevalence varied
significantly among sites (Fisher’s exact test, P < 0.0001). No
mites were found infesting harvestmen at four of the seven
sites. At the site with the highest mite prevalence, 14 of 45
individuals (31.1%) had at least one mite. By comparison,
mites were rare at the Prionostemma sp. 2 spiny palm
aggregations during this study (fewer than 1 in 50 individuals;
G.F.G et al., pers. obs.).
Removal experiment. — The removal treatment had an
unexpected effect on the sex ratio at Prionostemma sp. 2
roosts. While the overall sex ratio was approximately 1:1 at the
first removal (Table 3; 250 females, 277 males, proportion
female = 0.49; binomial test P = 0.26), it was significantly
male-biased in subsequent removals (total count: 146 females,
316 males, proportion female = 0.37; binomial test P <
0.0001). A sex ratio shift of this magnitude is very unlikely to
have occurred by chance (Fisher’s exact test, P < 0.0001).
Seven of the 10 sites had strongly skewed sex ratios (female
biased, n = 3; male biased n - 4), and despite complete
turnover in roost membership, the initial and subsequent (i.e.,
post-removal) sex ratios were strongly correlated across sites
(Fig. 5, Spearman rank correlation r^ = 0.79, n = \0 sites, P -
0.008). As shown in Fig. 5, three sites that initially had weakly
female-biased sex ratios all shifted to having male-biased sex
ratios, three sites that initially had strongly female biased sex
ratios remained strongly female-biased, and four sites that
initially had strongly male-biased sex ratios remained strongly
male-biased. None of the measured site characteristics
correlated significantly with the initial roost sex ratio (canopy
cover I's = 0.22, u - 10, F = 0.53; spine density r^ = -0.02,
P - 0.95; crown height r, = 0.44, P = 0.20; trunk diameter
r, = -0.52, P = 0.14).
All 989 of the harvestmen removed during this experiment
were marked and released on other spiny palms. For the
duration of the study, none of the marked harvestmen
returned to the site where they were initially captured.
264
THE JOURNAL OF ARACHNOLOGY
However, six marked individuals, from three different release
sites, were found inside the same tree cavity in the mark-
recapture study. The distance between the release sites and this
tree cavity ranged from 28-^5 m and the harvestmen were
found there 1-2 days after they were released.
Harvestman communal roost sex ratios from the literature. —
We found data on the sex ratios at communal roosts of 12
harvestman species in the published literature. Most of the
reported communal roost sex ratios did not deviate signifi-
cantly from 1:1 (Tabled). Significantly female-biased com-
munal roost sex ratios were found in Goniosoma albiscriptiim
Mello-Leitao 1932 at one of seven sampling dates in 2000
(Willemart & Gnaspini 2004) and in a multi-year study of
Goniosoma longipes Roewer 1931 (Machado et al. 2000), both
at caves in southeastern Brazil. Tsurusaki (2003) reported
significantly male-biased sex ratios in general collections of
two harvestman species in Japan, but whether these species
form roosting aggregations was not stated. Prinostemma sp. 1
appears to be the only known example of a harvestman with
strongly male-biased communal roost sex ratios.
DISCUSSION
Roosting behavior (Mestre & Pinto-da-Rocha 2004; Will-
emart & Gnaspini 2004), sex ratios (Chelini et al. 2012), and
mite infestation levels (Townsend et al. 2006) are all known to
vary seasonally in harvestmen, so it cannot be assumed that
the species differences that we observed hold year round. With
that caveat, the preferred roosting microhabitats of the two
Prionostemma species at Refugio Bartola during the dry
season could scarcely be more distinct. All of the Prionos-
temma sp. 1 aggregations that we found were inside cavities
at the base of buttressed trees, while Prionostemma sp. 2
aggregations are usually found several meters above the
ground in spiny palms (Grether & Donaldson 2007). Some
marked individuals were found moving between tree cavity and
spiny palm aggregations, however, and a review of photos
taken of roosting aggregation in previous years yielded three
additional cases of individuals with the coloration of Prionos-
temma sp. 1 in spiny palm aggregations (G.F.G., pers. obs.).
The extent to which these species intermingle at roost sites
remains to be quantified. Solitary individuals of Cosmetidae
harvestmen (e.g., Cynorta, Eucynorta) are often found in
Prionostemma aggregations as well (unpublished data).
In mark-recapture studies, Prionostemma sp. 1 showed
much higher daily return rates (up to 11%) than Prionostemma
sp. 2 (up to 26%; Grether & Donaldson 2007). A likely
explanation is that suitable tree cavities are scarce compared
to spiny palms. Another possible explanation is that cavity
roosts are easier for the harvestmen to relocate.
We found ectoparasitic larval mites on 8% of the
Prionostemma sp. 1 and on less than 1 % of the Prionostemma
sp. 2. Whether this is causally related to the species difference
in roosting habitat is unknown but seems possible. Species
differences in larval mite infestation rates have previously been
linked to species differences in foraging habitats (Townsend
et al. 2008).
We have found evidence for handling effects in both species
(see Grether & Donaldson 2007 for the Prionostemma sp. 2
evidence), but the rapid decrease over time in the number of
Prionostemma sp. 1 at the mark-recapture sites leaves little
doubt that capturing these animals makes them less likely to
return to the same site. Harvestmen have been shown to have
spatial associative learning ability (dos Santos et al. 2013) and
may avoid sites where they have previously been disturbed.
Another possible explanation is that captured harvestmen
release defensive chemicals (Machado 2002; Machado et al.
2002; Eisner 2004; Rocha et al. 2013) that persist at the site of
disturbance and make it less attractive for roosting. In any
case, the decreasing return rate over time (Table 1) suggests
that these harvestmen would rapidly abandon a site where
they were disturbed repeatedly.
Perhaps the most interesting species difference found in our
study at Refugio Bartola is the difference in roost sex ratios.
The Prionostemma sp. 1 aggregations were strongly male
biased (76% male), which may be rare in harvestmen. The
communal roosts of some insects are male biased (Alcock
1998; Switzer & Grether 1999), but our review of the literature
turned up no other harvestman examples (Table 4). Most
harvestmen aggregation sex ratios reported in the literature do
not differ significantly from 1:1, but female biases have been
reported in several Laniatores species (Table 4). In some cases,
the sex ratio at communal roosts may merely reflect the
population sex ratio (Chelini et al. 2012), and female-biased
population sex ratios may be indicative of facultative
parthenogenesis (Tsurusaki 1986, 2003). Willemart and
Gnaspini (2004) found that the communal roosts of Gonio-
soma albiscriptum (Laniatores: Gonyleptidae) were more
female-biased than the population sex ratio and hypothesized
this is because males are more aggressive and less gregarious [
than females. Goniosoma albiscriptum roosting aggregations
break up during the peak reproductive season, perhaps
because females become intolerant of conspecifics while
guarding their eggs and males become intolerant of all other
males (Willemart & Gnaspini 2004). A similar mechanism j
could potentially account for male-biased roost sex ratios, if !
males continued to roost communally while females roosted j
away from aggregation sites to guard their eggs. We did not
encounter egg-guarding females during our study, however. i
Thus, the male-bias of Prionostemma sp. 1 communal roosts is
a mystery that merits further study.
Although the overall sex ratio of Prionostemma sp. 2 roosts
did not differ from 1:1, most of the aggregation sites were
strongly sex biased. In the removal experiment, sites that
initially had weakly female-biased sex ratios became male-
biased while sites with strongly skewed sex ratios remained ,
skewed in the same directions despite complete turnover in
roost membership (Table 3, Fig. 5). A possible explanation
for the shift in the overall sex ratio is that males are more
vagile than females, as has been reported for other species of
harvestmen and for arachnids generally (reviewed in Will-
emart and Gnaspini 2004). If removing the harvestmen from
an aggregation site temporarily depletes the local pool of
potential recruits, males may move into the area first, resulting
in a temporary male bias in the roost sex ratio. But why would
some sites attract mainly females? Sex differences in roost-site
preferences could potentially explain the pattern, but none of
the roost characteristics that we measured were predictive of
the sex ratio. Another possible explanation is that the sexes
differ in their scent-marking chemicals and are most strongly [
attracted to same-sex scent. The latter hypothesis could be
Table 4. — Sex ratios of harvestman roosting aggregations reported in the literature. Abbreviations in column titles: Mo., month; Nag_ number of aggregations sampled; number
of females; N„„ number of males; P/, proportion female; Sig., significance level of statistical test versus Pf = 0.5; Ref., source of data. Country codes: BR, Brazil; NL, Netherlands; NI,
Nicaragua; US, United States. Season codes: Sp, spring; Su, summer, W, winter; F, fall. F-values for 2-tailed tests: NS P > 0.1; % P < 0.1; *P < 0.05; **P < 0.01, ***p < 0.001.
Reference codes: 1, Machado and Vasconcelos 1998; 2, Mestre and Pinto-da-Rocha 2004; 3, Willemart and Gnaspini 2004; 4, Machado et al. 2000; 5, Machado 2002; 6, Chelini et al.
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
c. c
:3 -o
oooooooooooooodooooooo
— (N — I I m (N ^ ^
I I I I I
>. >.
o
O- 3
D. ■
3^0 5
TD
? =
^ is
< S
= g-^l
< M Q S
O
I
JO ^
- s->
C 3
3 >5
c
sJ Q2.
cC
3
0
0
s pq
S c.'
CQ
3
CQ
3^
i22
3*^
]
.v C
C
C
C
'O ^
3
Un
3
S.H
3
u.
u
S3 3
a, e-
c4
£Q
O
i§ «;
s ®
. e
.£■ is
U 0-
c/5 C/3 c/5
ea 02
-2" ^
=3 3
eu cu
o o
?c3
00 02
CiC
ca 00
3 3
3 3
CL Pu
O O
j3 ?3
cci CsC
20 02
o o
/3 /3
C/D GO
c/3 c/5 C/)
ua.)a)DD(D<i>a>
O
r2 .-S
L -
U 3 3
M u u
3 O
r£ .-S
3 3
u u
^ —
^ r ^
^ U
Ox) Dm Om Cl Oh Oh
o o
j3 /3
O O
/3 ?3
•U D O D D
r2 r£
5 5
:£ :2
5 5
rS rS
5 5
DC
ca
- C4
.2 02
3 .
3 O
a. -3
o 3
(3 Oh
^ O ^
^ j3 ^
.S o' 3''
tr: ^ c
a.2 £
5 ^ 3
0:; 3 0.
_ u -
3 3
3; O .£3
iS -a -o:
o 3 i2
2 J3 3
U
c4 oi
oa 02
^ k: oi
m m oa
Uh
3 3
^ X)
^33
CL Oh
3 O O
u- »3 <3
3 GO (X
0« . .
3
X 3
■X >
(U (D
u. Ui (U
3 3 3
U CJ U .S ^
s. 5- S-
.s.
p. h
L L) S.J
O
5 -a -a -a -a
q Q Q Q Q
s
Q,
sj So i>5 *>5 =>5
O O O
:3
2
5
>5
,0
•I ^
s: s*-
^ C)
L L L L
^
A
Co Co
1^D(DQ.)DiDa.)<liD(L><Uil>iU(L/<l.><UDDO(D(Ui3J
3333333333333333333333
CLD^Cl,a.D-a,Cl.Q.CLCLCLCLCua-a<
(Uaja.>Cl><L)aj(D(L>D<D<U<U(U^^
Gccccccccccccccncccccc
0000000000000000000000
0000000000000000000000
r-* 00 o^ o^
G2 GO *
Z tjcn Z *
Leiobunidae Leiobimum townsendi Austin, Texas, US Sep (Su) 1 157 167 0.48
Leiobunidae Leiohwnmi sp. NL - - 349 304 0.53
Sclerosomatidae Prionostcmma .sp. 2 Refugio Bartola, Rio San Juan, NI Feb (W dry) 10 250 111 0.47
Sclerosomatidae Prionostemnui sp. I Refugio Bartola, Rio San Juan, NI Feb (W dry) 7 33 139 0.19
266
THE JOURNAL OF ARACHNOLOGY
tested with single-sex group translocations. If females are
more strongly attracted to female scent than are males, sites
where only females are released should attract more female
than male recruits on subsequent days.
In contrast to the sharp habitat distinction that we found
at Refugio Bartola, at La Selva Biological Station both
Prkmostemma species are typically found on the vertical
surfaces of medium to large tree trunks or buttresses and
nearby shrubs (Proud et al. 2012). Harvestman roosting
behavior can change seasonally (Holmberg et al. 1984; Chelini
et al. 2011), so it is important to consider whether the reported
differences between sites could be an artifact of the timing of
the research conducted at the two sites. At Refugio Bartola,
Prionosteninia sp. 2 has been studied between the months of
January and May, which includes the dry season (February-
April) and parts of the wet season. Spiny palms are used as
roosting sites throughout this period, and the observation that
the locations of the communal roosts are stable from one year
to the next (Teng et al. 2012; Grether et al. 2014), combined
with what is known about the mechanism of roost formation
(Donaldson & Grether 2007), indicates that spiny palms are
used as aggregation sites year-round at this site. That is, if the
communal roosts were abandoned for part of the year, they
would presumably form in different spiny palms in different
years, because individuals are not roost-site faithful and
suitable spiny palms are not limiting (Donaldson & Grether
2007; Grether & Donaldson 2007; Teng et al. 2012). At La
Selva Biological Station, harvestmen have been studied in
both the dry and wet seasons, and one of us has searched for
Sclerosomatidae aggregations in spiny palms and the but-
tresses of large trees during both seasons and encountered
none (V.R.T., pers. obs.). Thus, we are confident that
Prionosteninia roosting behavior differs between the sites.
How might population differences in roosting patterns
arise? We first consider a sort of null model of the roost
formation process. If individual harvestmen had no micro-
habitat preferences and roost formation was based solely on
conspecific attraction (including scent-mark detection), then
the locations of roosting sites would be expected to drift
randomly over time through chance colonization events.
Under this null model, we would expect communal roosts to
form repeatedly at the same locations but not exclusively in a
specific microhabitat. Aggregations would be expected to
persist longer at sites where the harvestmen survived at higher
rates, however, and this could lead to a pattern in which, at
any given time, most aggregations formed in microhabitats
that offered protection from predators, desiccation, etc. Thus,
geographic variation in roosting patterns could arise simply
through chance events and variation in the factors that
intluence survival rates in different microhabitats (predator
species, climate, etc.). A more realistic model would have
individuals searching for roosting aggregations in the micro-
habitats where they are most likely to form, either because of
associative learning or because microhabitat preferences
evolve to track roosting patterns, or some combination of
these mechanisms. Nevertheless, the sort of cultural drift
envisioned in the null model seems likely to play some role in
population differentiation.
One way to investigate the relative importance of habitat
preferences versus conspecific attraction would be to seed new
Prionosteninia aggregations in different kinds of vegetation,
using the group translocation method (Teng et al. 2012), and
follow their fate. At Refugio Bartola, Prionostemma sp. 2
aggregations occasionally form on non-spiny understory
plants (e.g., Rubiaceae: Psychotria) but not in the same places
in different years (G.F.G., pers. obs.). The aggregations in
spiny palms may persist longer than those in other types of
vegetation simply because palm spines offer protection from
predators, such as anoline lizards (Grether & Donaldson
2007). There is also evidence, however, that these harvestmen
prefer spiny palms per se. When spines were experimentally
removed from established roosting sites, the aggregations
shifted rapidly over to previously unused spiny palms, if any
were nearby (Donaldson & Grether 2007). Thus, it would be
interesting to examine whether a tradition of roosting in spiny
palms, once introduced, would spread through the Prionos-
teinma sp. 2 population at La Selva Biological Station.
ACKNOWLEDGMENTS
We thank D.N. Proud and two anonymous reviewers for
helpful comments on previous drafts of the manuscript. This
study was carried out through the Field Biology Quarter
program, with financial support from the Office of Instruc-
tional Development and the Department of Ecology and
Evolutionary Biology, at the University of California Los
Angeles. AL was supported by Epperson and Holmes O.
Miller scholarships. We thank R. Chock, J.P. Drury and D.M.
Shier for help in the field and the owners and staff of Refugio
Bartola for service and hospitality. Voucher specimens will be
deposited in the natural history collection at the American
Museum of Natural History in New York.
LITERATURE CITED
Alcock, J. 1998. Sleeping aggregations of the bee Idiomelissodes
diiplocincta (Cockerel!) (Hynienoptera: Anthophorini) and their
possible function. Journal of the Kansas Entomological Society
71:74-84.
Altmann, J. 1974. Observational study of behavior: sampling methods.
Behaviour 49:227-267.
Beauchamp, G. 1999. The evolution of communal roosting in birds:
origin and secondary losses. Behavioral Ecology 10:675-687.
Bijleveld, A. I., M. Egas, J.A. van Gils & T. Piersma. 2010. Beyond the
information centre hypothesis: communal roosting for information
on food, predators, travel companions and mates? Oikos 119:
277-285.
Blanco, G. & J. Telia. 1999. Temporal, spatial and social segregation of
red-billed choughs between two types of communal roost: a role for
mating and territory acquisition. Animal Behaviour 57:1219-1227.
Chelini, M.C., R.H. Willemart & P. Gnaspini. 201 1. Caves as a winter
refuge by a Neotropical harvestman ( Arachnida, Opiliones). Journal
of Insect Behavior 24:393-398.
Chelini, M.C., R.H. Willemart & P. Gnaspini. 2012. Gregarious
behavior of two species of Neotropical harvestmen (Arachnida:
Opiliones: Gonyleptidae). Journal of Arachnology 40:256-258.
Cockerill, J.J. 1988. Notes on aggregations of Leiohummi (Opiliones)
in the southern U.S.A. Journal of Arachnology 16:123-126.
Coddington, J.A., M. Horner & E.A. Soderstrom. 1990. Mass
aggregations in tropical harvestmen (Opiliones Gagrellidae Prio-
iwsteinnia sp.). Revue Arachnologique 8:213-219.
Cody, M. 2000. Antbird guilds in the lowland Caribbean rainforest of
southeast Nicaragua. Condor 102:784-794.
Devries, P.J., J. Schull & N. Greig. 1987. Synchronous nocturnal
activity and gregarious roosting in the neotropical skipper butterlly
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
267
Celaenorrhinus fritzgaertneri (Lepidoptera: Hesperiidae). Zoologi-
cal Journal of the Linnean Society 89:89-103.
Donaldson, Z.R. & G.F. Grether. 2007. Tradition without social
learning: scent-mark-based communal roost formation in a
Neotropical harvestman (Prionostemmci sp.). Behavioral Ecology
and Sociobiology 61:801-809.
dos Santos, G.C., J.A. Hogan & R.H. Willemart. 2013. Associative
learning in a harvestman (Arachnida, Opiliones). Behavioural
Processes 100:64-66.
Edgar, A.L. 1971. Studies on the biology and ecology of Michigan
(Opiliones). Miscellaneous Publications, Museum of Zoology,
University of Michigan 144:1-64.
Eiserer, L. 1984. Communal roosting in birds. Bird Behavior 5:61-80.
Eisner, T. 2004. Chemical defense of an opilionid (Accmthopachylus
aculeatus). Journal of Experimental Biology 207:1313-1321.
Gnaspini, P. 2007. Development. Pp. 455^72. In Harvestmen: The
Biology of Opiliones. (R. Pinto-da-Rocha, G. Machado & G.
Giribet, eds.). Harvard University Press, Cambridge.
Grether, G.F. & Z.R. Donaldson. 2007. Communal roost site selection in
a Neotropical harvestman: habitat limitation vs. tradition. Ethology
113:290-300.
Grether, G.F., A. Levi, C. Antaky & D.M. Shier. 2014. Communal
roosting sites are potential ecological traps: experimental evidence
in a Neotropical harvestman. Behavioral Ecology and Sociobiol-
ogy 68:1629-1638. DOT 10.1007/s00265-014-1771-2.
Holm, S. 1979. A simple sequentially rejective multiple test procedure.
Scandinavian Journal of Statistics 6:65-70.
Holmberg, R.G., N.P.D. Angerilli & L.J. Lacasse. 1984. Overwinter-
ing aggregations of Leiohiimuu paessleri in caves and mines
(Arachnida, Opiliones). Journal of Arachnology 12:195-204.
Kerth, G. & K. Reckardt. 2003. Information transfer about roosts in
female Bechstein’s bats: an experimental field study. Proceedings of
the Royal Society B: Biological Sciences 270:511-515.
Machado, G. 2002. Maternal care, defensive behavior & sociality in
neotropical Goniosoma harvestmen (Arachnida, Opiliones). In-
sectes Sociaux 49:388-393.
Machado, G. & R. Macias-Ordonez. 2007. Social behavior.
Pp. 400-413. In Harvestmen: The Biology of Opiliones. (R. Pinto-
da-Rocha, G. Machado & G. Giribet, eds.). Harvard University
Press, Cambridge.
Machado, G. & C.H.F. Vasconcelos. 1998. Multi-species aggregations
in Neotropical harvestmen (Opiliones, Gonyleptidae). Journal of
Arachnology 26:389-391.
Machado, G., V. Bonato & P.S. Oliveira. 2002. Alarm communica-
tion: a new function for the scent-gland secretion in harvestmen
(Arachnida: Opiliones). Die Naturwissenschaften 89:357-360.
Machado, G., R.L.G. Raimundo & P.S. Oliveira. 2000. Daily activity
schedule, gregariousness & defensive behaviour in the Neotropical
harvestman Goniosoma longpipes (Opiliones: Gonyleptidae). Jour-
nal of Natural History 34:587-596.
Mallet, J. 1986. Gregarious roosting and home range in Heliconiiis
butterflies. National Geographic Society Research 2:198-215.
Mestre, L.A.M. & R. Pinto-da-Rocha. 2004. Population dynamics
of an isolated population of the harvestman Ilhaia cuspidata
(Opiliones, Gonyleptidae), in Araucaria Forest (Curitiba, Parana,
Brazil). Journal of Arachnology 32:208-220.
Pereira, W., A. Elpino-Campos, K. Del-Claro & G. Machado. 2004.
Behavioral repertory of the Neotropical harvestman Ilhaia cuspidata
(Opiliones, Gonyleptidae). Journal of Arachnology 32:22-30.
Proud, D.N., B.E. Felgenhauer, V.R. Townsend, D.O. Osula, W.O.
Gilmore & Z.L. Napier et al. (2012). Diversity and habitat use of
Neotropical harvestmen (Arachnida: Opiliones) in a Costa Rican
rainforest. ISRN Zoology 2012:1-16.
Rocha, D.F.O., F.C. Wouters, G. Machado & A.J. Marsaioli. 2013.
First biosynthetic pathway of l-hepten-3-one in Iporangaia
pustidosa (Opiliones). Scientific Reports 3:3156.
Switzer, P.V. cS: G.F. Grether. 1999. Characterictics and possible
functions of traditional night roosting aggregations in rubyspot
damselfiies. Behaviour 137:401-416.
Teng, B., S. Dao, Z.R. Donaldson & G.F. Grether. 2012. New
communal roosting tradition established through experimental
translocation in a Neotropical harvestman. Animal Behaviour
84:1183-1190.
Townsend, V.R., K.A. Mulholland, J.O. Bradford, D.N. Proud &
K.M. Parent. 2006. Seasonal variation in parasitism by Lcptus
mites (Acari, Erythraeidae) upon the harvestman, Leiohimutn
fornwswu (Opiliones, Sclerosomatidae). Journal of Arachnology
'34:492-494.
Townsend, V.R., D.N. Proud, M.K. Moore, J.A. Tibbetts, J.A. Burns
& R.K. Hunter et al. (2008). Parasitic and phoretic mites associated
with Neotropical harvestmen from Trinidad, West Indies. Annals of
the Entomological Society of America 101:1026-1032.
Tsurusaki, N. 1986. Parthenogenesis and geographic variation of
sex ratio in two species of Leiohunwn (Arachnida, Opiliones).
Zoological Science 3:517-532.
Tsurusaki, N. 2003. Phenology and biology of harvestmen with some
taxonomical in and near Sapporo, Hokkaido, Japan, with some
taxonomical notes on Nelinia suzukii n. sp. and allies (Arachnida:
Opiliones). Acta Arachnologica 52:5-24.
Vulinec, K. 1990. Collective security: aggregation by insects as a
defense. Pp. 251-288. In Insect Defenses: Adaptive Mechanisms
and Strategies of Predators and Prey. (D.L. Evans & J.O. Schmidt,
eds.). State University of New York Press, Albany.
Wade, R.R., E.M. Loaiza-Phillips, V.R. Townsend & D.N. Proud.
2011. Activity patterns of two species of Neotropical harvestmen
(Arachnida: Opiliones) from Costa Rica. Annals of the Entomo-
logical Society of America 104:1360-1366.
Wijnhoven, H., A.L. Schonhofer & J. Martens. 2007. An unidentified
harvestman Leiohunum sp. alarmingly invading Europe (Arachni-
da: Opiliones). Arachnologische Mitteilungen 34:27-38.
Wilkinson, G.S. 1984. Reciprocal food sharing in the vampire bat.
Nature 308:181-184.
Willemart, R. & P. Gnaspini. 2004. Spatial distribution, mobility,
gregariousness & defensive behaviour in a Brazilian cave harvest-
man Goniosoma alhiscriptum (Arachnida, Opiliones, Gonylepti-
dae). Animal Biology 54:221-235.
Willemart, R.H. & E.A. Hebets. 2011. Sexual differences in the
behavior of the harvestman Leiohunum vittatum (Opiliones,
Sclerosomatidae) towards conspecific cues. Journal of Insect
Behavior 25:12-23.
Manuscript received 25 April 2014, revised 2 September 2014.
2014. The Journal of Arachnology 42:268-276
From spiderling to senescence: ontogeny of color in the jumping spider, Hahvonattus pyrrithrix
Lisa A. Taylor' --^, David L. Clark^ and Kevin J. McGraw^: 'Florida Museum of Natural History, University of Florida,
Gainesville, FL 3261 1 USA. E-mail: LAT12@cornell.edu; -Department of Entomology and Nematology, 1881 Natural
Area Drive, Steinmetz Hall, University of Florida, Gainesville, FL 3261 1 USA; ^School of Life Sciences, Arizona State
University, Tempe, AZ 85287 USA; ''Department of Biology, Alma College, Alma, MI 48801 USA
Abstract. The diverse colors of animals serve a variety of purposes, from acquiring mates to avoiding predators. Often,
color patterns are not static throughout life, but change drastically during development, maturity, and senescence. While
recent work has focused on the signaling value of vibrant colors in jumping spiders (Salticidae), we know very little about
how colors change as spiders age; such information can provide a context for understanding the functions of and
constraints on colorful traits. Focusing on Hahronaftiis pyrrithrix Chamberlin 1924, our goals were to examine (1) the
microscopic morphology of the colored body regions that males display to females during courtship (i.e., males’ red faces,
green legs, and white pedipalps), (2) how the colors of these regions as well as dorsal color patterns change during
development prior to sexual maturity, and (3) how male condition-dependent red facial and green leg coloration changes as
males age beyond sexual maturity. Although the bright white pedipalps and green legs of males appeared only upon sexual
maturity, the sexes began to differentiate in facial coloration and dorsal patterning, with males developing red faces and
conspicuous black and white dorsal patterning as young juveniles (ca. 2.5 mm in body length, or ca. 45% of their total
mature adult body size). Even after maturity, color was not static; a male’s green legs (but not red face) faded with age.
Results are discussed in the context of potential functions of and constraints on color in salticids, and how they may change
throughout an individual’s lifetime.
Keywords: Juvenile coloration, Salticidae, sexual dichromatisni, sexual dimorphism, sexual selection
Animal colors and patterns can serve a variety of functions.
During courtship, they can aid in species recognition or
convey information about the quality of an individual as a
mate (see reviews in Andersson 1994; Hill & McGraw 2006).
They also frequently keep animals hidden (i.e., camouflage) or
protected (i.e., aposematism, mimicry) from predators (see
reviews in Cott 1940; Ruxton et al. 2004). In many animals,
color patterns are not static throughout life, but change
dramatically during development, maturity, and senescence, as
well as seasonally (Booth 1990). When color patterns differ
between the sexes, examination of ontogenetic color change is
particularly interesting because the timing and extent of sexual
color differentiation can provide clues to the costs and benefits
of different color patterns and their functions and constraints
across contexts throughout life.
Color change from development to adulthood is typically
thought to represent shifts in selection pressures as individuals
change in size, mobility, vulnerability to predation, habitat use,
or reproductive status (Booth 1990). In animals where bright
male colors have evolved via sexual selection, sex-specific color
patterns often appear suddenly upon sexual maturity, presum-
ably because they are costly and unnecessary for juveniles
(Andersson 1994). When sexually selected colors appear before
sexual maturity, they are particularly interesting because they
may hint at previously overlooked functional roles (e.g., Kilner
2006; Kapun et al. 2011). When the sexes differ in color due to
different ecological selection pressures (e.g., Slatkin 1984), the
timing of color pattern divergence can help us understand
shifting selection pressures. For example, in the lizard Erettuas
htgiihris, adults and older juveniles are tan and cryptic, whereas
young juveniles have highly conspicuous markings, mimicking
noxious oogpister beetles (Huey & Pianka 1977); in this system,
subtle and changing functional roles of color would be missed
by limiting study to adult stages.
Adult organisms can also change color as they age beyond
sexual maturity (Booth 1990). In many birds, colors used to
attract mates do not appear immediately upon sexual
maturity, but are delayed until after the first breeding season
(reviewed in Hawkins et al. 2012). Animals may also decline
(more subtly) in color with senescence; colorful pigments or
structures contained within dead tissue (e.g., feathers, scales)
can fade with age as a product of abrasion, soiling, or
photobleaching (Ornborg et al. 2002; McGraw & Hill 2004;
Delhey et al. 2006; Kemp 2006). If maintaining colors is costly,
age-based fading can have important consequences for
signaling, with the ability to maintain bright colors (i.e., the
ability to resist tissue/pigment damage) acting as an indicator
of quality (e.g., Delhey et al. 2006). Alternatively, color fading
may provide direct information about an individual’s age
(Manning 1985). Such information could help individuals
identify more mature, viable mates (reviewed in Kokko &
Lindstrom 1996). Alternatively, if older individuals are more
likely to carry disease or parasite infection (e.g., Tarling &
Cuzin-Roudy 2008) or if they are more likely to accumulate
deleterious mutations in their germ-line (Beck & Promislow
2007), age-based color variation might enable individuals to
select younger mates. A deeper understanding of how, and
ultimately, why colors change with age will enable us to
generate informed hypotheses about their potential signal
content and evolution.
Jumping spiders (Salticidae) are an excellent group in which
to examine ontogenetic color change from development
through senescence. In many species, adult males are more
colorful than females and display these colors to females
during courtship or to other males during competitive
interactions (e.g., Peckham & Peckham 1889, 1890; Lim &
Li 2004; Girard et al. 2011). In addition, sexual dichromatism
in dorsal color that is not displayed during courtship may
268
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
269
reOect different predator-avoidance strategies of males and
females (LAT, iinpub. data). To date, only three jumping
spider species have had their colors quantified using modern
color measurement techniques (i.e., spectrophotometry) (Cos-
mophasis unihratica Simon 1903 (Lim & Li 2006), Phintella
vittata (C.L. Koch 1846) (Li et al. 2008a), and Habwuattiis
pyrrithrix Chamberlin 1924 (Taylor et al. 201 1)), and in only
one study were juvenile colors measured (Lim & Li 2006). To
our knowledge, no study has documented age-based changes
in salticid colors as they develop from spiderlings through
sexual maturity. Because species descriptions and dichoto-
mous keys typically include details on only adults, with
anatomy of mature genitalia required for proper identification
(e.g., Ubick et al. 2005), the salticid literature includes few,
even qualitative, descriptions of juvenile color patterns (but
see Nelson 2010 for an exception).
The genus Hahronattus F.O.P. Cambridge 1901, containing
approximately 100 species, is one of the most highly
ornamented groups; males are typically elaborately colored
whereas females are cryptic (Griswold 1987; Maddison &
Hedin 2003). Furthermore, patterns of juvenile coloration also
vary across the genus (LAT, pers. obs.). For example, in H.
hirsutus (Peckham & Peckham 1888) juveniles of both sexes
are indistinguishable from one another to the human eye and
resemble cryptic adult females until sexual maturity (LAT,
pers. obs.). In H. hallani (Richman 1973) juveniles of both
sexes are indistinguishable from one another but have striking
dorsal color patterns unlike either adult males or females
(LAT, pers. obs.). In H. pyrrithrix, juvemle males and females
exhibit color patterns similar to those of sexually mature
adults; males have red faces and striped dorsal patterns,
whereas females are drab and cryptic throughout their life
(LAT, pers. obs). This diversity in ontogenetic color change
suggests that the costs, benefits, and functions of juvenile
colors might be just as interesting as those of adults.
Additionally, there is evidence that, after reaching maturity,
adult male ornamental colors in H. pyrrithrix continue to
undergo additional age-related changes, which could have
important implications for sexual signaling (Taylor et al.
2011).
In this study, we focused on Hahronattus pyrrithrix', males
of this species are adorned with red faces, green front legs, and
white pedipalps that they display to females during courtship.
Our goals were to ( 1 ) examine the microscopic morphology of
the elaborately colored body regions that males display (i.e.,
red faces, green legs, and white pedipalps), (2) examine how
the colors of these regions as well as dorsal color patterns
change during development leading up to sexual maturity, and
(3) examine how male condition-dependent red facial and
green leg coloration changes as males age beyond sexual
maturity. The red facial and white pedipalp colors of H.
pyrrithrix are contained within modified setae, or scales (e.g..
Hill 1979), while the green leg coloration is present on the
surface of the cuticle of the femur (e.g., Parker & Hegedus
2003; Ingram et al. 2011), which is further adorned with white
scales (LAT, pers. obs.). Recent work on H. pyrrithrix
suggests that adult male facial and leg colors are correlated
with body condition in the field (Taylor et al. 2011). The red
(but not green) coloration is variable among males of the same
age and is positively correlated with the quality of a male’s diet
(Taylor et al. 2011), and the presence of red coloration
improves courtship success in certain contexts (Taylor &
McGraw 2013); however, we know nothing about the role of
red facial coloration in juvenile males. We have hypothesized
elsewhere that the conspicuous dorsal coloration in sexually
mature adult males (combined with characteristic leg-waving
behavior and high movement rales associated with mate
searching) provides protection from predators through imper-
fect mimicry of bees and/or wasps (see Taylor 2012), yet we
know nothing about the potential factors that might shape
color differences in sexually inactive juveniles. Even after
maturity, male colors do not appear to be static (Taylor et al.
201 1). Throughout the mating season, the scales that produce
the colors may undergo natural wear and degradation, which
may result in predictable, post-maturity, age-related deterio-
ration of color (e.g., Kemp 2006; Kemp & Macedonia 2006);
this may allow females to use color to assess a male’s age
during courtship (e.g.. Manning 1985).
To our knowledge, this will be the first study to quantify
ontogenetic color changes throughout development in any of
the more than 5000 species (Platnick 2013) of jumping spiders.
Standard portable spectrophotometers used in animal color-
ation studies (reviewed in Andersson & Prager 2006) typically
have a minimum reading area of 1 mm (e.g., Lim & Li 2006;
Moreno et al. 2006; Galvan & Moller 2009); thus, precise
quantification of color can only be done on relatively large
body regions (>1 mm). Thus, using standard equipment
makes the study of minute patches of color on small species of
spiders challenging and makes the detailed study of color on
particular body regions of juvenile salticids (e.g., faces, legs,
pedipalps) impossible. Here we use a custom-designed
microspectrophotometer (see Methods and also Taylor et al.
2011), allowing us to carefully measure minute patches of
color on juveniles and compare colors with those same precise
areas on adult spiders.
METHODS
Study %^tQ.iQ%. -Hahronattiis pyrrithrix is found throughout
southern California and Arizona, USA, south to Sinaloa,
Mexico (Griswold 1987). In Phoenix, Arizona, they are quite
common and found at high densities in riparian areas, grassy
backyards, and agricultural fields (LAT, pers. obs.). Geo-
graphic variation in coloration is common within the genus
Hahronattus (see Griswold 1987) and thus some subtleties of
color pattern described in the present study for Phoenix, AZ
animals may vary across the species range. Voucher specimens
from our study population have been deposited in the Florida
State Collection of Arthropods, Gainesville, FL, U.S.A.
Additional details on the biology and courtship display
behavior of H. pyrrithrix are provided elsewhere (Taylor et
al. 2011; Taylor & McGraw 2013). Most temperate spiders live
only one year in the field (see Foelix 201 1); to our knowledge,
nothing is known about how long H. pyrrithrix, in particular,
live under natural conditions.
Scale morphology of adult male ornaments (Study 1). — Using
five sexually mature adult specimens, we imaged the color
patches on the males’ red face, green front legs, and white
pedipalps that they display to females, using a Leica-Cam-
bridge Stereoscan 360 field emission scanning electron
microscope (SEM) (Leica Microsystems, Wetzlar, Germany)
270
THE JOURNAL OF ARACHNOLOGY
at an acceleration voltage of 2 kV. Prior to imaging, we
allowed frozen specimens to air-dry overnight and then
mounted the carapace, legs, and pedipalps onto standard
SEM stubs using conductive graphite paint.
Ontogenetic color change in juveniles (Study 2). — To
examine how male and female coloration changes during
juvenile development in the field, we collected spiders {n —
135) from a range of developmental stages (i.e., size classes)
between May and October 2008 from a single, dense popula-
tion within an agricultural area in Queen Creek, Arizona,
USA (Maricopa County, 33.224744° N, 1 1 1.592825° W). This
population was chosen because, in contrast with other sites
where multiple species are abundant and interact (LAT, unpub.
data), the only species of Hahronattus that we have ever seen at
this site in five years is H. pyrrithrix. This allowed us to be
confident that all spiderlings and juveniles included in the
present study were H. pyrrithrix. Specifically, we collected
spiderlings (before they are able to be sexed, ca. 1. 5-2.0 mm in
length, n - 15), small juveniles (ca. 2.5 mm, // = 15 males, u =
15 females), large juveniles (ca. 3 mm, /? = 15 males, /; = 15
females), subadults (ca. 4-6 mm, /? = 15 males, /? = 15 females)
and sexually mature adults (ca. 5-7 mm, n = 15 males, /? = 15
females). Immediately after collection, we froze spiders
( — 80° C) for later color analysis.
Post-maturity age-related changes in condition-dependent
male ornaments (Study 3). — To examine how adult male color
changes with age post-maturity, we collected 12 gravid adult
females in July and August 2008 from the same population
described above, brought them back to the lab and allowed
them to lay eggs. Spiderlings were housed together until they
were large enough to be sexed (ca. 2.5 mm in length), at which
point the first three males from each female’s egg sac were
removed, housed separately in clear plastic containers (6x6
X 13 cm), and fed a constant diet of small crickets (Acheta
domesticus) three times per week. Spiders (n — 36; three from
each of 12 egg sacs) were checked daily to determine if they
had molted; within each clutch, as males reached their final
molt to maturity, they were randomly assigned to one of three
different age groups (0, 60, and 120 days post-maturity). These
age ranges were chosen because they likely represent the
difference in ages of males in the field during the most active
part of the mating season at this site (approximately May-
August; LAT, pers. obs.). When males reached the appropri-
ate randomly assigned age (0, 60, or 120 days post-maturity),
we euthanized them and placed them in the freezer ( — 80° C)
for later color analysis.
Color measurement and analysis. — Body colors were quan-
tified following methods described in Taylor et al. (2011).
Briefiy, we used a refiectance spectrophotometer (USB2000,
Ocean Optics, Dunedin, FL, USA) coupled to a modified
Leica DMLB2 fluorescence light microscope with a 40x
quartz objective lens (Leica Microsystems, Wetzlar, Germany)
and illuminated with a full-spectrum Leica 75 W xenon arc
lamp (Leica Microsystems, Wetzlar, Germany). This setup
allowed us to quantify the minute color patches of all size
classes of these spiders that are too small to measure
accurately with standard spectrophotometry equipment.
Unfortunately, the optics of the microscope cut out a portion
of the UV spectrum, so this instrument only provides spectral
data from 375-700 nm. In some jumping spider species, UV
reflectance appears to be important in communication (Lim et
al. 2007, 2008; Li et al. 2008b), and thus we must use caution
when excluding UV wavelengths from our analyses. However,
in a previous study (Taylor et al. 2011), we confirmed that,
though reflectance does extend into the UV for the green legs
and white pedipalps of H. pyrrithrix, there are no UV peaks in
either region, so the benefit of using an instrument that allows
precise and repeatable measures on minute color patches of
these tiny spiders far outweighs the disadvantage of excluding
UV.
For Study 2, where we were interested in color changes of
the faces, front legs, and pedipalps of males and females that
occurred during juvenile development through maturity, we
took the average of two reflectance measures of each of these
three body regions. The colored areas that we measured on
each specimen were 0.25 mm in diameter. For facial
coloration, both measurements were taken from the same
region of the face (just below the anterior median eyes). For
leg coloration, one measurement was taken from the ventral
side of each (right and left) femur. For pedipalp coloration,
one measurement was taken from the distal segment of each
(right and left) pedipalp. From these spectral data, we
calculated the single color variable that captured the most
sex- and age-related variation for each body region scored.
Specifically, because face color among the different sex/age
classes varied from white to red, the metric that captured most
of this variation was ‘red chroma’ (i.e., the proportion of total ■
reflectance in the red region of the spectrum, between 600 and
700 nm). Similarly, because the front legs varied from white to
green, the metric that captured most of this variation was
‘green chroma’ (the proportion of total reflectance between
450 and 550 nm). Finally, because the pedipalps varied in
coloration from gray to bright white, brightness (total
reflectance over the entire spectrum) was the metric that
captured most of this variation. For a detailed discussion of !
the rationale behind selecting relevant color variables,
including those used here, see Montgomerie (2006). In
addition, we qualitatively characterized the dorsal color
pattern of individuals as either (1) tan and cryptic in ’
coloration, similar to the dorsal coloration of adult females,
or (2) consisting of black and white stripes and chevrons
characteristic of adult males; all individuals examined fit
clearly into one of these two categories (see Results). Because
these categorizations were based on pattern rather than
reflectance properties of the colors, we did not quantify dorsal
coloration spectrophotometrically.
For Study 3, where we were interested in more subtle, age-
based fading of display colors in adult males, we limited our
analysis to the coloration of the red face and green legs, j
because previous studies showed that these two color patches '
were correlated with body condition in the field, presenting the
possibility that such condition-dependence could be explained
in part by the fading of colors as males age (Taylor et al.
201 1). We took the average of two reflectance measures from
each region and used these spectral data to calculate three
color variables that were previously found to be correlated
with body condition in the field: ( 1 ) the hue of the red face (the
wavelength corresponding to the inflection point of the red ,
curve), (2) the red chroma of the face (the proportion of total
reflectance between 600 and 700 nm), and (3) the brightness ,
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
271
Figure 1. — Morphology of the colored body regions of adult male Habronattus pyrrithrix. a-b. Red scales on the face showing ridged
protrusions; c-d. White spatulate scales ornamenting the green front leg (femur); e-f. Flat white pedipalp scales.
(mean reflectance) of the green front legs, following the
methods described in Taylor et al. (201 1). We also determined
the relative size of the male’s red facial patch; because larger
males had larger red faces, we used the residuals of a
regression of patch area on carapace width, which provides
a ‘relative patch size index’ that is uncorrelated with body size
and has previously been found to be correlated with body
condition in the field (Taylor et al. 2011). Three males died
over the course of the study for unknown reasons and were
thus excluded from our analyses.
Statistical analysis. — For Study 2, we used analyses of
variance (ANOVA) to examine effects of developmental stage
(i.e., size class), sex, and their interaction on face color
(red chroma), front leg color (green chroma), and pedipalp
color (mean brightness). Data did not meet normality and
equal-variance assumptions and thus were rank-transformed
Ill
THE JOURNAL OF ARACHNOLOGY
Table I . — Results of ANOVA examining the effect of sex, age (i.e.,
size class), and their interaction on color metrics associated with the
face, legs, and pedipalps during development in H. /nTn7/;)7'.v jumping
spiders. Df = degrees of freedom.
Red chroma of face
Df
F
P
sex
1,140
304.96
<0.001
age
4,140
6.30
<0.001
sex X age
4,140
20.27
<0.001
Green chroma of legs
Df
F
p
sex
1,140
0.28
0.60
age
4,140
9.37
<0.001
sex X age
4,140
5.10
<0.001
Brightness of pedipalps
Df
F
p
sex
1,140
1.43
0.23
age
4,140
41.54
<0.001
sex X age
4,140
3.33
0.01
(Conover & Iman 1981) prior to analysis. For Study 3, we
used ANOVA to examine the effects of age on the hue, red
chroma, and the relative size of a male’s red face and on the
brightness of his green legs. Because we used three males from
each clutch (one assigned to each age category), we included
the clutch (i.e., mother’s identity) as a random factor in the
model. Following ANOVA, we compared the colors among
age classes using Tukey-Kramer pairwise comparisons with an
alpha level of 0.05. All data from Study 3 met the assumptions
of parametric statistics. All statistical analyses were conducted
using SAS 9.2 (SAS Institute, Cary, NC, USA).
RESULTS
SEM analyses revealed varied scale structure on the three
different colorful body regions of males (Fig. 1). On the red
face, we found ridged protrusions covering the surface of each
scale (Figs, la, b). The green legs were ornamented with long
spatulate scales, the flattened ends of which were covered with
fine ridges (Figs. Ic, d). The white scales on the pedipalps were
similar in size and shape to the red facial scales, but were
relatively smooth by comparison (Figs, le, f).
In Study 2, we found a significant effect of the age X sex
interaction on all three color metrics examined (Table 1),
indicating that colors developed differently between the sexes.
Although spiderlings of both sexes had sparse red scales
around their anterior median eyes (Fig. 2a), development of
red coloration on the face was apparent in small juvenile males
and increased into adulthood, whereas small juvenile females
developed white facial scales (Figs. 2, 3a). Similarly, the
conspicuous dorsal color pattern of males was also fully
developed in small juveniles (ca. 2.5 mm), whereas spiderlings
of both sexes and juvenile females had a cryptic, tan dorsal
color pattern similar to adult females (Fig. 4). In contrast, the
green coloration of the legs and the bright white pedipalp
coloration typical of adult males showed a sudden onset at
sexual maturity (Fig. 3b, c).
In Study 3, the green leg coloration of adult males was
brighter (lighter) with increasing age (F2.21 = 4.17, T* = 0.03;
Fig. 5d), but we found no effect of age on any aspect of red
facial coloration (hue: F2,2i = 0.37, P = 0.69; red chroma:
Figure 2. — Ontogenetic changes in coloration in males and females 'j
as spiders develop from spiderlings through sexual maturity, a. ;
Spiderling stage (where sexes are indistinguishable); b. Small juvenile
male; c. Small juvenile female; d. Large juvenile male; e. Large
juvenile female; f. Subadult male; g. Subadult female; h. Sexually
mature adult male; i. Sexually mature adult female. Scale bars ;
represent 0.5 mm.
^2,21 = 0.53, P = 0.60; size of red facial patch: F2.21 = 1-97,
P = 0.17; Figs. 5a-c).
DISCUSSION
Here we document the scale morphology associated with the
three colored body regions in male Hahronattus pyrrithrix that
are prominently displayed to females during courtship. We
also show how the colors of these three regions (i.e., red face,
green front legs, and bright white pedipalps) develop as
individuals grow from spiderlings through sexual maturity.
Finally, given that the colors of two of these body regions (i.e.,
red faces and green front legs) were previously found to be
correlated with body condition in the field (Taylor et al. 2011),
we examined the possibility of age-related fading of these traits
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
273
males
females
spiderlings (cannot be reliably sexed)
Figure 3. — Ontogenetic changes in coloration in males and females
as spiders develop from spiderlings through sexual maturity (mean ±
SEM). a. Facial coloration; b. Front leg coloration; c. Pedipaip
coloration.
in adult males and show that green leg coloration, but not red
facial coloration, fades (i.e., becomes lighter) with age.
In examining color development, we found that both the
bright white pedipalps and green leg coloration of males
Figure 4. — Sexual dichromatism in dorsal coloration in juvenile
and adult male and female H. pyrrithrix. a. Juvenile male; b. Juvenile
female; c. Adult male; d. Adult female.
appeared only at sexual maturity. This is typical of many
animal ornaments used in mating or aggressive competitions
over access to mates; moreover, because such colors typically
incur costs, it is not surprising that these ornaments are not
expressed in juvenile stages (Andersson 1994). In contrast,
males and females began to differentiate in red facial
coloration and dorsal patterning as young juveniles (ca.
2.5 mm). During these stages, young males began to develop
red facial scales and conspicuous black and white dorsal
patterning typical of sexually mature adult males. The red
coloration of adult males is prominently displayed in courtship
and has been shown to improve courtship success in certain
contexts (Taylor & McGraw 2013), yet it is unclear whether
this coloration might have any functional role for juvenile
males who do not engage in courtship. Red coloration has
been shown to have important effects on receivers in a variety
of taxa (reviewed in Pryke 2009); it could be that juvenile
males use their red face for signaling in non-sexual contexts,
either with conspecifics, potential predators, or prey. Regard-
ing conspicuous dorsal patterning in adult males, this appears
to be linked to higher movement rates associated with mate-
searching, compared with cryptic females who spend more
time at rest. Presumably, the higher movement rates of males
render cryptic coloration ineffective; the pairing of conspicu-
ous body patterns with false antennation (i.e., leg waving
behavior) may help adult males avoid predators by imperfectly
mimicking wasps and/or bees (Taylor 2012). Again, it is
unclear what benefits, if any, this dorsal coloration might
provide to young juvenile males. It is possible that, even as
juveniles, males and females might face different ecological
selection pressures (e.g., different dispersal or movement rates)
that may drive such sex-differences in juvenile dorsal
patterning (Booth 1990); in future work, such ideas should
be examined in more detail. Finally, it is possible that juvenile
sexual dichromatism does not have a functional role (e.g.,
Johnston 1967); it may simply indicate relaxed selection
pressure for crypsis, compared with other species in which
274
THE JOURNAL OF ARACHNOLOGY
0 60 120
Age (days post-maturity) Age (days post-maturity)
Figure 5. — Effect of adult age (post-maturity) on male display colors that were previously found to be correlated with body condition in the
field (mean ± SEM). Aspects of red facial coloration (a-c) did not change with age, yet the brightness (lightness) of male green leg coloration
increased as males aged (d). Different letters indicate significant differences at P <0.05.
males are cryptically colored until maturity. It is interesting,
however, that this species is an exception to the general pattern
of salticid color development, where juveniles of both sexes
typically resemble females in color pattern until reaching
maturity (LAT, pers. obs.). To date, studies of any aspect of
the biology of juvenile jumping spiders are rare (e.g., Nelson et
al. 2005; Bartos 2008), yet they have revealed interesting aspects
of life history that would have been missed by simply focusing
on adults, as most studies do. H. pyrrithrix is a particularly
good system in which to examine sex differences in juveniles
because, unlike most salticid species, color patterns allow small
juveniles to be accurately sexed well before reaching maturity.
In addition to age-related changes that occur during
development prior to sexual maturity, our study also
uncovered post-maturity, age-based color change. Previous
studies have suggested that structural coloration in jumping
spiders may be linked to male age (Lim & Li 2007; Taylor et
al. 2011), yet both of these studies used comparisons of two
groups of spiders, one that had been collected from the field
and measured immediately and a second that was field-
collected and measured after a certain period of time in the
lab. While differences in the two groups may be due to age, we
cannot rule out confounding effect of diets and captivity; in
both cases, the first group experienced a field-based diet/
environment for its entire life while the second group was
collected from the field and then switched to a lab-based diet/
environment prior to color measurement. Here we remove
these confounding effects of diet and captivity to show that,
even when spiders are raised entirely in the lab, the green leg
coloration of adult males fades (i.e., increases in mean
brightness) with age. This is also consistent with correlational
findings from a previous study (Taylor et al. 2011); this same
aspect of male leg color (brightness) was correlated with body |
condition in the field, suggesting that younger males in better
condition have darker legs, while older males in poorer |
condition have lighter legs. j
Interestingly, this pattern of age-based fading did not hold
for the males’ red facial coloration, which is also correlated
with body condition in the field (Taylor et al. 2011). Previous j
studies have shown that red facial coloration is positively j
correlated with the quality of a male’s juvenile diet (Taylor
et al. 2011). Collectively, these studies support the idea that I
the two different colors (red faces and green legs) have the '
potential to signal different aspects of male quality (reviewed
in Hebets & Papaj 2005). A male’s red facial coloration j
potentially signals a male’s nutritional status and foraging
ability (but not his age), while green leg coloration may signal j
age while containing no information about his diet or foraging
ability. An interesting next step will be to examine how the
mechanisms of coloration (e.g., specific pigments, structures,
etc.) for these jumping spiders might facilitate or constrain the ll
information content of a specific color and how they influence ;
receivers (e.g., McGraw et al. 2002). Work with butterflies
suggests that structural colors are more likely to fade with age !
than pigmentary colors (Kemp 2006). A better understanding |
of the detailed mechanisms of color production in H. i|
pyrrithrix, including the specific pigments and structure types, j
will allow us to test the generality of these ideas.
Our examination of the morphology of the males’ green legs
offer preliminary insight into the mechanisms of age-based
fading observed in our study. The green leg coloration is
produced in the cuticle, while additional white light is reflected '
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
275
off of the long, fragile spatulate scales (LAT, pers. obs., see
Fig. 1 c,d). Fading of leg color could thus be a result of the
breakdown of structures in the green cuticle, or alternatively,
could be a result of damage to white spatulate scales, causing
them to reflect more light. Males use these front legs in prey
capture (LAT, pers. obs.), and thus damage to their scales over
time may be difficult to avoid. Closer examination of the
morphological changes that occur with age may help to
elucidate the mechanisms behind age-based fading in H.
pyrrithrix leg color.
Here we show that, in addition to sexually dichromatic miale
display colors that show a sudden onset at maturity (e.g.,
brilliant green legs, bright white pedipalps), males also have
bright sexually dimorphic colors that begin to develop when
males are still small juveniles (e.g., red faces and conspicuous
black and white dorsal patterning). Furthermore, these colors
are not all static at maturity; in particular, the green front legs
of males are subject to age-based fading. As this is the first
study to quantify age-based changes in juvenile coloration
of any species of jumping spider, this work provides an
important first step towards understanding the costs, benefits,
and potential functions of juvenile coloration. Recent work on
salticid coloration has provided some interesting and prom-
ising systems to examine general questions about color
communication and evolution (Lim et al. 2007, 2008; Li
et al. 2008a; Taylor et al. 2011; Taylor & McGraw 2013).
Examination of ontogenetic changes in spider coloration,
particularly in groups such as Habronattus, may help us
elucidate some of the more subtle costs and benefits of color
expression and change throughout an animal’s life.
ACKNOWLEDGMENTS
We thank K. Domke, J. Grieco, L. Hall, A. Lopez, and M.
Ponce for assistance in the field and lab. B. Sharp, R. Roberson,
and D. Lowry provided valuable training and assistance with
SEM. J. Alcock, C. Johnson, and R. Rutowski provided
discussion on study design as well as helpful comments on early
versions of this manuscript. We thank M. and C. Sclinepf for
permission to collect spiders on their property. This work was
supported by research grants from the Animal Behavior
Society, Sigma Xi, and the Arizona State University Graduate
and Professional Students’ Association, as well as a National
Science Foundation Graduate Research Fellowship to LAT.
LITERATURE CITED
Andersson, M. 1994. Sexual Selection. Princeton University Press,
Princeton, NJ.
Andersson, S. & M. Prager. 2006. Quantifying colors. Pp. 41-89. In
Bird Coloration: Mechanisms and Measurements. (G.E. Hill &
K.J. McGraw, eds.). Harvard University Press, Cambridge, MA.
Bartos, M. 2008. Alternative predatory tactics in a juvenile jumping
spider. Journal of Arachnology 36:300-305.
Beck, C.W. & D.E.L. Promislow. 2007. Evolution of female
preference for younger males. PLoS ONE 2:e939.
Booth, C.L. 1990. Evolutionary significance of ontogenetic colour
change in animals. Biological Journal of the Linnean Society
40:125-163.
Conover, W.J. & R.L. Iman. 1981. Rank transformations as a bridge
between parametric and nonparametric statistics. American
Statistician 35:124—129.
Cott, H.B. 1940. Adaptive Coloration in Animals. Methuen, London,
UK.
Delhey, K., A. Peters, A. Johnsen & B. Kempenaers. 2006. Seasonal
changes in blue tit crown color: do they signal individual quality?
Behavioral Ecology 17:790-798.
Foelix, R.F. 2011. Biology of Spiders. Oxford University Press, New
York.
Galvan, I. & A.P. Moller. 2009. Different roles of natural and sexual
selection on senescence of plumage colour in the barn swallow.
Functional Ecology 23:302-309.
Girard, M.B., M.M. Kasumovic & D.O. Elias. 2011. Multi-modal
courtship in the peacock spider, Maratus volans (OP-Cambridge,
1874). PLoS ONE 6:e25390.
Griswold, C.E. 1987. A revision of the jumping spider genus
Habronattus F.O.P. Cambridge (Araneae: Salticidae), with phe-
netic and cladistic analyses. University of California Publications
in Entomology 107:1-344.
Hawkins, G.L., G.E. Hill & A. Mercadante. 2012. Delayed plumage
maturation and delayed reproductive investment in birds. Biolog-
ical Reviews 87:257-274.
Hebets, E.A. & D.R. Papaj. 2005. Complex signal function:
developing a framework of testable hypotheses. Behavioral
Ecology and Sociobiology 57:197-214.
Hill, D.E. 1979. Scales of salticid spiders. Zoological Journal of the
Linnean Society 65:193-218.
Hill, G.E. & K.J. McGraw. 2006. Bird Coloration: Function and
Evolution. Harvard University Press, Cambridge, MA, USA.
Huey, R.B. & E.R. Pianka. 1977. Natural selection for juvenile lizards
mimicking noxious beetles. Science 195:201-203.
Ingram, A.L., O. Deparis, J. Boulenguez, G. Kennaway, S. Berthier &
A.R. Parker. 2011. Structural origin of the green iridescence on the
chelicerae of the red-backed jumping spider, Phidippus johnsoni
(Salticidae: Araneae). Arthropod Structure & Development 40:
21-25.
Johnston, R.F. 1967. Sexual dimorphism in juvenile house sparrows.
Auk 84:275-277.
Kapun, M., A. Darolova, J. Kristofik, K. Mahr & H. Hoi. 2011.
Distinct colour morphs in nestling European Bee-eaters Merops
apiaster. is there an adaptive value? Journal of Ornithology
152:1001-1005.
Kemp, D.J. 2006. Heightened phenotypic variation and age-based
fading of ultraviolet butterfly wing coloration. Evolutionary
Ecology Research 8:515-527.
Kemp, D.J. & J.M. Macedonia. 2006. Structural ultraviolet
ornamentation in the butterfly Hypolimiuis bolina L. (Nymphali-
dae): visual, morphological and ecological properties. Australian
Journal of Zoology 54:235-244.
Kilner, R. 2006. Function and evolution of color in young birds.
Pp. 201-232. In Bird Coloration: Function and Evolution. (G.E. Hill
& K.J. McGraw, eds.). Harvard University Press, Cambridge, MA.
Kokko, H. & J. Lindstrom. 1996. Evolution of female preference for
old mates. Proceedings of the Royal Society Biological Sciences
Series B 263:1533-1538.
Li, J.J., M.L.M. Lim, Z.T. Zhang, Q.Q. Liu, F.X. Liu & J. Chen,
et al. 2008a. Sexual dichromatism and male colour morph in
ultravio!et-B reflectance in two populations of the jumping spider
Phintella vittata (Araneae: Salticidae) from tropical China.
Biological Journal of the Linnean Society 94:7-20.
Li, J.J., Z.T. Zhang, F.X. Liu, Q.Q. Liu, W.J. Gan & J. Chen, et al.
2008b. UVB-based mate-choice cues used by females of the
jumping spider Phintella vittata. Current Biology 18:699-703.
Lim, M.L.M. & D.Q. Li. 2004. Courtship and male-male agonistic
behaviour of Cosmophasis umbratica Simon, an ornate jumping
spider (Araneae: Salticidae) from Singapore. Raffles Bulletin of
Zoology 52:435M48.
Lim, M.L.M. & D.Q. Li. 2006. Extreme ultraviolet sexual dimor-
phism in jumping spiders (Araneae: Salticidae). Biological Journal
of the Linnean Society 89:397-406.
276
THE JOURNAL OF ARACHNOLOGY
Liin, M.L.M. & D.Q. Li. 2007. Effects of age and feeding history on
structure-based UV ornaments of a jumping spider (Araneae:
Salticidae). Proceedings of the Royal Society Biological Sciences
Series B 274:569-575.
Lini, M.L.M., M.F. Land & D.Q. Li. 2007. Sex-specific UV and
fluorescence signals in jumping spiders. Science 315:481-481.
Lim, M.L.M., J.J. Li & D. Li. 2008. Effect of UV-reflecting markings
on female mate-choice decisions in Cosmophasis iimhratica, a
jumping spider from Singapore. Behavioral Ecology 19:61-66.
Maddison, W. & M. Hedin. 2003. Phylogeiiy of Habronattiis jumping
spiders (Araneae: Salticidae), with consideration of genital and
courtship evolution. Systematic Entomology 28:1-21.
Manning, J.T. 1985. Choosy females and correlates of male age.
Journal of Theoretical Biology 116:349-354.
McGraw. K.J. & G.E. Hill. 2004. Plumage color as a dynamic trait:
carotenoid pigmentation of male house finches (Carpodacus
mexicanus) fades during the breeding season. Canadian Journal
of Zoology 82:734-738.
McGraw, K.J., E.A. Mackiliop, J. Dale & M.E. Hauber. 2002.
Different colors reveal different information: how nutritional stress
affects the expression of melanin- and structurally based orna-
mental plumage. Journal of Experimental Biology 205:3747-3755.
Montgomerie, R. 2006. Analyzing colors. Pp. 90-147. In Bird
Coloration: Mechanisms and Measurements. (G.E. Hill & K.J.
McGraw, eds.). Harvard University Press, Cambridge, MA.
Moreno, J., E. Lobato, J. Morales, S. Merino, G. Tomas & J.
Martinez-de la Puente, et al. 2006. Experimental evidence that egg
color indicates female condition at laying in a songbird. Behavioral
Ecology 17:651-655.
Nelson, X.J. 2010. Polymorphism in an ant mimicking jumping
spider. Journal of Arachnology 38:139-141.
Nelson, X.J., R.R. Jackson & G. Sune. 2005. Use of Anopheles-
specific prey-capture behavior by the small juveniles of Evarcha
ciilicivora, a mosquito-eating jumping spider. Journal of Arachnol-
ogy 33:541-548.
Ornborg, J., S. Andersson, S.C. Griffith & B.C. Sheldon. 2002.
Seasonal changes in a ultraviolet structural colour signal in blue
tits, Pams caenileus. Biological Journal of the Liniiean Society
76:237-245.
Parker, A.R. & Z. Hegedus. 2003. Diffractive optics in spiders.
Journal of Optics A — Pure and Applied Optics 5:S1 1 1-Sl 16.
Peckham, G.W. & E.G. Peckham. 1889. Observations on sexual
selection in spiders of the family Attidae. Occasional Papers of the
Wisconsin Natural History Society 1:3-60.
Peckham, G.W. & E.G. Peckham. 1890. Additional observations on
sexual selection in spiders of the family Attidae, with some remarks
on Mr. Wallace’s theory of sexual ornamentation. Occasional
Papers of the Wisconsin Natural History Society 1:117-151.
Platnick, N.I. 2013. The World Spider Catalog, Version 13.5.
American Museum of Natural History, New York. Online at
http://research.amnh.org/iz/spiders/catalog
Pryke, S.R. 2009. Is red an innate or learned signal of aggression and
intimidation? Animal Behaviour 78:393-398.
Ruxton, G.D., T.N. Sherratt & M.P. Speed. 2004. Avoiding Attack:
the Evolutionary Ecology of Crypsis, Warning Signals and
Mimicry. Oxford University Press, Oxford, UK.
Slatkin, M. 1984. Ecological causes of sexual dimorphism. Evolution
38:622-630.
Tarling, G.A. & J. Ciizin-Roudy. 2008. External parasite infestation
depends on moult-frequency and age in Antarctic krill (Euphausia
superba). Polar Biology 31:121-130.
Taylor, L.A. 2012. Color and communication in Habronattus jumping
spiders: tests of sexual and ecological selection. Ph.D. Dissertation,
Arizona State University.
Taylor, L.A., D.L. Clark & K.J. McGraw. 2011. Condition
dependence of male display coloration in a jumping spider
(Habronattus pvrrithrix). Behavioral Ecology and Sociobiology
65:1 133-1146.
Taylor, L.A. & K. McGraw. 2013. Male ornamental coloration
improves courtship success in a jumping spider, but only in the sun.
Behavioral Ecology 24:955-967.
Ubick, D., P. Paquin, P.E. Cushing & V.D. Roth. 2005. Spiders of
North America: An Identification Manual. American Arachno-
logical Society.
Manuscript received 11 November 2013, revised 7 August 2014.
2014. The Journal of Arachnology 42:277-283
Scavenging throughout the life cycle of the jumping spider, Phidippus audax (Hentz) (Araneae: Salticidae)
Michael E, Vickers', Marianne W. Robertson' \ Casey R. Watson- and Travis E. Wilcoxen': 'Department of Biology,
Millikin University, Decatur, IL 62522, USA; -Department of Physics and Astronomy, Millikin University, Decatur,
IL 62522, USA
Abstract. Phidippus audax (Hentz 1845), a common North American jumping spider, is a visual predator that uses its
highly developed eyesight to detect and forage actively for prey. We demonstrate that P. audax can survive throughout its
life cycle as a scavenger. We separated 600 spiderlings into eight treatments examining all combinations of three different
variables: live versus dead prey, substrate present versus substrate absent, and large versus small arenas. Over the course of
the study, we recorded survival rates, instar durations, and carapace widths. Our results indicate that P. audax can survive
solely on a diet of dead prey, but at significantly lower survival rates and with longer instar durations than spiders fed on
live prey. Scavenging spiders, however, exhibited no significant difference in carapace widths when compared to predators.
Choice tests conducted on adults indicate that spiders raised as either predators or scavengers exhibit no significant
differences in prey choice when given the option of live or dead prey.
Keywords: Dead prey, mortality, habitat complexity, development
Jumping spiders (Salticidae) are active predators that feed on
a wide variety of prey. Their enlarged anterior-median eyes and
secondary eyes provide them with heightened sensitivity to
visual stimuli (Land 1971 ). Individuals first orient toward prey,
then stalk or actively chase it to within a few centimeters, and
then attempt a strike (Forster 1982a; Foelix 1996). Active
predation is the strategy most widely studied in salticids (Givens
1978; Hill 1979; Forster 1982a; Freed 1984; Nyffeler et al. 1990;
Richman & Jackson 1992; Jackson & Pollard 1996), however,
alternative types of feeding behaviors do occur in this family.
These alternative behaviors include araneophagy (Harland &
Jackson 2000; Jackson 2000; Rienks 2000; Jackson et al. 2002;
Penney & Gabriel 2009), herbivory (Meehan et al. 2009),
indirect vertebrate blood feeding (Jackson et al. 2005),
myrmecophagy (Jackson et al. 1998; Clark et al. 2000),
nectivory (Ruhren & Handel 1999; Jackson et al. 2001), and
prey stealing (Jackson et al. 2008). Our study focuses on
scavenging in the salticid Phidippus audax (Hentz 1845).
Scavenging by spiders is not widely reported in the field;
however, it has been demonstrated in the laboratory. For
example, wolf spiders (Lycosidae) preferentially feed on aged,
dead prey items over live prey when given the choice (Knost &
Rovner 1975). Female Theridion evexum Keyserling 1884
(Theridiidae) collect and store dead prey in their webs, and
when spiderlings emerge, they feed upon both old and newly
acquired dead prey items (Barrantes & Weng 2008). The
brown recluse spider, Loxosceles reclitsa Gertsch & Mulaik
1940 (Sicariidae), also feeds on dead prey items (Sandidge
2003; Cramer 2008; Vetter 2011).
Scavenging in Jumping spiders has also been demonstrated.
Wolff (1986) starved 13 adult Salticus scenicus (Clerck 1757)
females for five days and then presented them with dead house
flies as prey. House fiies given to starved spiders had
significantly lower post-trial weights than house flies given
to well-fed spiders, indicating that the starved spiders fed on
the dipteran prey. Although Wolff (1986) demonstrated that
starved salticids have the potential to feed on dead prey,
^Corresponding author. Email: mrobertson(gmillikin.edu
scavenging has never been demonstrated throughout the life
cycle of any spider species. We examined scavenging in a
jumping spider, P. audax, to determine if a highly visually-
oriented predator could survive solely on dead prey through-
out its life cycle.
In the present study we examined three possible variables:
prey type, habitat complexity (presence or absence of
substrate), and arena size. We predicted that spiders raised
as scavengers would have lower survival rates than predators
due to the lack of visual cues provided by dead prey. As a
corollary, we hypothesized that scavengers would exhibit
longer instar durations and smaller carapace widths than
predators due to reduced prey consumption. We predicted
that the addition of substrate and increased arena size would
further hinder scavengers’ ability to detect dead prey and thus
further reduce their survival rate. Because the combination of
added substrate and increased foraging area better reproduces
the spiders’ natural environment, adjusting these conditions
enabled us to test the prospect of scavenging in the field, and
the effects that changes within an environment might have on
scavengers.
METHODS
We collected eleven gravid female jumping spiders, P.
audax, from the Rock Springs Center for Environmental
Discovery in Macon Co., Decatur, IL USA (39.817713° N,
89.00932° W) in the spring of 1998. We housed each gravid
female individually in a petri dish (15 cm diameter X 1.5 cm
height) until oviposition. Eight females successfully oviposited
in the lab. We removed 600 spiderlings (mean = 75, SE =
14.87, range = 6-104) and housed each in a separate petri dish
(10 cm diameter X 1.5 cm height) until spiderlings were
randomly separated into groups.
We randomly separated the 600 spiderlings into eight
groups of 75 with the following treatments: live versus dead
prey, large (15 cm X 1.5 cm) versus small (10 cm X 1.5 cm)
arena size, and substrate present (10 g of peat moss in large
arenas and 4.5 g of peat moss in small arenas) versus substrate
absent.
277
278
THE JOURNAL OF ARACHNOLOGY
Table 1 . — Feeding regime for Phidippus tiudcix in instars 2-8. Note
that instar 1 is spent within the egg sac.
Instar
No. of prey introduced
Prey species
2
2
Drosophila nielauogaster
3
4
D. nielauogaster
4
6
D. nielauogaster
5
1
Musca doniestica
6
2
M. doniestica
7-8
3
M. doniestica
Spiders were kept at room temperature under a 12:12
photoperiod regime. We fed spiders three times per week,
removed uneaten prey, and supplied fresh water via soaked
cotton balls. We introduced prey at an approximate distance
of 13 cm from the spider in large arenas and 8 cm away in
small arenas. For prey, we used fruit flies, Drosophila
nielauogaster, or house flies, Musca domestica, depending on
spider instar (Table 1). For scavenging treatments, we killed
prey immediately prior to feeding. We lightly crushed fruit
flies, and we killed house flies by applying pressure to the
prothorax with forceps. We used organic, sphagnum peat
moss as a substrate to simulate a more natural environment.
The peat moss was kept dry during the course of the study and
not replaced.
Throughout the life cycle of each spider, we recorded the
date of every molt and the date of death when applicable. At
the end of each instar, we removed exuviae and preserved
them in 80% ethanol for later measurement of carapace
widths. Carapace widths were recorded using a Meiji
microscope fitted with an ocular micrometer. Five of the
spiders were removed from the study because of unrecorded
molt dates. Voucher specimens were deposited in the Millikin
University Arthropod Collection.
When spiders reached maturity, we conducted a choice test
to determine which prey type (live versus dead house fly)
spiders would select. For these choice tests, we introduced two
prey items simultaneously > 7.0 cm in front of the spiders’
cephalothorax in a large (15 cm X 1.5 cm) arena. We ran
choice tests for approximately 20 min or until capture, and
then recorded prey choice. We tested a total of 226 spiders: 144
raised as predators and 82 raised as scavengers.
Statistical analysis. — To determine the effects of scavenging
on P. aiidax, we recorded survival rates, instar durations and
carapace widths throughout their development, and choice of
live versus dead prey as adults. To isolate differences arising
from each of the 3 environmental variables (prey type,
presence or absence of substrate, and arena size), we used a
Cox Regression survival analysis with survival (yes or no) as
the dependent variable and prey type (live or dead), substrate
(yes or no), arena size (large or small), their three-way
interaction and their two-way interactions as independent
predictor variables.
To determine the effects of the prey type, substrate, and
arena size on instar duration, we completed a General Linear
Mixed Model (LMM) with instar duration as the dependent
variable and instar, prey type, substrate type, arena size, and
all two-way and three-way interactions as independent
variables. Spider identity was included as a random variable.
Choice test results were analyzed within each group,
predators and scavengers, using the chi-square goodness-of-
fit test against a null expectation of 50:50. In addition, we used
a chi-square contingency test to determine whether the
proportion of predators that chose live prey differed from
the proportion of scavengers that preferred live prey. In all
cases, R-values of less than 0.05 were considered statistically
significant.
RESULTS
Of the initial sample of 600 spiderlings, we successfully
raised a total of 226 P. audax to maturity, with 144 raised as
predators on live prey and 82 as scavengers on dead prey
(Table 2; Fig. 1 ).
Survival. — There was a statistically significant three-way
interaction among prey type, substrate type, and arena size
with regards to survival (/i = 0.951, Wald = 4.714, df = 1,
(exp) /i = 0.386, P = 0.030). The /i is the logistic coefficient for
each predictor variable (i.e. arena size, substrate type, or prey
type) and represents the expected amount of change in survival
when changing from one condition to the other within the
predictor. The Wald test (and accompanying R-value) is useful
in evaluating whether or not the logistic coefficient (^) is
different from zero. Finally, the (exp) fi represents the
instantaneous relative risk of death, at any time, for a spider
with one treatment for one variable compared with an
individual with the other treatment for that variable. To gain
an understanding of the nature of the interaction, we ran
separate Cox Regression analyses within each of the two arena
sizes.
Within the small arenas, differences in survival between
spiders fed different prey types were dependent upon substrate
type (two-way interaction of prey type and substrate type; (i =
-1.173, Wald x‘ = 15.527, df = 1, (exp) p = 0.310, P <
0.001 ). Because of the significant interaction term within small
Table 2. — Total number of Phidippus audax assigned to each treatment, total number of spiders raised to maturity, and percent survival in
each of the eight treatments.
Prey type
Substrate type
Arena size
^Assigned to treatment
#Raised to maturity
% survival
Live
Empty
Large
75
43
57
Live
Empty
Small
75
34
45
Live
Substrate
Large
75
32
42
Live
Substrate
Small
75
35
46
Dead
Empty
Large
75
28
37
Dead
Empty
Small
75
42
56
Dead
Substrate
Large
75
2
0.02
Dead
Substrate
Small
75
10
13
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HENTZ
279
1.0
0.8
rt!
>
i 0.6
D
Ut
01
>
^ 0.4
3
e
3
u
0.2
0.0
Figure 1. — Survival curve based on Cox Regression for Phidippus
aiidax raised on live prey (predator) or dead prey (scavenger). There
was no significant main effect of prey type on survival {P = 0.944).
arenas, we ran a separate Cox Regression within small arenas
with substrate and small arenas without substrate. Within
small arenas with no substrate, there was greater survival to
subsequent instars with dead prey (/? = 0.578, Wald x“ = 8.36,
-Predator
-Scavenger
P = 0.944
4 5
Instar
df = \, P = 0.004, (exp) /f = 1.783; Fig. 2a). Conversely,
within small arenas with substrate, there was greater survival
to subsequent instars with live prey (/i = —0.564, Wald x“ =
6.320, df= \, P = 0.012, (exp) /? = 0.569; Fig. 2b).
Within the large arenas, differences in survival on different
prey types were dependent upon substrate type (two-way
interaction of prey type and substrate type; /i = 1.797, Wald x“
= 28.077, df = 1, (exp) /i = 6.032, P < 0.001). Because of the
significant interaction term within large arenas, we ran a
separate Cox Regresssion within large arenas with substrate
and large arenas without substrate. Within large arenas with
no substrate, there was no significant difference in survival
between spiders with live prey or dead prey (/( = 0.231, Wald
X- = 1.285, df ^ 1, P = 0.257, (exp) p = 1.260; Fig. 2c).
Within large arenas with substrate, however, there was greater
survival to subsequent instars among spiders with live prey (/(
= -1.736, Wald x" = 34.916, df = \, P < 0.001, (exp) p =
0.176; Fig. 2d).
Sex comparisons in mature predators and scavengers: Of the
595 spiderlings used in this study, 117 males and 99 females
successfully reached maturity. However, adding the variable
‘sex’ resulted in poorer models in all cases, and there was no
difference in survival between males and females in the
presence of the other three variables (P > 0.198 in all cases).
Instar duration. — There were significant three-way interac-
tions of instar, prey type, and substrate type (Pi.isgs = 13.682,
P < 0.001; Table 3) and instar, prey type, and arena size
Instar ipsta,.
Instar 'nstar
Figure 2a-d. — Differences in survival for Phidippus audax raised on live prey (predator) or dead prey (scavenger) in a) small arenas without
substrate (P = 0.004); b) small arenas with substrate (P = 0.012); c) large arenas without substrate (P = 0.257); and d) large arenas with substrate
(P< 0.001).
280
THE JOURNAL OF ARACHNOLOGY
Table 3. — Results from a General Linear Mixed Model with instar
duration as the dependent variable and spider identity as a random
variable. Random variable (Spider ID): Wald Z = 28.249, P < 0.001
(retained in all models).
Variable
df
F
P
Instar
5. 1595
148.863
<0.001
Prey type
1, 1595
81.492
<0.001
Habitat
1, 1595
45.681
<0.001
Arena size
1, 1595
4.351
0.178
Instar*Prey
5, 1595
18.913
<0.001
Instar* Habitat
5, 1595
3.835
0.137
Instar*Arena
5, 1595
1.083
0.247
Prey* Habitat
1. 1595
53.919
<0.001
Prey*Arena
1, 1595
2.352
0.577
Habitat*Arena
5. 1595
6.799
0.146
Instar*Prey*Hab
1, 1595
13.682
<0.001
Prey*Hab*Arena
5, 1595
0.149
0.7
Instar*Prey* Arena
5, 1595
6.006
<0.001
(^5.1595 = 6.006, P < 0.001; Table 3). The significant three-
way interactions of instar and prey type with substrate type
and arena size indicate that instar duration is dependent upon
multiple variables; therefore, to determine the nature of the
interactions, we used subsequent LMM’s to analyze the effects
of instar and prey type as well as the two-way interactions of
instar and prey type within each of the possible combinations
of arena size and substrate type. The random variable, spider
identity, was also significant (Wald Z = 28.249, P < 0.001),
therefore, it was used in all subsequent analyses.
Within small arenas and no substrate, there was a
significant interaction between instar and prey type (T5 511 =
6.473, P < 0.001); therefore, we ran a separate LMM within
those with dead prey and found a significant difference in
instar duration among instars with a general pattern of
increasing instar duration from instar 2 (14.94 days) to instar 7
(63.95 days; Fig. 3a). The second LMM, within live prey,
revealed a similar pattern, with an increase in instar duration
from instar 2 (12.46 days) to instar 6 (52.6 days), however,
instar 7 was slightly lower than instar 6 (51.7) creating the
significant interaction term. In general, instar duration is
shorter with spiders given live prey within small arenas and no
substrate (Fig. 3a).
Within small arenas with substrate, there was again a
significant interaction between iiistar and prey type, and a
subsequent LMM within spiders given dead prey revealed
a significant difference in instar duration among instars, with a
general pattern of an increase in instar duration from instar 2
(23.6 days) to instar 7 (91.5 days; Fig. 3b). Exceptions were an
increase in instar duration in instar 4 to 64.59 days, followed
by a decrease in duration to 52 days in both the 5'’’ and 6*'’
instars. The second LMM, within live prey, again showed a
general increase in instar duration from instar 2 (13.8 days) to
instar 7 (47.15 days; Fig. 3b). The interaction term, then, is a
product of the increase in instar duration to 64.59 days in the
dead prey group’s 4‘'’ instar. Again, overall, spiders given live
prey had shorter instar durations than those given dead prey
within small arenas with substrate (Fig. 3b).
Within large arenas without substrate, there was a
significant interaction between instar and prey type, and a
subsequent LMM within spiders given dead prey revealed
a significant increase in instar duration from instar 2
(17.46 days) to instar 4 (43.68 days). However, there was a
plateau in instar duration for the subsequent instars (Fig. 3c).
From an LMM within spiders given live prey, we found a
significant increase in instar duration from instar 2 (1 1.2 days)
to instar 7 (51.85 days). Again, spiders given live prey, in
general, had shorter instar durations than those given dead
prey (Fig. 3c).
Within large arenas with substrate, there was another
significant interaction between instar and prey type. There-
fore, we ran a separate LMM within spiders with dead prey
and found a significant increase from instar 2 (17.34 days) to
instars 4 and 5 (89.25 days and 76.5 days, respectively). Only
one spider in this group survived to instar 6 (instar duration of
37 days) and no spiders in this group survived to instar 7.
From the second LMM within spiders given live prey, there
was a significant increase from instar 2 (14.76 days) to instar 7
(70.64 days; Fig. 3d). Again, overall, spiders given live prey
consistently had shorter instar durations than those given dead
prey (Fig. 3d).
Sex coiuparisous: We initially used a LMM that included
sex as an independent variable, but there was no significant
interaction between other independent variables and sex {P >
0.114 in all instars) nor was there a significant difference |
between males and females with regards to instar duration {P
> 0.182). Given the low percentage of spiders surviving to an
instar where sex could be determined and that there were no 1
significant interactions or main effects of sex, adding sex to the
LMM substantially reduced the power of the analysis.
Therefore, sex was not included in the final analyses of the
differences in instar durations.
Carapace widths. — Overall, as spiders matured, carapace j
widths were not significantly different among the eight
treatments in any of the instars (P > 0.05 in all cases).
Choice tests. — Whether raised as predators or scavengers, I
spider choice of prey type differed from random (i.e., 50:50).
Among predators, 117 chose live prey, while 27 chose dead
prey (/" = 56.25, df = P < 0.001). Among scavengers, 62 j
chose live prey, while 20 chose dead prey {'/~ — 38.03, df — I, P ]
< 0.001 ). There was no significant difference in the proportion
of predators (117/144) and scavengers (62/82) that preferred
live prey {y~ = 0.283, df = 1, P = 0.595).
DISCUSSION
Spiders can survive on dead prey alone but face costs, such
as lower survival rates and longer instar durations. Addition-
ally, the two independent variables of substrate/no substrate
and large/small arenas had significant effects on scavenging
spiders.
Survival. — With the addition of substrate in both small and
large arenas, scavengers exhibited lower survival rates. Our
results are consistent with those of previous studies. Phidippus
aiidax has been observed to hunt mainly on upper, well-lit
areas of vegetation, such as leaves and branches, as well as on
the sides of houses and fence posts (Givens 1978; Carducci &
Jakob 2000). It therefore stands to reason that the dark j
substrate color and the lack of visual stimuli from dead prey '
hindered the spiders’ ability to find dead prey items and would
both have a significant, negative impact on the spiders’
survival rates and instar durations. This indicates a low '
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HEHTZ
281
Instar
Instar
Instar Instar
Figure 3a-d. — Differences in instar duration for Phidippus aiidax raised on live prey (predator) and dead prey (scavenger) in a) small arenas
without substrate; b) small arenas with substrate; c) large arenas without substrate; and d) large arenas with substrate.
probability of successful scavenging by P. audax in nature,
where the foraging area is substantially larger and substrate is
varied and abundant. In the smaller foraging area, spiders had
a greater likelihood of finding dead prey by chance.
We found an interesting exception to the trend of lower
scavenger survival rates for treatments involving empty
arenas. While predators and scavengers in large, empty arenas
had statistically similar survival rates, scavengers had signif-
icantly greater survival to subsequent instars than predators in
small, empty arenas. These results are somewhat counterintu-
itive, but a possible explanation is that scavenger P. audax,
within a smaller foraging area, could have encountered and
began feeding upon dead prey items more quickly than
predator P. audax could capture and begin feeding on live
prey. In accord with our results, when predatory waterbugs
Microvelia macgregori Kirkaldy (Hemiptera: Veliidae) held in
water-filled arenas, were given dead prey items, D. mekmoga-
ster, the waterbugs began feeding when they came across a
dead prey item (Jackson & Walls 1998). Wolf spiders often
took dead prey as a meal if given the option, even if live prey
items were present (Knost & Rovner 1975). The jumping
spider. Trite planiceps Simon 1899 fed on freshly killed
squashed flies, if left overnight in their arenas (Forster
1982b). In the latter case as well as in our study, the
scavenging spiders may have detected minor residual move-
ments from the freshly killed Hies that prompted them to
attack and feed.
Instar duration. — On average, scavengers had longer instar
durations. Scavengers raised in substrate-filled arenas, both
large and small, exhibited the longest instar durations,
presumably due to difficulty in finding prey. Our results are
consistent with the literature. Pholcid spiders, Holoaieuuis
pluchei (Scopoli 1763), developed significantly faster and often
underwent fewer molts when they were given a prey diet that
allowed them to reach their satiation point (Jakob & Dingle
1990). Alternatively, when prey were limited, the orb-weaving
Zygiella-x-notata (Clerck 1757), had longer instar durations, a
correspondingly longer development time, and reduced adult
282
THE JOURNAL OF ARACHNOLOGY
weight (Mayntz et al. 2003). In addition, spiders reduce their
metabolic rates during long periods of food deprivation and
consequently survive longer (Anderson 1974; Greenstone &
Bennett 1980), which in turn may result in longer instar
durations.
Although P. aiu/ax are naturally active predators feeding on
a wide variety of live prey, we have shown for the first time
that these spiders are capable of surviving from egg sac
emergence to maturity solely on a diet of dead prey, albeit with
lower survival rates and longer instar durations. In addition to
acquiring nutrients from the dead prey, spiders raised as
scavengers may have also used metabolic defense mechanisms
to survive. For example, in a time of prey shortage, spiders will
exhibit a high tolerance to starvation by lowering metabolic
rates and using their abdomens to store large quantities of
lipids that can be used slowly until the prey shortage ends
(Anderson 1974; Greenstone & Bennett 1980; lida 2005).
Further research should be conducted to better understand the
types of nutrients being obtained from freshly killed or
desiccated prey items. Whatever the nutrients are, our results
indicate that at least some jumping spiders were able to survive
by further breaking down dead prey items (Givens 1978;
Cohen 1995; Foelix 1996; Morse 1998).
Carapace widths. — Overall, as spiders matured, we found
that carapace widths were not significantly different among the
eight treatments from instar to instar. Predators and scavengers
grew comparably, regardless of their prey type. With regard to
scavenging, these results may indicate that even though we
reported significant differences in mortality and instar duration,
individuals were able to reach average size. Correspondingly,
the orb-weaver, Zygiella x-notatci, experienced longer instar
durations when prey was limited, but these prey shortages did
not negatively impact growth within an instar. Additionally,
spiders fed low quality prey experienced higher instar growth
ratios by utilizing the longer instar durations to gain more
weight (Mayntz et al. 2003). The wolf spider Pardosa prativaga
(L. Koch 1870) experienced longer instar durations when food
restricted or fed nutritionally insufficient prey items. However,
when available prey was more abundant, spiders were able to
catch up on any lack in growth and development (Jespersen &
Toft 2003). Although the ability to stay within an instar for
longer periods of time to grow to average size may be beneficial
in the long run, in the short run it would make scavengers more
susceptible to predators in the wild.
Choice tests. — Because spiders raised both as predators and
scavengers preferred live prey as adults, P. audax exhibited its
instinctive predatory behavior regardless of the diet on which
it was raised. However, it is important to note that 47 spiders
did choose dead prey. This result could simply be due - at least
in part - to spiders finding and feeding on dead prey before
detecting live prey. Corroborating this hypothesis, wolf spiders
(Knost & Rovner 1975) and jumping spiders (Forster 1982b)
will feed on dead prey if they happen to come into contact
with it while foraging.
Our results indicate that P. audax can be reared as a
scavenger throughout its entire life cycle, but at certain costs
to the organism. Whether or not scavenging occurs in the field
is largely unknown. Much of the research conducted on
scavenging has been carried out in a controlled laboratory
setting (Knost & Rovner 1975; Wolff 1986; Cramer 2008),
where many of the variables can be restricted to much
narrower ranges than those that prevail in the natural world.
Because P. audax is a highly visual predator that actively
hunts for prey, scavenging may be a way to supplement food
intake during times of prey shortage. Further research should
also be conducted to determine the effects of a multi-prey diet
on scavenging as an alternative feeding strategy.
ACKNOWLEDGMENTS
We would like to thank Rock Springs Center for
Environmental Discovery for allowing us to collect spiders.
In addition, we would like to thank Denise Slane for helping
us maintain spider colonies in the laboratory. We thank the
Millikin Summer Undergraduate Research Fellowship and the
Millikin Biology Department for funding this research.
LITERATURE CITED
Anderson, J.F. 1974. Responses to starvation in the spiders Lycosa
lenfa Hentz and Filistata hibenuilis (Hentz). Ecology 55:576-585.
Barrantes, G. & J. Weng. 2008. Carrion feeding by spiderlings of the
cob-web spider Theridkm evexiim (Araneae, Theridiidae). Journal
of Arachnology 35:557-560.
Carducci, J.P. & E. Jakob. 2000. Rearing environment affects
behaviour of jumping spiders. Animal Behaviour 59:39M6.
Clark. R.J., R.R. Jackson & B. Cutler. 2000. Chemical cues from ants
influence predatory behavior in Hahrocestum piilex, an ant-eating
jumping spider (Araneae, Salticidae). Journal of Arachnology
28:309-318.
Cohen, A.C. 1995. Extra-oral digestion in predaceous terrestrial
Arthropoda. Annual Review of Entomology 40:85-103.
Cramer, K.L. 2008. Are brown recluse spiders, Loxosceles reclusa
(Araneae, Sicariidae) scavengers? The influence of predator
satiation, prey size and prey quality. Journal of Arachnology
36:140-144.
Foelix, R. 1996. The Biology of Spiders, 2"^ ed. Oxford University
Press, New York.
Forster, L.M. 1982a. Vision and prey-catching strategies in jumping
spiders. American Scientist 70:165-175.
Forster, L.M. 1982b. Non-visual prey-capture in Trite planiceps, a
jumping spider (Araneae, Salticidae). Journal of Arachnology
10:179-183.
Freed, A.N. 1984. Foraging behaviour in the jumping spider
Phidippus audax: bases for selectivity. Journal of Zoology
203:49-61.
Givens, R.P. 1978. Dimorphic foraging strategies of a salticid spider
(Phidippus audax). Ecology 59:309-321.
Greenstone, M.H. & A.F. Bennett. 1980. Foraging strategy and
metabolic rates in spiders. Ecology 61:1255-1259.
Harland, D.P. & R.R. Jackson. 2000. Cues by which Portia fimbriata,
an araneophagic jumping spider, distinguishes jumping-spider prey
from other prey. Journal of Experimental Biology 203:3485-3494.
Hill, D.E. 1979. Orientation by jumping spiders of the genus
Phidippus (Araneae: Salticidae) during the pursuit of prey.
Behavioral Ecology and Sociobiology 5:301-322.
lida, H. 2005. Trade-off between hunting ability and starvation
tolerance in the wolf spider. Pardosa pseudoamndata (Araneae:
Lycosidae). Applied Entomology and Zoology 40:47-52.
Jackson, R.R. 2000. Prey preferences and visual discrimination ability
of Brettus, Cocalus, and Cyrba, araneophagic jumping spiders
(Araneae: Salticidae) from Australia, Kenya and Sri Lanka. New
Zealand Journal of Zoology 27:29-39.
Jackson, R.R. & S.D. Pollard. 1996. Predatory behavior of jumping
spiders. Annual Review of Entomology 41:287-308.
Jackson, R.R. & E.l. Walls. 1998. Predatory and scavenging
behaviour of Microvelia luacgregori (Hemiptera: Veliidae), a
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HENTZ
283
water-surface bug from New Zealand. New Zealand Journal of
Zoology 25:23-28.
Jackson, R.R., R.J. Clark & D.P. Harland. 2002. Behavioural and
cognitive intluences of kairomones on an araneophagic jumping
spider. Behaviour 139:749-775.
Jackson, R.R., X.J. Nelson & G.O. Sune. 2005. A spider that feeds
indirectly on vertebrate blood by choosing female mosquitoes as prey.
Proceedings of the National Academy of Sciences 102:15155-15160.
Jackson, R.R., K. Salm & S.D. Pollard. 2008. Snatching prey from
the mandibles of ants, a feeding tactic adopted by East African
jumping spiders. Journal of Arachnology 36:609-61 1.
Jackson, R.R., S.D. Pollard, X.J. Nelson, G.B. Edwards & A.T.
Barrion. 2001. Jumping spiders (Araneae: Salticidae) that feed on
nectar. Journal of Zoology, London 255:25-29.
Jackson, R.R., D. Li, A.T. Barrion & G.B. Edwards. 1998. Prey-
capture techniques and prey preference of nine species of ant-
eating jumping spiders (Araneae: Salticidae) from the Philippines.
New Zealand Journal of Zoology 25:249-272.
Jakob, E.M. & H. Dingle. 1990. Food level and life history
characteristics in a pholcid spider {Holocnemiis pluchei). Psyche
97:95-102.
Jespersen, L.B. & S. Toft. 2003. Compensatory growth following
early nutritional stress in the wolf spider Pardosa prativaga.
Functional Ecology 17:737-746.
Knost, S.J. & J.S. Rovner. 1975. Scavenging by wolf spiders
(Araneae: Lycosidae). American Midland Naturalist 93:239-244.
Land, M.F. 1971. Orientation by jumping spiders in the absence of
visual feedback. Journal of Experimental Biology 54:119-139.
Mayntz, D., S. Toft & F. Vollrath. 2003. Effects of prey quality and
availability on the life history of a trap-building predator. Oikos
101:631-638.
Meehan, C.J., E.J. Olson, M.W. Reudink, T.K. Kyser & R.L. Curry.
2009. Herbivory in a spider through exploitation of an ant-plant
mutualism. Current Biology 19:R892-R893.
Morse, D.H. 1998. The effect of wounds on desiccation of prey:
Implications for a predator with extra-oral digestion. Oecologia
115:184-187.
Nyffeler, M., R.G. Breene & D.A. Dean. 1990. Facultative
monophagy in the jumping spider, Plexippiis paykiiUi (Audouin)
(Araneae: Salticidae). Peckhamia 2:92-96.
Penney, D. & R. Gabriel. 2009. Feeding behavior of trunk-living
jumping spiders (Salticidae) in a coastal primary forest in the
Gambia. Journal of Arachnology 37:1 13-1 15.
Richman, D.B. & R.R. Jackson. 1992. A review of the ethology of
jumping spiders (Araneae, Salticidae). Bulletin of the British
Arachnological Society 9:33-37.
Rienks, J.H. 2000. Extended nest residence and cannibalism in a
jumping spider (Araneae, Salticidae). Journal of Arachnology
28:123-127.
Ruhren, S. & S.N. Handel. 1999. Jumping spiders (Salticidae)
enhance the seed production of a plant with extrafloral nectaries.
Oecologia 119:227-230.
Sandidge, J.S. 2003. Scavenging in brown recluse spiders. Nature
426:30.
Vetter, R.S. 2011. Scavenging by spiders (Araneae) and its
relationship to pest management of the brown recluse spider.
Journal of Economic Entomology 104:986-989.
Wolff, R.J. 1986. Scavenging by jumping spiders (Araneae: Salt-
icidae). Great Lakes Entomologist 19:121-122.
Manuscript received 27 April 2013, revised 22 August 2014.
2014. The Journal of Arachnology 42:284-292
Removal of genital plugs and insemination by males with normal and experimentally modified palps in
Leucaitge mariana (Araneae: Tetragnathidae)
Vivian Mendez' •’ and William G. Eberhard' ^': 'Escuela de Bioiogia, Universidad de Costa Rica, Ciudad Universitaria,
Costa Rica; -Universidad Nacional Autonoma de Mexico; -’Department of Biological Sciences, Macquarie University,
Sydney, NSW 2109, Australia; ■’Smithsonian Tropical Research Institute, Biological Sciences, Louisiana State
University, Baton Rouge, LA. E-mail: william.eberhard@gmail.com
Abstract. Both males and females of the spider Leiicaiige mariana (Taczanowski 1881) contribute material to the plugs
that often occlude the genital openings of females in the field. Males were sometimes unable to remove or penetrate these
plugs, but overcame others using three different mechanical mechanisms: snag the plug and pull it off; break and penetrate
through it; and break its adhesion to the epigynum by injecting material under it. They used their genitalia to accomplish
these tasks, despite the fact that the genital bulb lacks muscles and innervation, thus limiting the male’s ability to guide
genital movements precisely. The effects of two male genital structures, the conductor tip and the conductor hook on sperm
transfer and genital plug removal were tested by direct observations of their morphology and behavior, and by
experimental removal of structures from one but not the other palp of the same male. Removal of the conductor tip
reduced sperm transfer, while removal of both the hook and the conductor reduced plug removal. A preliminary
characterization of palp movements and their sequences did not reveal any behavior that seemed especially designed for
removing plugs, as opposed to inseminating the female.
Keywords: Copulatory plugs, genitalic function, cryptic female choice, plug removal
Genital plugs in female genitalia occur in many animals,
and are generally formed from male seminal products or parts
of the male’s own genitalia (Smith 1984; Birkhead & Moller
1998; Simmons 2000; Uhl et al. 2010). Some plugs prevent
subsequent males from gaining access to the female’s
reproductive tract, and plugs are often included in lists of
sperm competition devices of males (Parker 1970; Thornhill &
Alcock 1983; Smith 1984; Birkhead & Moller 1998; Simmons
2000). Active female participation in making plugs occurs,
however, in some spiders (Knollach 1998; Uhl et al. 2010;
Aisenberg & Barrantes 2011) and insects (Markow & Ankney
1988; Hosken et al. 2009).
In several groups, plugs do not consistently exclude
subsequent males (reviewed in Eberhard 1996; Uhl et al.
2010), and males of some species remove at least some
copulatory plugs from the female (Milligan 1979; Masumoto
1993; Eberhard 1996; Knoflach 1997). The male’s genitalia
often seem to be active during the process of plug removal, but
details of the mechanisms by which plugs are removed have
been little studied. Most data involve only extrapolations from
the probable mechanical properties of male genital structures.
For instance, penile spines in microtine rodents and eversion
movements of the hemipenes in lizards have been hypothesized
to function to remove plugs (Milligan 1979; In den Bosch
1994), but direct observations and experimental evidence are
lacking. The thin pointed shape of the distal portion of the
aedeagus of a papilionid butterOy has been hypothesized to
allow the male to tunnel through or to slip past soft, recently
formed or small plugs (Matsumoto & Suzuki 1992). The male
of the linyphiid spider Duhiaranea (?) apparently dissolves
plugs in situ, perhaps with liquid from either his mouth or his
palps, and he then removes the pieces with undetermined
portions of his palps (Eberhard 1996). Male Agelena limbata
Thorell 1897 spiders also use unspecified portions of their
palps to pry plugs from the female (Masumoto 1993). To our
knowledge, no male morphological structure has ever been i|
demonstrated experimentally to be specialized for plug
removal. ,,
Given the selective importance to males of gaining access to *
internal female genitalia, it seems likely that male structures I
specialized for plug removal exist. Male genitalia seem ;
particularly likely to have plug removal structures, as they
probably often contact plugs. Plug removal devices could
evolve under sexual selection by male-male competition |i
(sperm competition), female choice (if females influence plug j
deposition, the necessity for plug removal, or the effectiveness
of removal attempts), male-female conflict (if the female’s best ji
interests involve maintaining a plug), or combinations of these ;
factors (e.g. Wiley & Posten 1996; Arnqvist & Rowe 2005;
Eberhard 2010). ;[
The present study documents female effects on plug i
deposition and removal, and a male genital structure whose
form, mechanical properties and behavior suggest that it
represents an adaptation to remove plugs in the tetragnathid
spider Leucaiige mariana (Taczanowski 1 88 1 ), a member of the
large cosmopolitan genus Leucauge White 1841 (>150 species;
Platnick 2013) that is abundant in early second growth and
secondary forest in the Central Valle (San Jose Province) of
Costa Rica. Copulation and sperm transfer have been studied
in detail in this species (Eberhard et al. 1993; Eberhard &
Huber 1998a; Mendez 2002; Aisenberg 2009; Aisenberg &
Eberhard 2009; Barrantes et al. 2013), but nearly exclusively in
virgin females. '
As in other spiders (Eberhard & Huber 2010), the sperm of
L. mariana are encapsulated when they are transferred from
the male’s palp to the female’s internal spermathecae in a ^
viscous liquid matrix (Figs. 1, 2c). Once inside the female, the
sperm emerge from their capsules (Eberhard & Huber 1998a),
as in the related Nephila clavipes (Linnaeus 1767) (Brown
1985). Sperm precedence patterns are not known in L.
284
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
285
Figure 1. — Epigynum without a plug (left) and with a partial, asymmetrical plug (right).
Figure 2. — Ventral and microscopic views of plugs of L. mariana.
a) a yellow plug containing spheres (arrows) but no sperm; b) a large
mixed white and yellow plug overflowing the central cavity, with an
irregular surface; c) contents of a plug stained with acetocarmine
which contained both encapsulated sperm (right arrow) and
decapsulated sperm (left arrow); d) a white plug covering the lower
portions of one side of the epigynum (arrow indicates a portion of the
epigynal curved ridge that was not covered; e) a yellow-orange plug
with a granular surface; 0 a small yellowish plug with a smooth
surface at the anterior corner of the left side of the central cavity
(arrow); g) a white plug with a smooth surface that covers most of the
central cavity.
mariana, but the fact that males in the field occur preferen-
tially with penultimate iestar females rather than mature
females (Eberhard et al. 1993), indicates that the first male to
mate with a female often sires at least some of her offspring.
On the other hand, the following combination of observations
indicates that first male sperm precedence is not complete:
males mate with non-virgin females both in the field and in
captivity (Mendez 2002; W. Eberhard unpub. obs.); distinctive
behavior of the male’s genitalia results in deposition of one
component of the plug during the latter stages of copulation
(Eberhard & Huber 1998a); females in some cases add a
second component to the plug (Eberhard & Huber 1998a;
Aisenberg 2009; Aisenberg & Eberhard 2009); and males
push and scrape at some plugs with their genitalia without
dislodging them, but dislodge others and then apparently
succeed in inserting their genitalia in the female (Mendez 2002;
the present study). Mixed first and last male paternity has been
observed in the related genus Tetragnatha Latreille 1841
(Danielson-Frangois & Bukowski 2005).
The female’s epigynum, where all male insertion, plugging,
and unplugging attempts occur, is a sclerotized plate on the
ventral surface of her abdomen, with a central cavity that is
bounded anteriorly by an overhanging wall (Fig. 1); access to
the entrance of each of the two insemination ducts, which lead
to the two spermathecae, is through slits at the base of the
rounded lateral wall of the central cavity. Plugs consist of
masses that vary in size, shape, consistency and texture that
are located at variable sites on the epigynum (Figs, lb, 2b,
d-g) (Mendez 2002).
During copulation, the palps are extended, and contact the
female’s abdomen in alternation. The subapical cymbium of
the palp (Fig. 3) is first placed on a featureless region of the
ventral surface of the female’s abdomen just anterior to her
epigynum. Then the basal hematodocha inflates (“primary
inflation”), causing the distal bulb to rotate so that its terminal
portion, which includes the intromittent embolus and the tip
and hook of the conductor sclerite, moves ventrally away from
the cymbium and then dorsally toward the entrance of the
insemination duct on the female’s epigynum. If the entrance is
unobstructed and the palp is correctly aligned, the conductor
hook sweeps antero-laterally across the female’s epigynum
until it is arrested by the anterior wall, and the basal
hematodocha then swells further (a “secondary inflation”),
causing further rotation that drives the conductor tip and the
286
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Movements (small arrows) of embolus base and tegulum that resulted from inflation of the basal hematodocha (partially collapsed
in this preparation; the approximate position of the cymbium in life is indicated by the dotted lines). The tegulum rotated against the
paracymbitim, whose tip slid along the groove in the tegulum as the expansion of the basal hematodocha drove the embolus distally from the
conductor (from Eberhard & Huber 1998a).
embolus into the insemination duct (an “insertion”) (Eberhard
& Huber 1998a). Substantial force is applied to the female
during primary and secondary inflations, sometimes displac-
ing her entire abdomen laterally.
Two types of palpal insertion occur in copulations with
virgin females (Eberhard & Huber 1998a). “Long” insertions
(when sperm transfer probably occurs, at least in copulations
with virgin females) last on the order of 1 min. Repeated
secondary intlations of the basal hematodocha alternate with
brief collapses; each inflation drives the embolus tip into the
insemination duct. “Short” insertions last on the order of Is
and involve only a single secondary inllation, and both the
embolus and conductor are then pulled away from the
epigynum when the basal hematodocha collapses. Short
insertions usually occur in bouts, and later in copulation. A
small mass of white material emerges from the tip of the
embolus and is deposited on the surface of the epigynum
during many short insertions. Many apparent insertion
attempts fail (44% in copulations with virgin females;
Eberhard & Huber 1998a), when the conductor tip and or
the hook snag the epigynum only momentarily or miss it
completely during a primary inllation (“flubs” in the
terminology of Watson 1991). On average, copulation with
virgin females lasted 17.3 ± 6.1 min; there were 3.5 ± 2.0 long
insertions, averaging about 108-120 s in duration, and 6.2 ±
5.2 bouts of short insertions with a mean of 14.6 ± 7.0
indations per bout. Copulations with unplugged non-virgin
females were shorter (9.9 ± 13.3 min), and had fewer long
insertions (0.2 ± 0.6).
It is important to keep in mind that insertion attempts by
male L. mariana are “blind” in two senses. The male’s eyes are
on his dorsal side, so he cannot possibly see his palps,
copulatory plugs, or the female’s genitalia during copulation.
In addition, his palpal bulb is not innervated (Eberhard &
Huber 1998b, 2010), so he has no direct sensory feedback from
the bulbal structures (conductor tip, hook, embolus) that
contact the female’s genitalia. Movements of bulb sclerites are
produced by changes in internal pressure and expansion of
hematodochal membranes, rather than by contractions of
muscles. The only sensory feedback that may be available to
the male is from more basal structures such as his cymbium,
which is innervated and has abundant setae on its surface that
contact the female’s abdomen during intromission attempts,
or other segments of his palp.
METHODS
Spiders were readily induced to copulate ventral side
upward under a dissecting microscope, where details of the
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
287
Figure 4. — SEM images of the distal portions of the male palpal bulb of L. markma. a) intact palp; b both the hook and the conductor tip
removed; c only the tip of the conductor removed; d) close-up of embolus tip at the site where the conductor tip was cut off.
behavior of the male’s palps and their mechanical interactions
with the female’s epigynum were observed and recorded. An
orb of a mature female in the field was mounted on the raised
edges of a plastic plate about 30 cm in diameter, and the
female to be observed and then the male were induced to climb
onto the web. The plate was then placed under a microscope.
We captured each mature male in the field the day he was
observed. All spiders were collected on the campus of the
Universidad de Costa Rica in San Pedro de Montes de Oca,
San Jose Province, Costa Rica (el. 1100 m).
Each palp introduces sperm into only one of the female’s
two spermathecae, so paired tests were possible to test for
effects of modifying one of the male’s palps but not the other
on plug removal, sperm transfer, and palp behavior (see
Discussion for limits on details of the replications). We
modified the palps of some males experimentally by first
clamping the male gently between the foam-rubber covered
tips of a fine forceps with one palp exposed, then cutting
palpal sclerites with a fine scissors under a dissecting
microscope (Fig. 4). We made two types of cut: both the
conductor tip and the conductor hook of one palp were cut
near the tip of the conductor lobe (Fig. 4d); or the conductor
tip was cut leaving the hook intact (Fig. 4b). The tip of the
male’s intromittent organ (the embolus) (Fig. 4c) was enclosed
in a slot in the conductor tip, basal to the tip of the lobe; it was
thus not affected by cuts at the level of the hook, and little
affected by more basal cuts. No fluid was seen to leak from
these injuries, either when the cuts were made or subsequently
during copulation. Incidental contact with the sclerites during
these operations revealed that the tip of the conductor was
flexible and bent easily when contacted; the hook, in contrast,
was more rigid and bent little if at all.
We left the male’s other palp intact as a control. Thus, in
contrast to other well-known tests of the effects of experi-
mental modifications of male morphology on female respon-
ses (e.g. Andersson 1982; Moller 1988; Basolo 1990), we
controlled at least partially for the possibility that modifica-
tion of the male’s morphology affected him in additional ways
(e.g., his courtship behavior) that could affect his reproductive
success. The asymmetric nature of some plugs (e.g., Fig. lb)
meant, however, that the conditions encountered by the male’s
two palps were not always identical (see Discussion). The
plugs in all plugged females that were mated to males with
modified palps were white and apparently hard. Nearly all
operated males were observed copulating with only one
female; one male was observed with one female with a plug
and another female that was virgin.
We checked insemination success in matings with virgin
females by dissecting the epigynum and the spermathecae
from the female, placing the pair of spermathecae on a
microscope slide in a drop of saline and squashing them under
a coverslip. The areas of the separate sperm masses that were
expelled from each of the membranous first spermathecal
chamber (where sperm are deposited by the male; Eberhard &
Huber 1998a) were compared for the spermatheca that
corresponded to the experimentally modified palp versus the
spermatheca that was inseminated by the control palp. While
the pressure of the squash with the cover slip was not
standardized, the two spermathecae were squashed simulta-
neously and with enough pressure to extrude whatever sperm
288
THE JOURNAL OF ARACHNOLOGY
they contained, so meaningful comparisons of their contents
could be made.
Sperm from the male genitalia, complete plugs, and white
masses that we collected from the male’s palp on the tip of a
fine needle without allowing the material to contact the
epigynum were mounted on microscope slides and stained
with acetocarmine, a DNA stain that colored the sperm nuclei
bright red while leaving the other material relatively transpar-
ent (Fig. 2c). We assessed plug consistency by gently poking
and prying at plugs on the epigyna of live spiders with a small
needle under a dissecting microscope.
We captured plugged females in the field, and obtained
virgin females by allowing field-captured penultimate instar
females to molt in isolation in captivity. We recorded
copulation behavior using a Sanyo VDC-2950 video camera
that was attached to a dissecting microscope and focused
tightly on the female’s epigynum, so that its width occupied
about 75% of the width of the screen. Male palp behavior was
classified in video recordings as follows: flub with a brief snag
on plug or epigynum; flub without a snag; reposition cymbium
on female abdomen; secondary inflation without insertion (of
at least the conductor - see below); secondary inflation with
insertion; palp immobile (motionless for > 1 s); and withdraw
palp from abdomen (usually to change palps).
RESULTS
Origin and composition of genital plugs. — Genital plugs on
the epigyna of mature field-collected females varied in size,
color, surface texture, site, and contents (Fig. 2). Yellowish
plugs (Fig. 2e) were rare (2.5% of 200 females checked in
January 2007), and often lacked sperm (56.7% of 33), but
sometimes contained spheres (Fig. 2a) (39.4% of 33). All
broke easily into flakes when poked with a needle. Silvery-
white plugs (Fig. 2b, d, f, g), in contrast, all contained sperm
(100% of 57) (Fig. 2c), never contained spheres (0% of 57),
were hard, did not break into flakes when poked (although
they occasionally broke into large chunks), and adhered more
tightly to the epigynum than did yellowish plugs. Some field-
collected genital plugs were heterogeneous, possibly the result
of the mixture of new plug material and partially dislodged
previous plugs; mixing of this sort occurred in matings in
captivity. Plugs that were not disturbed by subsequent matings
were long-lasting. Each of ten wild-caught females that were
kept isolated from males for 22 days in captivity had the same
type of plug at the end that she had had when captured.
All sperm inside the palpal bulbs of two males were
encapsulated (right arrow in Fig. 2c). The small masses of
white material deposited by the male on the epigynum and
collected directly from the palps also contained abundant
sperm that were almost exclusively encapsulated (all sperm in
ten masses were encapsulated; all but a single sperm among
many sperm in one other mass were encapsulated). No spheres
were present in the material collected directly from the palps
or the white masses.
We confirmed previous suggestions that females contribute
material to plugs (Eberhard & Huber 1998a; Aisenberg 2009;
Aisenberg & Eberhard 2009) in three ways. Direct observa-
tions of copulating pairs under the dissecting microscope
showed, in a few cases in which visibility was good, that liquid
welled up into the atrium from inside the female’s insemination
duct during copulation, replicating previous observations
(Eberhard & Huber 1998a). This liquid appeared to cause the
white masses from the male to dissolve or disperse, forming a I
silvery-white or transparent plug. In two cases, a plug that was J
composed of both new material and parts of a previous i
plug that was not completely dislodged apparently hardened f
rapidly and blocked further insertion attempts; but more often |
the male easily penetrated the apparently liquid plug repeatedly
during copulation. Some females may have also added liquid i
soon after copulation ended and the spiders separated, as the ;
material on the epigynum generally acquired a more liquid i
appearance following the end of copulation. When no liquid
emerged from the interior of the female during copulation, as |
was common in copulations with virgin females in captivity |
(Eberhard & Huber 1998a; Aisenberg & Eberhard 2009), the J
male removed nearly all or (more often) all of the white masses '
that he deposited; the small masses adhered to his palps during ;
subsequent insertions, and were withdrawn adhering to them
and then fell or were lost. i
Plug composition gave a second indication of active female
participation in the formation of both yellow and white plugs. ;;
Of 57 white plugs, 18 contained multiple decapsulated sperm ;
(left arrow in Fig. 2c). Because sperm in the spermatheca 1
become decapsulated following insemination (Eberhard & I
Huber 1998a), while all or nearly all of the sperm in the male’s I
genitalia prior to copulation and in the white mass that he i
deposited on the female epigynum were encapsulated (above), \
the abundant decapsulated sperm in these plugs suggest that i
the plugs contained material from the female, probably from f
her spermatheca. Yellow plugs, on the other hand, are !
probably often produced by only the female; 56.7% of 33 |:
contained no sperm at all. In contrast, all material we collected '
from male palps, as well as material seen in sections of the i|
distal portions of the sperm ducts inside intact palps j
(Eberhard & Huber 1998a) contained numerous sperm (all [;
of which were encapsulated). j
Finally, the sites of some small plugs that did not cover the
entire central cavity were consistent with female contributions, j:
They were along the sides of the cavity or at its anterior-lateral :
corners, and covered the lower rather than the more salient f
portions of the epigynum (Fig. 2, d f, g); these are sites where ''
liquid ejected from the insemination ducts would be expected [
to first accumulate. This evidence does not clarify which sex i
produced the plug substance because male contributions could
not be ruled out, but they are compatible with female
participation. t
Copulations that fail to result in plugs may be common in ;
the field. Of 64 females collected with no plugs, 82.8% i
nevertheless had sperm in their spermathecae. Plug removal by j
the female with her legs could not be ruled out in these cases,
but only infrequent removal is seen in captive females (above) i
so this is probably not the sole explanation. Field populations
of L. mariana showed strong seasonal peaks of abundance, ;
and unplugged females were more common in the field early in '
population peaks than later (Mendez 2002).
Plug removal — Intact males attempting to copulate with a I'
female with a white plug were only sometimes (68% of 28 !
pairings) able to dislodge it enough to allow insertion of the ;
conductor into at least the outer portion of the insemination :
duct on at least one side of the epigynum (“plug removal” f
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
289
hereafter) (in these and other “insertions” described below,
direct determination of whether deeper penetration by the
embolus occurred was not possible, because the tip of the
conductor was out of sight). Plugs were dislodged by the palps
in three different ways. In each case removal occurred after the
palp had “snagged” against the plug (its movement was
interrupted at least briefly by contact with the plug). In 21
pairs, the mechanism of removal was determined: pulling or
prying the plug away as a single piece from the epigynum
(14%); breaking the plug and then either prying away the
pieces or penetrating past them (33%); and injecting material
under the plug and then pulling it off as a unit (53%). In
pulling a plug off as a unit, the conductor tip or hook scraped
across the surface of the epigynum, snagged the plug, and then
pulled or pried it free. No material emerged from the palp
during these movements. In perforating or inserting the tip of
his palp through a crack in the plug, the male apparently
drove the conductor tip toward or into the insemination duct.
Some broken pieces of these plugs were pulled from the
epigynum during subsequent inflations. In removing a plug by
injecting material under it, the conductor tip and probably the
hook (it was not possible to resolve this detail in direct
observations) penetrated through the plug, but did not appear
to enter the insemination duct. The palp ejected materia! that
accumulated between the plug and the surface of the epigynum
and broke the plug free from the epigynum; it was then pulled
away during subsequent inflations. We did not discern differ-
ences in the movements of the male’s genitalia that seemed to be
specially designed to utilize these different mechanisms.
In some cases, when the plug consisted of more than one
mass or was broken into pieces but not all the pieces were
removed, the male nevertheless succeeded in inserting one or
both of his palps into at least the entrance of the female’s
insemination ducts. In some video sequences it was clear that
the conductor tip was bent back sharply as it scraped across
the surface of the plug, suggesting that the more rigid hook
was more effective than the conductor tip in applying force to
the plug. In all copulations in which a plug was removed the
male subsequently deposited new plug material.
The basic movements of the palp before and after the plug was
dislodged were compared in ten intact males that were paired
with females with white plugs. Cymbium placement, and primary
and secondary basal hematodochal expansions that swung the
conductor tip and hook across the epigynum were at least
qualitatively similar before and after the plug was dislodged.
Effects of experimental modifications on plug removal and
sperm transfer^ — The frequency of plug removal was only
barely significantly reduced when both the hook and the
conductor tip of one palp were removed compared with intact
males (41% of 17 pairs) {P = 0.04 with one-tailed there
was no significant reduction when only the conductor tip was
removed (52% of 21 pairs (P = 0.27 with x“)- Comparisons
between the modified and unmodified palps of the same male
gave more dramatic differences in some respects. Of seven
cases in which a plug was broken by a male that had lost both
hook and conductor tip, all breaks were produced by the
intact rather than the modified palp (x^ = 7.0, df = 1, P =
.008); in contrast, of 20 cases in which the plug was broken
when the male had lost only the conductor tip, half were
produced by the intact palp and half by the modified palp. Of
five cases in which a plug was removed as a unit from both
sides of the epigynum at once in experiments in which both the
hook and the conductor tip were removed, the trend was in the
expected direction: the intact palp removed the plug in four of
them (x^ = 1.8, df = 1, one-tailed P = 0.09). Summing the two
modification experiments, the plug was dislodged as a unit by
the intact palp in seven of eight cases (x^ = 4.50, df = 1, one
tailed P = 0.017).
In contrast, both modified and control palps were effective
once a plug was broken. When the plug was broken and at
least one piece was removed, the intact palp removed a piece
of the plug on its side of the epigynum in eight cases and the
modified palp in seven. The frequency with which a palp
snagged the plug at least once was not altered (59% for
palp lacking both the hook and the conductor tip, 76% for
palp lacking only the conductor tip, 71% for the intact palp).
Insemination of virgin females was reduced when the palps
were modified. The spermatheca on the side into which the
intact palp v/as inserted (the “control” spermatheca) was full in
all 19 females that were dissected after being mated to males
with both conductor tip and hook removed, while the
“experimental” spermatheca (into which the modified palp
was inserted) was uninflated and apparently empty of sperm in
53% of these females (x^ = 13.6, df = 1, P = 0.0002, comparing
empty and non-empty spermathecae). The control spermatheca
was more full than the experimental in 17 (90%) of these females
(X^ = 13.5, df = 1, P = 0.00024). Corresponding data when
only the conductor tip was removed were 11 of 1 1 control
spermathecae full, and 64% of the experimental spermathecae
not inflated (x^ = 10.3, df = 1, P = 0.0014, comparing empty
and non-empty spermathecae). The control spemathecae
contained a greater amount of sperm than the experimental
spermatheca in nine of 11 (82%) cases (x“ = 4.45, df = 1,
P = 0.035). The differences in the frequency of uninflated
spermathcae between the two experimental treatments with
respect to the control spermathecae were not significant (P =
0.71 with a two-tailed Fisher Exact Test).
The total durations of attempts to intromit (including both
primary and secondary inflations) in 39 matings with modified
males were not significantly shorter than in 29 matings with
intact males {P = 0.39 with Wilcoxon/Kruskal Wallis Rank
Sums Test). The total numbers of primary inflations (with and
without subsequent secondary inflations) of control and
modified palp were nearly equal in 37 copulations (2056
inflations by control palps, 2098 by modified palps; respective
means = 69.4 ± 59.3 and 69.3 ± 58.5; P — 0.92 with Mann-
Whitney U Test). The proportion of fiiibs in which control
and modified palps snagged at least briefly on the plug or the
epigynum also did not differ (respective means = 55 ± 34%
and 58 ± 34%; P = 0.99 with Mann-Whitney U Test).
The female pushed the male’s palp away from her genital
opening with her legs in two pairs in which the male lacked
both conductor tip and hook, but also pushed the male’s palp
away in two matings with intact males; in one additional case,
the female pushed the plug material out of her epigynum with
her leg.
DISCUSSION
Some genital plugs impeded subsequent mating attempts,
and such exclusion presumably benefits the male that made
290
THE JOURNAL OF ARACHNOLOGY
the plug. Females also participated actively in the formation of
successful plugs, so they presumably also benefit, but their
benefits are less clear. One possible female benefit is biasing
the paternity of her offspring in favor of males with certain
traits (cryptic female choice). By helping some males but not
others to form a plug, the female could favor paternity for
subsequent males better able to remove plugs. Other female
behaviors, such as pushing the male’s palp or plug material
from her epigynum with her tarsus, may also influence
paternity. It is not known in most of these cases, however,
whether these cooperative or resistant processes of the female
are biased toward males with certain traits. An exception is the
association between larger numbers and durations of bursts of
one type of male copulatory courtship (gentle pushing with his
legs on those of the female) and a greater frequency of plug
production (Aisenberg & Eberhard 2009). Thus cryptic choice
involving plug production and removal is feasible, but so far
strong support has been demonstrated only with respect to
male leg pushing.
Females also apparently occasionally formed some epigynal
plugs without male participation. These yellowish and orange
plugs crumbled easily when poked with a pin, and it seems
very unlikely that they could exclude forceful intromission
attempts by subsequent males. Presumably they have some
other, as yet undetermined function.
Despite the limited mobility of genital sclerites in the male
palpal bulb and their inability to provide the male with
sensory feedback, male L. mariana frequently penetrated or
dislodged even hard, firmly-attached epigynal plugs. They
were also able to insert their genitalia at least in the entrance
of the insemination duct, even when the contours of the
epigynal surface were substantially altered by remaining pieces
of plugs. The male’s ability to adjust to striking variations in
female morphology contrasts strongly with the tight mechan-
ical fit between male and female morphology that is typical of
many other spiders (Gering 1953; Grasshoff 1973; Huber
1995; Eberhard & Huber 1998b, 2010). The relative simplicity
of the morphology of the male genitalia of Leiicaiige and other
tetragnathids is apparently derived (Griswold et al. 1998);
perhaps this simplicity (especially of the relatively small
fraction of the Leucaiige palp that physically contacts the
female) increases this ability to adjust. Similar flexibility, in the
form of an ability to inseminate both sides of the female with a
single palp, has been demonstrated in two other, distantly
related spiders (Costa et al. 2000; Knoflach & van Harten
2000), one which also has a very simple palp design.
Tetragnathid spiders have changed the sides of the female
that are inseminated by the male palps (Huber & Senglet
1997), also suggesting fiexibility at some point in their
evolutionary history.
Male genital movements in a species like L. mariana may be
under two types of selection — to couple mechanically with the
female genitalia in order to inseminate (and perhaps stimulate)
her, and to remove plugs that impede such coupling.
Nevertheless, male L. mariana used the same or similar basic
genitalic movements in copulations with plugged and un-
plugged females. The relative frequencies of different types of
palp movement changed, but it was uncertain whether these
changes were simply consequences of greater difficulty in
mechanically engaging the palp with the epigynum when it was
plugged, or the changes in male behavioral tactics were
designed to remove plugs. Our behavioral categorizations were ■
only general, however, and more detailed observations might
reveal differences. It is at least possible that a male could sense
the presence of a plug. The more frequent withdrawal of the :
palpal bulb following a flub seen by Eberhard & Huber ^
(1998a) suggests that a male obtains enough sensory feedback ''
from his palps to sense whether mechanical coupling has
occurred. Males of some other spiders appear to use their i
palps to search for the female’s genitalic openings (Huber ■
1995), also implying some sensory feedback. |
The conductor hook may be especially important for plug |
removal. Its rigidity combined with its hooked design
probably improves its ability to snag and pull or pry off
plugs, and perhaps also to perforate them. The results of j
copulations when the hook was experimentally removed,
however, showed only a weak trend toward less frequent plug 1
removal. The plugs in L. mariana vary in many ways, however, |
that could affect removal, including composition, size, the J
portion of the epigynum that is covered, left-right asymmetry, i'
and the roughness of the outer surface; none of these traits was '|
standardized in these experiments. Thus even in comparisons i
between the intact and modified palps of the same male, the
experimental results can at best be only suggestive. Our ability !
to determine whether it was the modified or unmodified palp i|
that originally dislodged the plug may also have been '
imperfect. Many plugs consisted of a mass of material that 1
extended to both sides of the epigynum, and it was not always
possible to eliminate the possibility that a minor, difficult to 1
perceive preliminary dislodgement with one palp could have
led to a subsequent removal by the other. In sum, the intra- '
male differences observed in plug removal by intact and
modified palps are compatible with the hypothesis that the ;
hook functions to remove plugs, but are not conclusive. !
The fiexibility of the conductor tip makes it poorly designed
to remove plugs by hooking and prying, but well designed to j
slip along the curved external wall of the epigynum and of the ^
insemination duct. We speculate that it may facilitate deeper i
intromission by the embolus, slipping between the plug and
the epigynum wall to inject material below the plug, allowing '
the male to dislodge the plug as a unit. This facilitation of ;
embolus insertion could explain its positive effects on sperm I,
transfer documented here. Our experimental modifications of '
palpal morphology were crude, however, and cannot illumi-
nate the functional significance of details of their forms. [
Details of the forms of both hooks and conductor tips vary
interspecifically in Leucauge. Hooks that are similar in shape :
to that of L. mariana occur in L. veinista (Walckenaer 1841)
(Levi 1980), L. wiilingensis Song & Zhu 1992 (Song & Zhu
1992), and L. argentata (O.P. -Cambridge 1869) (Chrysanthus |:
1975). In contrast, the hooks have quite different forms in L.
decorata (Blackwall 1864) (Chrysanthus 1975; Tanikawa 1990) f
and L. tessellata (Thorell 1887) (= termistica) (Song & Zhu 'i
1992), while conductor hooks are missing in still others, such
as Opadometa ( = Leucauge) grata (Guerin 1838) (Chrysanthus
1963), L. ( — Plesiometa) argyra (Walckenaer 1841) (Barrantes
et al. 2013), and possibly Tylorida (= Leucauge) mornensis
(Benoit 1978) (Benoit 1978). Epigynal plugs occur in at least ^
one of the species (L. argyra) in which the conductor hook is '
missing (Barrantes et al. 2013). The genus Leucauge has '
MENDEZ & EBERHARD— REMOVAL OE PLUGS BY MALE GENITALIA
291
apparently never been revised, and no phylogeny is available
which could clarify the order in which different forms and
functions for the hook and conductor tip evolved. It seems
likely that the hook was favored by sexual selection, but the
data do not permit discrimination among possible (non-
exclusive) types of selection such as sperm competition, cryptic
female choice, or sexually antagonistic coevolution.
This is to our knowledge the first experimental demonstra-
tion of effects on plug removal for any particular male
genitalic structure, and also the first demonstration of multiple
functions for genitalic structures and the behavior patterns
which they execute. The evolutionary interactions between
male and female genitalia in Leucauge are obviously complex
and merit further study.
ACKNOWLEDGMENTS
We thank Kenji Nishida for photographs, Maribelle Vargas
for help producing SEM images, and Anita Aisenberg, Phil
Taylor, Bernhard Huber, and an anonymous reviewer for
comments on previous drafts. VM was supported by a Short
Term Fellowship from the Smithsonian Tropical Research
Institute; WGE was supported by STRI and the Universidad
de Costa Rica.
LITERATURE CITED
Aisenberg, A. 2009. Male performance and body size affect female
re-mating occurrence in the orb web spider Leucauge luariana
(Araneae, Tetragnathidae). Ethology 115:1127-1136.
Aisenberg, A. & G. Barrantes. 2011. Sexual behavior, cannibalism,
and mating plugs as sticky traps in the orb weaver spider Leucauge
argyra (Tetragnathidae). Naturwissenschaften 98:605-613.
Aisenberg, A. & W.G. Eberhard. 2009. Possible cryptic female choice
in a spider: female cooperation in making a copulatory plug
depends on male copulatory courtship. Behavioral Ecology
20:1236-1241.
Andersson, M. 1982. Female choice selects for extreme tail length in a
widowbird. Nature 299:818-820.
Arnqvist, G. & L. Rowe. 2005. Sexual conflict. Princeton University
Press, Princeton, New Jersey.
Barrantes, G., A. Aisenberg & W.G. Eberhard. 2013. Functional
aspects of genital differences in Leucauge argyra and L. mariana
(Araneae: Tetragnathidae). Journal of Arachnology 41:59-69.
Basolo, A.L. 1990. Female preference predates the evolution of the
sword in swordtail fish. Science 250:808-810.
Benoit. P.L.G. 1978. Contributions a I’etude de la faune terrestre des
iles granitiques de farchipel des Sechelles (Mission P. L. G. Benoit
- J. J. Van Mol 1972) Tetragnathidae et Araneidae-Nephilinae.
Revue Zoologique Africaine 92:663-674.
Birkhead, T.R. & A.P. Moller. 1998. Sperm competition and sexual
selection. Academic Press, New York, New York.
Brown, S.C. 1985. Mating behavior of the golden-orb weaving spider,
Nephila clavipes. II. Sperm capacitation, sperm competition and
fecundity. Journal of Comparative Psychology 99:167-175.
Chrysanthus, Fr. 1963. Spiders from South New Guinea V. Nova
Guinea, Zoology 24:727-750.
Chrysanthus, Fr. 1975. Further notes on the spiders of New Guinea II
(Araneae, Tetragnathidae, Theridiidae). Zoologische Verhandelin-
gen 140:1-50.
Costa, F.G., F. Perez-Miles & S. Corte. 2000. Which spermatheca is
inseminated by each palp in Theraphosidae spiders? A study of
Oligoxystre argeutinensis (Ischnocolinae). Journal of Arachnology
28:131-132.
Danielson-Frangois, A.M. & T.C. Bukowski. 2005. Female mating
history influences copulation behavior but not sperm release in the
orb-weaving spider Tetragnatha versicolor (Araneae, Tetragnathi-
dae). Journal of Insect Behavior 18:131-148.
Eberhard, W.G. 1996. Female control: sexual selection by cryptic
female choice. Princeton Univ. Press, Princeton, New Jersey.
Eberhard, W.G. 2010. Evolution of genitalia: theories, evidence, and
new directions. Genetica 138:5-18.
Eberhard, W.G. & B.A. Huber. 1998a. Courtship, copulation, and
sperm transfer in Leucauge mariana (Araneae, Tetragnathidae)
with implications for higher classification. Journal of Arachnology
26:342-368.
Eberhard, W.G. & B.A. Huber. 1998b. Possible links between
embryology, lack of innervation, and the evolution of male genitalia
in spiders. Bulletin of the British Arachnological Society 1 1:73-80.
Eberhard, W.G. & B. Huber. 2010. Spider genitalia. Pp. 249-284. In
The evolution of primary sexual characters in animals. (J. Leonard
& A. Cordoba-Aguilar, eds.). Oxford University Press, New York,
New York.
Eberhard, W.G., S. Guzman-Gomez & K.M. Catley. 1993. Correla-
tion between spermathecal morphology and mating systems in
Spiders. Biological Journal of the Linnean Society 50:197-209.
Gering. R.L. 1953. Structure and function of some American agelenid
spiders. Smithsonian Miscellaneous Collections 121(4):l-84.
Grasshoff, M. 1973. Konstruktions-und Funktionanalyse an Kopu-
lationsorganen einiger Radnetzspinnen. Senckenbergischen Nat-
urforschenden Gesellschaft 24:129-151.
Griswold, C.E., J.A. Coddington, G. Hormiga & N. Scharff. 1998.
Phylogeny of the orb-web building spiders (Araneae, Orbiculariae:
Deinopoidea, Araneoidea). Zoological Journal of the Linnean
Society 123:1-99.
Hosken, D., P. Stockley & T. Tregenza. 2009. Monogamy and the
battle of the sexes. Annual Review of Entomology 54:361-378.
Huber, B.A. 1995. Genital morphology and copulatory mechanics
in Anyphaena accentuata (Anyphaenidae) and Cliibiona pallidula
(Clubionidae: Araneae). Journal of Zoology, London 235:689-702.
Huber, B.A. & A. Senglet. 1997. Copulation with contralateral
insertion in entelegyne spiders (Araneae: Entelegynae: Tetragnathi-
dae). Netherlands Journal of Zoology 47:99-102.
In den Bosch, H.A.J. 1994. First record of mating plugs in lizards.
Amphibia-Reptilia 15:89-93.
Knoflach, B. 1997. Zur Taxonomic, Verbreitung und Sexualbiologie
von Theridion adrianopoli Drensky (Arachnida: Araneae, Theridi-
idae). Berichte des naturwissenschaftlichen-medizinischen Verein
Innsbruck 84:133-148.
Knoflach, B. 1998. Mating in Theridion variana Hahn and related
species (Araneae: Theridiidae). Journal of Natural History
32:545-604.
Knoflach, B. & A. van Harten. 2000. Palpal loss, single palp
copulation and obligatory mate consumption in Tidarren cuneola-
tuin (Tullgren, 1910) (Araneae, Theridiidae). Journal of Natural
History 34:1639-1659.
Levi, H.W. 1980. The orb-weaver genus Mecynogea, the subfamily
Metinae and the genera Pachygnatlia, Glenognatha and Azilia of
the subfamily Tetragnathinae North of Mexico (Araneae: Aranei-
dae). Bulletin of the Museum of Comparative Zoology 149:1-74.
Markow, T. & P.F. Ankney. 1988. Insemination reaction in
Drosophila', found in species whose males contribute material to
oocytes before fertilization. Evolution 42:1097-1 101.
Masumoto, T. 1993. The effect of the copulatory plug in the funnel-
web spider, Agelena linihata (Araneae: Agelenidae). Journal of
Arachnology 21:55-59.
Matsumoto, K. & N. Suzuki. 1992. Effectiveness of the mating plug
in Atrophaneura alcinous (Lepidoptera: Papilionidae). Behavioral
Ecology and Sociobiology 30:157-163.
Mendez, V. 2002. Comportamiento sexual y dinamica de poblacion
en Leucauge marina (Araneae: Tetragnathidae). Msc. Thesis,
Universidad de Costa Rica.
292
THE JOURNAL OF ARACHNOLOGY i
Milligan, S.R. 1979. The copulatory pattern of the Bank vole
(Clethriu)wniys glareolus) and speculation on the role of penile
spines. Journal of Zoology, London 188:279-283.
Moller, A.P. 1988. Female choice selects for male sexual tail
ornaments in the monogamous swallow. Nature 332:640-642.
Parker, G.A. 1970. Sperm competition and its evolutionary conse-
quences in the insects. Biological Reviews 45:525-567.
Platnick, N. 2013. The world spider catalog, version 14.0. American
Museum of Natural History. Online at http://research.amnh.org/
entomology/spiders/catalogS 1 -87/index. html
Simmons, L.W. 2000. Sperm competition and its evolutionary
consequences in the insects. Princeton University Press, Princeton,
New Jersey.
Smith, R.L. 1984. Sperm competition and the evolution of animal
mating systems. Academic Press, New York, New York.
Song, D. & M. Zhu. 1992. Notes on six species of the genus Leucauge
(Araneae: Tetragnathidae) of China. Sinozoology 9:111-117.
Tanikawa, A. 1990. Two newly recorded spiders, Tetragnatha
cluiuliodus (Thorell, 1890) and Leucauge decorala (Blackwall,
1864) (Araneae: Tetragnathidae) from Japan. Atypus 95:1-12.
Thornhill, R. & J. Alcock. 1983. The evolution of insect mating
systems. Harvard University Press, Cambridge, Massachusetts.
Uhl, G., S.H. Nessler & J.M. Schneider. 2010. Securing paternity in
spiders? A review on occurrence and effects of mating plugs and
male genital mutiliation. Genetica 138:75-104.
Watson, P.J. 1991. Multiple paternity as genetic bet-hedging in female
Sierra dome spiders, Linyphia litigiosa (Linyphiidae). Animal
Behavior 41:343-360.
Wiley, R.H. & J. Posten. 1996. Indirect mate choice, competition for
mates, and coevolution of the sexes. Evolution 50:1371-1381.
Manuscript received 14 September 2013, revised 13 June 2014.
2014. The Journal of Arachnology 42:293-298
Burrow structure and microhabitat characteristics of Nesiergus insulanm (Araneae: Theraphosidae) from
Fregate Island, Seychelles
Gregory Cannmg’, Brian K. Reilly* and Ansie S. Dippenaar-Schoeman^: 'Department of Nature Conservation, Tshwane
University of Technology, P. Bag X680, Pretoria OO'Ol, South Africa. E-mail: gregcan@absamail.co.za; -Agricultural
Research Council - Plant Protection Research Institute, P. Bag X134, Queenswood, 0121 Pretoria, South Africa &
Department of Entomology and Zoology, University of Pretoria, 0001, Pretoria, South Africa
Abstract. The burrow structure and microhabitat variables of the little known theraphosid Nesiergus insidanus Simon
1903 were determined on Fregate Island, Seychelles. The species constructed burrows in fossorial substrates, including
rocks, leaf litter and bare soil as well as on the trunks of decaying trees, both recumbent and standing. The majority of
burrows were predominantly found in sandy loam soil with partial protection from the sun. The density of burrows was
determined to be weakly positively correlated to soil and substrate type and strongly negatively correlated to degree of
exposure to the sun. The pH of the soil in which burrows are found was not significantly related to burrow sites, and
variability in burrow structure was revealed. Burrow aggregations vary from single burrows to aggregations exceeding 100,
distributed randomly.
Keywords: Tarantula, habitat, generalist
Little is known of the theraphosids of the Seychelles
archipelago and published reports consist of little more than
taxonomic descriptions and brief observations of their natural
history (Simon 1903; Hirst 1911; Benoit 1978; Guadanucci &
Gallon 2008; Saaristo 2010). More generally, despite numer-
ous recently published papers on the behavior of tarantulas
(Kotzman 1990; Fernandez-Montraveta & Ortega 1991; Costa
& Perez-Miles 1998, 2002; Quirici & Costa 2005), the biology
and ecology of many tarantulas is poorly known (Carter 1997;
Yanez et al. 1999; Machkour M’Rabet et al. 2005).
Three species of Nesiergus are recognized and are likely
endemic to Seychelles. Nesiergus insulanus Simon 1903 is the
type species for the genus and is known from Fregate and
L’ilot Fregate Islands (Canning et al. 2013), with anecdotal
and photographic evidence from naturalists on Cousine Island
indicating that it may be more widely distributed than
currently recognized. Nesiergus halophilus Benoit 1978 is
known from Fregate, Recife, Silhouette and Curieuse;
Nesiergus gardineri Hirst 1911 is known from Mahe, Felicite,
Praslin, Silhouette and The Sisters (Guadanucci & Gallon
2008).
The burrows of these spiders, as with other members of the
family, are used for protection against predators and parasites,
for the protection of eggs and developing spiderlings,
protection during ecdysis, for the capture of prey and for
the control of thermal stress (Dippenaar-Schoeman 2002).
Studies of habitat use by spiders have found that there are
strong associations with abiotic factors such as structural
features, temperature, wind, rain and humidity. Temperature
and humidity have been shown to be critical factors
influencing microhabitat selection for a number of spider
species (Norgaard 1951; Williams 1962; Cherrett 1964;
Sevacherian & Lowrie 1972; Riechert & Tracy 1975) and
similar associations have been found with areas of high prey
availability (Riechert & Gillespie 1986). Spiders are known to
select high quality habitats (Morais-Filho & Romero 2008),
and the structure of the burrows and the environmental
parameters necessary for their construction must be known to
provide a better understanding of a poorly known species, its
role in the community, and even as a potential indicator of
habitat change.
METHODS
Study site, — Fregate Island (04° 35' 19"S, 55° 56' 55"E) is
the most isolated of the Seychelles granitic islands (Ferguson
& Pearce-Kelly 2004) and is situated 55 km east of Mahe
Island (Skerrett et al. 2001). It is 219 ha in area, has an altitude
of 125 m at its highest point and overlies oceanic basalt.
Phosphatized granite and phosphate-cemented sandstone are
associated with guano deposits on the plateau. The low-lying
areas of the island were marshy in the past and are now
characterized by sediments of fine clay and quartz (Braithwaite
1984). However, these marshy areas have been replaced, to the
detriment of many species, by cultivated fields, gardens and a
marina development.
Field methods. — Field sampling sites were determined by
initially conducting a pilot study. The island was stratified into
habitat types based on the vegetation map of Henriette &
Rocamora (2009). Vegetation types were clearly distinguish-
able as a result of large-scale anthropogenically-induced
vegetation changes. Ground truthing determined the precise
location of these various habitats and in each described
habitat an extensive search was conducted on three separate
occasions. In each habitat type, we extensively searched leaf
litter, overturned rocks and logs and searched all other litter to
find burrows. This allowed us to determine the habitat types in
which spider burrows occurred. These sites were exhaustively
searched to ensure that burrows or signs of spiders were not
missed. The habitat types that were found in the pilot study to
support these spiders were the following (with number of
sample sites per habitat type determined by random selection
in parentheses): Coconut-dominated woodland (8), Ficus
benghaknsis (3), Mixed exotic woodland (7), Native woodland
(6), Replanted native woodland (6), Hotel area native planted
(4), Exotic scrub (8), Grassland (3) Coconut woodland planted
with natives (3). Those habitats in which no burrows or other
293
294
THE JOURNAL OF ARACHNOLOGY
signs of spiders were found included bamboo, coconut
plantations with grassland, cultivated areas, orchards and
Scaevola; these sites were not sampled further.
Subsequent to the pilot study, the island was stratified into
numbered quadrats, each measuring 100 X 100 m. From these
quadrats, a random integer generator (www.random.org) was
used to obtain random sample quadrats in each vegetation
type in which spiders were found in the pilot study, ensuring
that approximately 25% of the island was represented.
Sampling sites within these quadrats consisted of a 100 m x
2 m transect at right angles to the contour. Those vegetation
types in which no burrows were found in the pilot study were
excluded from the selection of sampling quadrats. Forty-eight
quadrats were generated in this way and sampled, of which 38
sites contained burrow aggregations. We define an aggrega-
tion as a cluster of burrows within a distance of less than one
meter from one another.
Burrow structure: Burrows were examined at the 38 sample
sites. At each sample site, an individual spider was extracted
from a burrow to confirm the identification of the species.
This was completed after data from the particular burrow had
been quantified. At each sample site in which burrow
aggregations were found, we measured the diameter of the
largest burrow and determined the orientation of all burrows.
We noted whether each burrow’s entrance was flush with the
ground and whether debris was incorporated in the burrow
entrance. The depth of the burrow could not be accurately
determined without digging them up due to their varying
shapes. To determine dimension and shape, five burrows were
randomly selected, spiders were extracted and Plaster of Paris
was poured down burrows to create an impression of the
burrow. The volume of each of these burrows was determined
by immersing the casts in a measuring cylinder of water and
measuring the displacement. The dimensions and shape of
burrows were also established by actively seeking burrows
adjacent to rocks or other objects, such as coconuts or large
fallen branches. At ten of these sites, objects were removed to
expose a cross section of the burrow. These burrows were
closely examined, measured and photographed to confirm
shape, number of chambers, number of spiders within each
burrow, use of silk and dimensions.
Microhahitat characteristics: Each sample site was visited in
the early morning, at midday and late afternoon on at least
three separate occasions only on sunny days for a three-month
period to determine the temporal exposure of burrows to the
sun. Burrows were considered to have full protection from the
sun if they were in shade at each visit, partially protected if
they were in sun on at least one visit and having no protection
if they were exposed to the sun on each visit. We recorded a
description of the habitat surrounding the burrow aggrega-
tion. The substrate was characterized as leaf litter, bare soil,
woody vegetation, grass or other. Leaf litter (Fig. la)
consisted of soil substrate covered with a complete layer of
leaf litter with minimal or no soil exposed. The leaf litter
varied from a single layer of leaves covering the soil to three to
four layers of leaves. Bare soil (Fig. lb) consisted of a
substrate of exposed soil, with leaves sporadically scattered
over the substrate, but not to the extent that they entirely
covered the substrate. Woody vegetation represented burrow
sites where the burrow had been constructed in living plant
material such as roots. Grass (Fig. Ic) consisted of the
substrate being covered in a layer of living grass. Other i
represented burrows were constructed in rocks (Fig. Id), coral :
remnants or decaying tree trunks (Figs, le, f). Ij
Ambient and burrow temperature and humidity were |
recorded using a thermistor digital instrument with penetra-
tion probe. Soil characteristics were determined by collecting j|
three soil samples of approximately 500 grams each from each
site and the basic soil texture, pH, soil type and soil moisture j!
were determined. Soil texture was determined by using the 't
United States Department of Agriculture soil triangle (online j;
at http://www.nrcs.usda.gov/wps/portaI/iircs/detail/soils/edu/ |
?cid = nrcsl42p2_05431 1). Soil moisture was determined by i
using the soil moisture content standard test method of the ;
Australian Department of Sustainable Natural Resources. j
Each soil sample was weighed, dried in an oven at a constant >
temperature of 110 °C for 4 hours and then weighed again
after cooling. The moisture content was determined as weights ■
compared before and after drying expressed as a percentage.
Soil sampling was conducted in the dry season to discount the i'
influence of rain on moisture content. The pH of the soil i
samples was determined with the use of a Bluelab combometer )
calibrated to pH 7.0 before the testing of each soil sample.
Spiders were also observed under captive conditions. r
Twenty females, including four mature specimens, were kept j
in a confined situation in a communal polystyrene box (63 X !j
29.5 X 17 cm) and with a layer of soil 8 cm deep. The top of j;
the box was covered with a glass sheet to prevent escape and i|
for observation purposes. Spiders were provided with fresh i
water daily and food once a week. Burrowing behavior was f
observed under these conditions. |,
Analyses: One-way ANOVA was used to compare the ||
number of burrows found in the sample sites with the ■
microhabitat characteristics to determine whether there were 1
any statistically significant differences. The analyses included
those sample sites in which no burrows were found in the (
habitat types that were found to include burrows in the pilot ^
study. Correlations were used to determine relationships t
between burrow densities and various microhabitat variables. |
Nearest neighbor analysis was adapted for this study to j
determine the patterning of burrows within an aggregation. As 3
the method eliminates the effect of scale, the patterning within 3
the distribution of the burrows in a cluster was determined 3
(Rossbacher 1986). The formula used to determine aggrega- !
tion distribution was Rn = 2d\/n/a where the value of Rn j‘
represents the degree to which an observation departs from a
predicted random distribution and d = the mean distance
between the nearest neighbors, ii = total number of points and 3
a = area under study. Rn ranges between 0 for a clustered |,
distribution, 1.00 for a random distribution and 2.15 for a |1
regular distribution (Clark & Evans 1954). Nearest neighbor '
analysis was used only at sites where there were more than 30 3
burrows in the aggregation (n = 15 sites). A Rayleigh test was 3
used to determine whether the direction of the burrows was
random or non-random. 3
3
RESULTS f
3
Microhabitat characteristics. — The number of burrows m ,|
each sample site varied between habitats from no burrows to [|
134 burrows in aggregations. The mean aggregations and i'
II
CANNING ET AL.— BURROW STRUCTURE OF NESIERGUS INSULANUS
295
Figure la-f. — Substrate types in which burrows of Nesiergus insulamis are found on Fregate Island, Seychelles, a. Leaf litter; b. Bare soil;
c. Grass; d. Rock; e. Tree trunk with arrows indicating position of burrows approximately 1.5 and 1.7 m above ground level; f. Recumbent
rotting log.
densities per square meter combined from sample sites in each
habitat type were as follows: Exotic scrub 8.4 at 0.042/m",
native woodland 36 at 0.1 8/m^, coconut-dominated woodland
11.4 at 0.057/m", Ficus benghalensis 36.5 at 0.1825/m", mixed
exotic woodland 6.5 at 0.01/m", grassland 3.5 at 0.0175/m",
hotel area native planted 15.4 at 0.0775/m", coconut woodland
planted with natives 1.7 at 0.0085/m^ and replanted native
woodland 21 at 0.105/m". Microhabitat variables varied
between sample sites (Table 1) with the mean ambient
temperature found to be 2.13°C higher than the temperature
within the burrows across habitat types. In contrast, the
humidity within the burrows was found to be an average of
9.93% higher than the ambient humidity. Open grassland was
the only habitat in which at least some burrows were found to
be fully exposed to the sun. The mean ambient temperature for
grassland was 2.5° C warmer than the mean across all habitat
types. The mean seasonal change in temperature is in a very
narrow band and this is reflected in the mean temperature
across habitat types.
An ANOVA showed a significant difference in number of
burrows between substrates across sample sites (F3, 32 = 3.42,
P = 0.03) with leaf litter and bare soil being preferred over
other substrates. A follow-up test to determine differences
between these two substrates showed that there is no
significant difference in choice between bare soil and leaf
litter (F|_ jg = 0.09, P = 0.77) as the more frequently used
substrates. Few burrows were found in grass-covered areas
and in the cracks and holes of rocks. Those burrows dug in
bare soil were found among vegetation and often close to
rotting logs that provided protection and a supply of prey in
the form of termites or other invertebrates. There was a
significant difference in soil types in which burrows occurred
(Fi. 64 = 5.66, P <0.0001) with the majority being found in
sandy loam. Protection from full exposure to the sun was
statistically highly significant (Fo, 24 = 1 1.13, F = 0.0003) with
spiders preferring partial protection from the sun. There was a
non-significant correlation between the soil types and the
density of burrows (Spearman Rank correlation, r - 0.167, P
- 0.157), a significant correlation between choice of substrate
and burrow density {r = 0.357, P = 0.013) and a very strong
correlation between protection from the sun and burrow
densities {r = 0.9995, P = 0.001). The soil pH varied
296
THE JOURNAL OF ARACHNOLOGY
Table 1 . — Summary of microhabitat variables across habitat types for burrows of Nesiergus insukmus on Fregate Island. Figures given are the
percentages of the total number of burrows displaying that particular variable for the habitat type. Moisture content, pH and temperature
measurements are from the lowest to the highest recorded measurement at each site in the specific habitat. FB = Ficus benglialensis, CWPWN =
coconut woodland planted with natives, MEW = mixed exotic woodland, ES = exotic scrub, NW = native woodland, RNW = replanted native
woodland, HANP = hotel area nativeplanted, CDW = coconut dominated woodland, GL = grassland.
FB
CWPWN
MEW
ES
NW
RNW
HANP
CDW
GL
Sampling sites (IS)
Wind Protection
3
3
7
8
6
6
4
8
3
none
66
50
partial
33
33
57.1
25
80
50
37.5
50
full
66
100
42.8
75
20
50
62.5
Sun Exposure
none
33
75
14.2
25
50
partial
100
66
25
85.7
75
100
100
50
50
full
50
Substrate
bare soil
33
33
50
71.4
60
50
37.5
leaf litter
66
33
50
14.2
100
50
37.5
grass
other( vegetation)
33
14.2
40
25
100
Soil Characteristics
silt loam
loam
25
28.5
100
12.5
50
loamy sand
silt
33
33
25
14.2
40
25
sandy loam
33
66
50
42.8
20
62.5
50
sandy
other (rock)
33
20
moisture Content
10-71%
5-6%
6-23%
3-23%
12-27%
1-25%
10-15%
^25%
6-10%
pH
4.2-4.9
6. 1-8.9
5. 7-8.2
3. 7-7. 4
4.9-8. 5
5. 1-8.3
5.2-8.4
5.7-8.9
7.3-8.2
Ambient Temp. (°C)
30.8-32.9
30.4-30.5
27.1-30.4
30.1-34.1
29.9°-31.8°
29.5°-31.5°
31.6°-32.r
29.8°-31.5“
32.9°-33.5°
Burrow Temp. (°C)
28.0-31.2
27.9-29.1
25.7-27.3
27.6-32.3
27,i°-28.7°
27°-30.8°
28.4°-30.4°
26°-29.7°
31.8°-32.2°
considerably between habitat types and between sample sites,
from 3.7 to 8.9 with a mean of 6.45 (UCL = 6.92, LCL =
5.98). A linear regression analysis determined that the
relationship between pH and spider densities was non-
significant (r = 0.9815, P = 0.33) and therefore plays no role
in burrow site selection.
Burrow structure. — Nearest-neighbor analysis showed that
the distribution of burrows within an aggregation was
random, (average Rn = 1.17). These spiders make use of
both fossorial substrates (Figs, la-c) and the trunks of
decaying trees. The trunks of rotting trees, both standing
(Fig. le) and recumbent (Fig. If) were used. The decompos-
ing wood likely provides a regular supply of food to prey on
such as termites and other invertebrates as well as providing a
stable microclimate. Hollows and cracks in rocks were
exploited on occasion (Fig. Id). Spiders were also found
under rocks where either a silk-lined depression or a burrow
was constructed.
Captive specimens of N. insulamis were able to excavate
their own retreats and were able to burrow through wood and
roots, despite lacking a rastelluni. When disturbed or if their
burrow was damaged or destroyed, they excavated a new
burrow. Chelicerae were used in loosening the soil and the first
pair of legs was used to pass the soil to the side of the burrow
entrance or under the body where the third and fourth pairs of
legs pushed the soil from the burrow. The first one-third to
one-quarter of the inside of the burrow was lined with silk.
There were no silk mats or trip lines around the burrow
entrance for prey detection. Silk was used in bends in burrows
to support the walls at these bends (Fig. 2).
The majority of the burrow entrances lay flush with the
surface and had no debris, although some debris in the form of
small stones, sticks and millipede droppings were on occasion
attached to the silk around the lip of the burrow. Burrows in
the cracks of rocks were fully constructed of silk with debris,
including feathers, attached along the full length of the
burrow. A single entrance was observed at all burrows. These
entrances were closed with silk with soil attached when the
spider was in the process of ecdysis, incubating, when there
were pre-emergent spiderlings in the maternal burrow, or
under adverse weather conditions, such as during heavy rain.
The entrances were completely camouflaged with soil during
this period.
The largest burrow diameter found at sample sites was
13.59 mm with a mean diameter for all sampled burrows of
6.42 mm. Orientation of the burrow entrance of 116 burrows
in ail habitat types was determined and a Rayleigh test
indicated that there was no particular prevailing orientation of
burrow entrances (Z = 0.282, P = 0.50). Burrow shape was
widely diverse and a single distinguishing shape cannot be
CANNING ET AL.— BURROW STRUCTURE OF NESIERGUS INSULANUS
297
Figure 2. — Burrow of N. insiikmus with resident spider in first
chamber. Arrows indicate use of silk below burrow entrance, at curve
above first chamber and on roof of second chamber.
attributed to this species. Burrows were J-shaped, U-shaped
and V-shaped with variations of these basic profiles.
Variations included additional chambers or shafts. Variations
were sometimes due to an obstruction that the spider could
not burrow through or around and sometimes appeared to be
random. U-shaped variations included burrows recumbent
with an extended burrow entrance. V-shaped burrow varia-
tions included additional horizontal arms or supplementary
arms giving the burrows a Y-shape, and the dimensions of
observed burrows varied widely (Fig. 3). The displacement
volume of the five burrow molds were 22 ml, 41 ml, 53 ml,
10 ml and 7 ml.
DISCUSSION
Nesiergus insukmiis makes use of a number of available
substrate types including soil, tree trunks and cracks in rocks
in which to create burrows. The exploitation of these
substrates indicates adaptability that allows the species to
exploit a wider range of habitats than would be available to
more specialized species. This behavior could be considered an
obligatory adaptation to their occurrence on small and
isolated islands with limited resources, thus restricting their
ability to occupy a more specialized niche.
Machkour M’Rabet et al. (2007) found that densities of the
tarantula Bracliypelma vagans Ausserer 1875 were dependent
on soil type. This study also found significant associations
with soil types, the type of soil apparently being important in
burrow construction because of the possibility of collapse
when these spiders only partially line their burrows with silk.
The variation in burrow structure from simple, single-
chambered structures to fairly complex constructions that
are found in high densities in suitable habitat has also been
recorded in B. vagans (Machkour M’Rabet et al. 2007).
Figure 3. — Burrow shapes of N. msukmiis indicating diverse
shapes, including basic burrow shapes, as well as variations thereof,
with additional chambers and shafts.
The combination of a number of suitable microhabitat
variables appears to be necessary to support a population of
these spiders and where these variables are absent, so too were
the spiders. They were commonly found adjacent to rocks and
decaying logs, as well as on pathways. These logs and rocks as
well as roads and pathways provide ecotones that support
increased biodiversity and productivity (Risser 1995). Arthro-
pods have been found to be greatly innuenced by changes in
temperature and humidity (Cady 1984) and we found that sites
of burrows that were at least partially protected from sun
exposure, thus limiting fluctuations, were preferred over sites
that offered little protection from the elements. Burrows found
in exposed areas were few in number and even these were
offered a degree of protection close to the ground.
The disturbance and alteration of natural habitats and the
introduction of alien plant species is detrimental to the
distribution of the species. Large-scale changes to the native
vegetation on the island limits the opportunity for dispersal to
new habitats and is cause for concern for a species with a
limited distribution. Fregate Island has been severely degraded
and large areas of the island are covered in alien species. In
particular, monospecific stands of coconuts. Cocos nucifera.
cover vast areas of the island, severely reducing available
native habitat. The occurrence of these spiders in such
degraded habitats is limited or absent and is of concern for
the long term welfare of the species. As tarantulas do not
balloon as a means of dispersal (Jankowski-Bell & Horner
1999) and spiderlings do not wander greatly if a suitable patch
is found in which the spiderlings are able to burrow (Cutler &
Guarisco 1995) their dispersal capabilities are reduced. The
restoration of habitat and the creation of corridors between
restored habitat and habitats in which this species is to be
found are essential for the long term viability of the species.
298
THE JOURNAL OF ARACHNOLOGY
LITERATURE CITED
Benoit. P.L.G. 1978. Contributions a I’etude de la faune terrestre des
lies granitiques de Farchipel des Sechelles Araneae Ortliognatha.
Revue de Zoologie et de Botanique Africaines 92:405-420.
Braithwaite, C.J.R. 1984. Geology of the Seychelles. Pp. 17-79. In
Biogeography and Ecology of the Seychelles. (D.R. Stoddart, ed.).
Dr. W. Junk Publishers, The Hague, Netherlands.
Cady, A.B. 1984. Microhabitat selection and locomotor activity of
Schizocosa ocveata (Walckenaer) (Araneae, Lycosidae). Journal of
Arachnology 11:297-307.
Canning, G., B.K. Reilly & A.S. Dippenaar-Schoeman. 2013. First
description of the male of Nesiergus msidcmus (Araneae: Ther-
aphosidae: Ischnocolinae) from the Seychelles archipelago. African
Invertebrates 54:241-244.
Carter, N. 1997. Who’s on CITES and why? Forum of the American
Tarantula Society 6:172-173.
Cherrett, J. 1964. The distribution of spiders on the Moor House
Reserve, Westmoreland. Journal of Animal Ecology 33:27-48.
Clark, P.J. & F.C. Evans. 1954. Distance to nearest neighbour as a
measure of spatial relationships in populations. Ecology 35:
445-452.
Costa, F.G. & F. Perez-Miles. 1998. Behavior, life cycle and webs of
Mecicohothriimi thorelli (Araneae, Mygalomorphae, Mecicobo-
thriidae). Journal of Arachnology 26:317-329.
Costa. F.G. & F. Perez-Miles. 2002. Reproductive biology of
Uruguayan theraphosids (Araneae, Mygalomorphae). Journal of
Arachnology 30:571-587.
Cutler, B. & H. Guarisco. 1995. Dispersal aggregation of Sphodros
fitchi (Araneae, Atypidae). Journal of Arachnology 23:205-206.
Dippenaar-Schoeman, A.S. 2002. Baboon and Trapdoor Spiders of
Southern Africa: An Identification Manual. Agricultural Research
Council, Pretoria, South Africa.
Ferguson, A. & P. Pearce-Kelly. 2004. Management Guidelines for
the Welfare of Zoo Animals. The Fregate Island giant tenebrionid
beetle Polposipus hercideainis. The Federation of Zoological
Gardens of Great Britain and Ireland, United Kingdom.
Fernandez-Montraveta, C. & J. Ortega. 1991. Owner-biased agonistic
behavior in female Lycosa tarentula fasciiventvis (Araneae,
Lycosidae). Journal of Arachnology 19:80-84.
Guadanucci, J.P.L. & R.C. Gallon. 2008. A revision of the spider
genera Chaetopelma Ausserer 1871 and Nesiergus Simon 1903
(Araneae, Theraphosidae, Ischnocolinae). Zootaxa 1753:34-48.
Hirst, S. 1911. The Araneae, Opiliones and Pseudoscorpiones.
Transactions of the Linnean Society of London 14:379-395.
Jankowski-Bell, M.E. & N.V. Horner. 1999. Movement of the male
brown tarantula, Aphonopelma hentzi (Araneae, Theraphosidae),
using radio telemetry. The Journal of Arachnology 27:503-512.
Kotzman, M. 1990. Annual activity patterns of the Australian
tarantula Selenocosmia stirlingi (Araneae, Theraphosidae) in an
arid area. Journal of Arachnology 18:123-130.
Machkour M'Rabet, S., Y. Henaut, R. Rojo & S. Calme. 2005. A not I
so natural history of the tarantula Brachypelma vagans: interaction {
with human activity. Journal of Natural History 39:2515-2523.
Machkour M’Rabet, S.M., Y. Henaut, A. Sepulveda, R. Rojo, S.
Calme & V. Geissen. 2007. Soil preference and burrow structure of f
an endangered tarantula, Brachypelma vagans (Mygalomorphae: i
Theraphosidae). Journal of Natural History 41:1025-1033. I
Morais-Filho, J.C. & G.Q. Romero. 2008. Microhabitat use by '
Peucetia flava (Oxyopidae) on the glandular plant Rhyncanthera
dichotoma (Melastomataceae). Journal of Arachnology 36: il
374-378.
Norgaard, E. 1951. On the ecology of two lycosid spiders (Pirata
piraticus and Lycosa pidlata) from a Danish sphagnum bog. Oikos
3:1-21. ’ 1
Quirici, V. & F.G. Costa. 2005. Seismic communication during
courtship in two burrowing tarantula spiders: an experimental s'
study on Eupcdaestrus weijenberghi and Acanthoscurria sidna. j:
Journal of Arachnology 33:159-166. |:
Riechert, S.E. & R.G. Gillespie. 1986. Habitat choice and utilization j
in the web spinners. Pp. 23-48. In Spiders-Webs, Behavior and J
Evolution. (W.A. Shear, ed.). Stanford University Press, Stanford, jj
California. }
Riechert, S.E. & C. Tracy. 1975. Thermal balance and prey j
availability: Bases for a model relating web-site characteristics to i[
spider reproductive success. Ecology 56:265-284. !|
Risser, P.G. 1995. The status of the science: examining ecotones. i
BioScience 45:318-325. |j
Rossbacher, LA. 1986. Nearest-neighbour analysis: a technique for
quantitative evaluation of polygonal ground patterns. Geografiska |
Annale 68A: 101-105.
Saaristo, M.I. 2010. Araneae. Pp. 8-306. In Arachnida and
Myriapoda of the Seychelles islands. (J. Gerlach & Y. Marusik, |
eds.). Siri Scientific Press, Manchester, United Kingdom.
Sevacherian, V. & D. Lowrie. 1972. Preferred temperatures of two
species of lycosid spiders Pardosa sierra and P. ramulosa. Annals of
the Entomological Society of America 65:111-114.
Simon, E. 1903. Histoire Naturelle des Araignees. Roret, Paris i
2:669-1080. |
Skerrett, A., 1. Bullock & T. Disley. 2001. Birds of Seychelles. I
Christopher Helm Ltd., London. !
Williams, G. 1962. Seasonal and diurnal activity of harvestmen j'
(Phalangida) and spiders (Araneida) in contrasted habitats, t
Journal of Animal Ecology 31:23-42. |
Yanez, M., A. Locht & R. Macias-Ordonez. 1999. Courtship and '
mating behavior of Brachypelma klaasi (Araneae, Theraphosidae). J
Journal of Arachnology 27:165-170. |
Manuscript received 5 August 2013, revised 18 August 2014.
2014. The Journal of Arachnology 42:299-302
Thermal preference of Dysdera crocala C. L. Koch 1838 (Araneae: Dysderidae)
Rita Sepulveda', Andres Taucare-Rios', Claudio Veloso' and Mauricio Canals'-'^--^: 'Departamento de Ciencias Ecologicas,
Faciiltad de Ciencias, Universidad de Chile; E-mail: mcanals@uchile.cl; -Programa de Salud Ambiental, Escuela de
Salud Publica, Facultad de Medicina, Universidad de Chile; -^Departamento de Medicina, Facultad de Medicina,
Universidad de Chile
Abstract. Body temperature is the most important ecophysiological variable affecting all aspects of the performance of
ectotherms. However, thermal preferences and tolerances of spiders have been studied only in 0.1% of spider species.
Knowledge of thermal preferences and tolerances is necessary to describe the ecology of these animals, defining the
preferred foraging sites or preferred shelters and reproductive sites. In this study we report for the first time the preferred
temperature of Dysdera crocata C.L. Koch 1838 in the laboratory. This is an epigean spider of Mediterranean climates with
large temperature fluctuations. The preferred temperature was low: 9.12° ± 5.12 °C, and actively searched. It did not vary
throughout the day.
Keywords: Woodlouse spider, micro-environments, Chile
Spiders are ectothermic animals; their energetic processes
are highly correlated with the temperature of their surround-
ings, which has consequences in energy conservation, repro-
duction and prey capture. However, thermal preferences and
tolerances of spiders have been studied only in 0.1% of spider
species (Humphreys 1987; Schmalhofer 1999; Hanna & Cobb
2007). Knowledge of thermal preferences and tolerances is
necessary to describe the ecology of these animals (Hertz et al.
1993), defining the preferred foraging sites or preferred
shelters and reproductive sites (Hanna & Cobb 2007).
By analyzing thermal preferences and tolerances we can
estimate the themal niche, which is one of the niche dimensions.
This may be assessed by means of mechanistic biophysical
ecological methods not using the environment per se but rather
the state of the organism, for example body temperature (Tb). Tb
drives an organism’s physiological state; thus it is crucial to
quantify patterns of body temperature if we are to link controlled
laboratory conditions with those in the field. The principles of
these models provide a robust approach to determining niches of
organisms mechanistically (Kearney 2006; Kearney & Porter
2009; Kearney et al. 2010; Kearney 2012).
Spiders of the genus Dysdera Latreille 1804 (Family
Dysderidae) are ground dwellers characteristic of xerothermic
forests of the Mediterranean and adjacent areas. During the
day, they shelter in gravel covered by organic material or
under stones, and it has been reported that at night these
wandering nocturnal hunters search for woodlice (terrestrial
isopods), their principal prey (Cooke 1965; Bradley 2013).
The woodlouse spider, Dysdera crocata C. L. Koch 1838 is
originally from the Mediterranean and eastern European
region (Cooke 1965) but has spread throughout the world.
There are over 240 species of Dysdera (Platnick 2013) however
only D. crocata is cosmopolitan. It is amenable to a wide
spectrum of environmental conditions, being a common spider
in regions with cold temperatures and winter snow cover (e.g.,
Illinois, Ohio, Great Britain, Tasmania) as well as regions of
hot, dry summers and mild winters of a Mediterranean climate
(e.g., southern California, Greece) (Southcott 1976; Roberts
1995; Bradley 2004; Bosmans & Chatzaki 2005; Vetter &
Isbister 2006).
In Chile, D. crocata is mostly limited to urban areas in the
central region (Mediterranean climate); it is considered to be a
synanthropic spider (Taucare-Rios et a!. 2013). It is an epigean
species which can be captured under stones, rocks and rotting
logs that also support isopods; it is active throughout the year
in a micro-environment practically isolated from light, and
with constant high humidity. The temperature in this
environment is affected by the fluctuations characteristic of
the Mediterranean climate, varying in the year more than
fifteen degrees at a depth of 10 cm in the soil (Villaseca 1990).
There are no studies of the thermal biology of D. crocata.
Because body temperature is the most important ecophysio-
logical variable affecting all aspects of the performance of
ectotherms, including locomotion, immune function, sensory
input, foraging ability, courtship and rates of feeding and
growth (Angilletta et al. 2002; Fortner et al. 2006; Angilleta
2009; Hazell et al. 2010), the objective of this study was to
determine the preferred temperature of this species.
METHODS
Animals and study area. — Twenty individuals of D. crocala
were collected in the peri-urban zones of Santiago, Chile
(32°S, 70° 40' W). They were transferred to the laboratory in
the Faculty of Science of the University of Chile. Each spider
was introduced into a plastic box with moist soil and isopods
obtained in the capture site and maintained for one week at
room temperature (20° ± 5 °C, 60 ± 5% RH) and at lOL
(8:00-18:00): 14D (18:00-8:00) photoperiod. All experiments
were conducted in this laboratory during March 2012-
October 2012.
Preferred temperature. — After a week of acclimation,
twenty individuals (11 females and nine males; nib= 102.29
± 60.88 mg) were exposed to a temperature gradient between
2° ± 2.56 °C and 50° ± 0.89 °C established in a plastic cylinder
oriented horizontally with the extremes halfway submerged in
a thermoregulated chamber 1.20 m long X 0.25 m wide X
0.25 cm high. This chamber had a thermoregulated heater in
one end and a cold point in the other, generating a thermal
gradient between the end points (Fig. 1). The gradient was
closely linear with a temperature of 19.3° ± 5.10 °C in the
299
300
THE JOURNAL OF ARACHNOLOGY
A
Lamp
Cold end Hot end
Figure 1. — Experimental temperature gradient apparatus used to
measure preferred temperatures of Dysdera crocata. Thermoregulated
water baths in grey. Infrarred lamp at 2.5 m.
center. Prior to the beginning of the experiments, the thermal
gradient was calibrated with thermocouples installed every
5 cm. The hot/cold ends of the gradient were always switched
between trials to account for potential side biases.
The spiders were exposed individually for 65 min. This was
repeated twice in the morning (09:00, 12:00) and twice in the
twilight-night period (18:00, 20:00). The experiments were
conducted in an isolated room illuminated with artificial light
in the two morning experimental hours and with only an
infrared lamp positioned perpendicular to the gradient at a
distance of 2.5 m in the two twilight-night periods. Individuals
were deposited in the center of the chamber and allowed five
minutes of settling. Then the temperature of the spiders was
measured at the midpoint of the cephalothorax with an
infrared thermometer every five minutes for one hour. Prior to
the experimental trial, the body mass of spiders was measured
with an analytical balance (Shimadzu, AUX 220, ± 1 mg).
For each individual a record of the 12 temperatures chosen
by the spiders (tf. one every 5 minutes) in the periods was
obtained. These were recorded starting at 9:00, 12:00, 18:00
and 20:00. With these temperature records, frequency
histograms of the chosen temperatures were constructed. For
each individual the mean preferred temperature (Tp) in each
hour was calculated (the average of the 12 values).
Analysis and statistics. — The temperatures chosen by the
spiders (tj) were characterized with frequency histograms. The
normality of the distributions was tested with the Shapiro-
Wilks test (W). The initial and tj temperatures were compared
using the Friedman test (Fr), with a posteriori multiple
comparisons. Sex differences were analyzed with the Mann-
Whitney test (U), and the correlation between initial
temperature and the temperature at the end of the trials were
evaluated with the Spearman correlation coefficient (R).
To analyze differences in thermal preferences of the species,
the temperatures chosen were averaged for each hour so that
each experimental time was represented by a single value (Tp).
Considering that each individual was studied at four different
hours (repeated measures design) and the non-normal
distribution of the data, a non-parametric Friedman test for
dependent samples was performed, with Tp the response
0 5 10 15 20 25 30 35 40
Temperature (°C)
Figure 2. — Frequency histogram of preferred temperatures for
Dysdera crocata.
variable and the four experimental times (9:00, 12:00, 18:00
and 20:00) as the factors.
RESULTS
The preferred temperature over all individuals and exper-
imental hours was 9.12° ± 5.12 °C, with median and mode
8.0° and 6.0 °C, respectively. This was not related to sex (U =
35, P = 0.29) or to the body mass of the spiders (R = 0.1 1, R
> 0.05). The distribution had a skewness of 1.47 and a
kurtosis of 0.32 (Fig. 2) and was different from a normal
distribution (W = 0.884, P « 0.001). The body temperature
at the end of the experiment was correlated with the body
temperature at the beginning of each experimental trial (R =
0.299, F < 0.05), but the variance explained was very small
(R^ = 0.09) and preferred temperatures changed quickly with
respect to the initial preference. Initial body temperature was
different than temperatures chosen in the following minutes in
the experimental trials (FrgQ jg — 146, P 0.001) (Fig. 3).
There was a mean displacement of 5.9 ± 5.7 cm every five
minutes.
No differences among Tp were found comparing the four
experimental hours (Fr 20,3 — 5.82, p = 0.121) (Fig. 4).
DISCUSSION
Thermal preferences facilitate the description of the ecology
of a species and assessment of the suitability of the habitat
(Hertz et al. 1993). According to Sevacherian & Lowrie (1972),
individual limits and physiological processes determine the
conditions in which an organism can survive and adapt
successfully to a particular environment.
Preferred temperatures for D. crocata were low compared to
the range described for other araneomorph species. For
example these temperatures are between 23° and 23.5 °C
in Agelenidae (Pulz 1987), between 16° and 22.3 °C in
Clubionidae (Almquist 1970) and between 19.2° and 26.2 °C
in Lycosidae (Almquist 1970; Sevacherian & Lowrie 1972;
Pulz 1987). However there are reports of low preferred
temperatures in other species. For example, preferred temper-
atures of some species of Linyphiidae have been reported; 4. 1
SEPULVEDA ET AL.— THERMAL PREFERENCE OF DYSDERA CROCATA
301
25
20
O
0
1=.
D
2
0
Q.
E
0
15 -
10
0 -* — A—* — At-* — AA — AA — A-^ — A— ^ — AA — A— ^ — A-^ — A—^ — A-^ — A—^ — A—^ — A—^ —
0 5 10 15 20 25 30 35 40 45 50 55 60 65
Time (min)
Figure 3. — Changes in body temperature over time in all
experimental series. The asterisk indicates that the initial temperature
was different than all others in a posteriori multiple comparisons.
°C in Bolephthyphantes ( = Bolyphcmtes) index (Thorell 1856)
(Pulz 1987) and 1.2 °C in Macrargus riifus (Wider 1834)
(Almquist 1970). The preferred temperature of D. crocata is
probably associated with temperatures that are usually found
in their habitat under stones, dried leaves and organic
material.
In Santiago, Chile, in the location where the specimens were
captured, the soil temperature can vary more than 15 °C, with
the lowest temperatures in the months of April to September
(winter), where temperature at 10 cm depth can reach 8 °C.
The lowest temperatures are reached at night, which coincides
with the activity period of D. crocata. Also, this time range of
low temperatures coincides with the time when the experi-
ments were performed. It has been reported that this species
feeds on the isopods with which they coexist (Cooke 1965,
Bradley 2013). In Chile, it is common to find D. crocata
sharing its habitat with the common woodlouse PorceUio
laevis, which would be its usual prey. A study of preferred
temperatures of this isopod demonstrated that it is variable at
different locations in Chile and according to the time spent in
the measurement system (Castaneda et al. 2004). Interestingly,
the preferred temperature for specimens of P. laevis in
Santiago was 9.4° ± 1.1 °C using a measurement period
similar to the time that we ran our experiments, and varied
between 9.4° ± 1.1 °C and 12.2° ± 1.1 °C in the total
experimental range of this study, which is fully consistent with
our results. Thus two species that share a habitat in the field,
one a predator and the other its prey, have similar preferred
temperatures. A similar result was reported for the spider
Loxosceles laeta (Nicolet 1849) and its predator Scytodes
glohida Nicolet 1849 (Canals 2004; Canals & Solis 2013), in
which the preferred temperatures, the critical temperatures
and desiccation tolerances have a large overlap (Alfaro et al.
2013; Canals et al. 2013). The body temperature of D. crocata
varied from an initial temperature of 15.6° ± 5.6 °C to 9.6° ±
4.6 °C in 5 minutes, and afterwards remained close to their
preferred temperature (Fig. 3), with an average displacement
Hour
Figure 4. — Preferred temperatures of Dysdcra crocata at different
times of the day (mean and standard deviation).
of about 6 cm in 5 min suggesting that spiders actively sought
their preferred temperature.
D. crocata did not present hourly variations in preferred
temperature throughout the experimental hours, contrasting
with those reported in other arthropods (Canals et al. 1997),
mygalomorph spiders with crepuscular and nocturnal activity
(Alfaro et al. 2012), and other nocturnal araneomorph spiders
(Alfaro et al. 2013).
Regarding thermal preferences, D. crocata had a standard
deviation of ±5.12 °C, a value that is nearly 1 °C low than
other spiders such as L. laeta and S. glohida, suggesting a more
narrow range of thermal microenvironment preference than
these species. The election of low temperatures and a relatively
narrow range may be explained by phenotypic plasticity as an
adaptation to the particular environmental conditions present
in Chile. This plasticity in preferred temperatures has been
reported in Paraphysa parvida Pocock 1903 and Graniniostola
rosea (Walckenaer 1837), two mygalomorph spiders of central
Chile (Alfaro et al. 2013). Species from different environments
typically also have different thermal preferences (Pulz 1987;
Schmalhofer 1999) and these may vary seasonally (Schmalho-
fer 1999), with the breeding season (Hanna & Cobb 2007;
Veloso et al. 2012) or during the day, as in other ectotherms
(Canals et al. 1997; Alfaro et al. 2013).
The woodlouse spider, Dysdera crocata, originated from the
Mediterranean and eastern European region (Cooke 1965) but
has spread throughout the world; it is considered to be a
cosmopolitan spider. Its distribution is mainly in the holartic
region and it is more common near the coast. It is a common
spider in regions with cold temperatures and winter snow
cover (e.g., Illinois, Ohio, Great Britain, Tasmania) as well as
in regions with the hot, dry summers and mild winters of a
Mediterranean climate (e.g., southern California, Greece)
(Southcott 1976; Roberts 1995; Bradley 2004; Bosnians &
Chatzaki 2005; Vetter & Isbister 2006). The projection of our
results from the micro scale to the temperature conditions
associated with its world distribution would be not correct
because preferred temperatures indicate the suitable environ-
ments for D. crocata. These preferred temperatures may be
302
THE JOURNAL OF ARACHNOLOGY
different in hotter environments (phenotypic or physiologic
plasticity), or this spider has a great ability to find its preferred
microenvironments, probably associated with its prey: isopod
populations.
ACKNOWLEDGMENTS
We thank Lafayette Eaton for his useful comments on the
manuscript. Funded by FONDECYT 1 1 10058 grant to MC.
LITERATURE CITED
Alfaro, C., D.P. Figueroa, H. Torres-Contreras, C. Veloso, F.
Venegas & M. Canals. 2012. Effect of thermal acclimation on
preferred temperatures in two mygalomorph spiders inhabiting
contrasting habitats. Physiological Entomology 38:20-25.
Alfaro, C., C. Veloso, H. Torres-Contreras, R. Solis & M. Canals.
2013. Thermal niche overlap of the brown recluse spider
Lo.xosceles laeta (Araneae; Sicariidae) and its possible predator,
the spitting spider Scytodes glohuhi (Scytodidae). Journal of
Thermal Biology 38:502-507.
Almquist, S. 1970. Thermal tolerances and preferences of some dune-
living spiders. Oikos 21:230-236.
Angilletta, M.J.J. 2009. Thermal Adaptation: a Theoretical and
Empirical Synthesis. Oxford University Press, Oxford.
Angilletta, M.J.J. , P.H. Niewiarovski & C.A. Navas. 2002. The
evolution of thermal physiology in ectotherms. Journal of Thermal
Biology 27:249-268.
Bosnians, R. & M. Chatzaki. 2005. A catalogue of the spiders of
Greece. Newsletter of the Belgian Arachnological Society 20 (2,
Suppl.):l-124.
Bradley, R.A. 2004. Ohio’s Backyard: Spiders. Ohio Biological
Survey Backyard Series #4.
Bradley, R.A. 2013. Common Spiders of North America. University
of California Press, Berkeley.
Canals, M. & R. Solis. 2013. Is the tiger spider Scytodes glohida an
effective predator of the brown recluse spider Lo.xosceles laetcil
Revista Medica de Chile 141:805-807.
Canals, M., C. Alfaro, C. Veloso, H. Torres-Contreras & R. Solis.
2013. Tolerancia a la desecacion y sobreposicion del nicho termico
entre la arana del rincon Lo.xosceles laeta y un posible control
biologico, la arana tigre Scytodes glohida. Parasitologia Ibero-
Latinoamericana 72:52-60.
Canals, M., M.E. Casanueva & M. Aguilera. 2004. Cuales son las
especies de arahas peligrosas en Chile? Revista Medica de Chile
132:773-776.
Canals, M., R. Solis, J. Valderas, M. Ehrenfeld & P.E. Cattan. 1997.
Preliminary studies on temperature selection and activity cycle of
Chilean vectors of the Chagas disease. Journal of Medical
Entomology 34:1 1-17.
Castaneda, L.E., M.A. Lardies & F. Bozinovic. 2004. Adaptative
latitudinal shifts in the thermal physiology of a terrestrial isopod.
Evolutionary Ecology Research 6:1-15.
Cooke, J.A. 1965. A contribution to the biology of the British spiders
belonging to the genus Dysdera. Oikos 16:20-25.
Hanna, C.H.J. & V.A. Cobb. 2007. Critical thermal maximum of the
green lynx spider Peiicetia viridaiis (Araneae, Oxyopidae). Journal
of Arachnology 35:193-196.
Hazell, S.P., C. Groutides, B.P. Neve, T.M. Blackburn & J.S. Bale.
2010. A comparison of low temperature tolerance traits between
closely related aphids from the tropics, temperate zone, and arctic. '
Journal of Insect Physiology 56:1 15-122.
Hertz, P., R. Huey & R. Stevenson. 1993. Evaluating temperature
regulation by field-active ectotherms: the fallacy of the inappro-
priate question. American Naturalist 142:796-818. i
Humphreys, W.F. 1987. Behavioral temperature regulation, f
Pp. 56-65. In Ecophysiology of Spiders. (W. Nentwig, ed.). |
Springer Verlag, Berlin.
Jaksic, F. & L. Marone. 2007. Ecologia de Comunidades. 2nd ed.
Ediciones Universidad Catolica de Chile, Santiago. ;
Kearney, M. 2006. Habitat, environment and niche: what are we i
modeling? Oikos 1 15:186-191. i
Kearney, M. 2012. Metabolic theory, life history and the distribution
of a terrestrial ectotherm. Functional Ecology 26:186-191.
Kearney, M. & W.P. Porter. 2009. Mechanistic niche modeling:
combining physiological and spatial data to predict species’ range. !;
Ecology Letters 12:334-350.
Kearney, M., S.J. Simpson, D. Raubenheimer & B. Helmuth. 2010.
Modelling the ecological niche from functional traits. Philosoph-
ical Transactions of the Royal Society B 365:3469-3483.
Platnick, N.l. 2013. The World Spider Catalog. Version 14.0
American Museum of Natural History. Online at http://research. '
amnh.org/entomology/spiders/catalog/
Portlier, H.O., A.F. Bennett, F. Bozinovic, A. Clarke, M.A. Lardies
& R.E. Lenski et al. 2006. Trade-offs in thermal adaptation: in ,■
need of a molecular to ecological integration. Physiological and ji
Biochemical Zoology 79:295-313. |
Pulz, R. 1987. Thermal and Water Relations. Pp. 26-55. In '
Ecophysiology of Spiders, (W. Nentwig, ed.). Springer-Verlag,
Berlin. J
Roberts, M.J. 1995. Spiders of Britain & Northern Europe. Harper s
Collins Publishers, London.
Schmalhofer, V.R. 1999. Thermal tolerances and preferences of the |
crab spiders Misuinenops asperatiis and Misumenoides forniosipes
(Araneae, Thomisidae). Journal of Arachnology 27:470M80.
Sevacherian, V. & D. Lowrie. 1972. Preferred temperature of two j
species of lycosid spiders, Pardosa sierra and P. ranmlosa. Annals (
of the Entomological Society of America 65:111-114.
Southcott, R.V. 1976. Arachnidism and allied syndromes in the
Australian region. Records of the Adelaide Children’s Hospital
1:97-186. i
Taucare-Rios, A., A. Brescovit & M. Canals. 2013. Synanthropic |
spiders (Arachnida: Araneae) from Chile. Revista Iberica de
Aracnologia 23:49-53.
Veloso, C., D. Luhr, R. Marfull, H. Torres-Contreras, D. Figueroa &
P. Sabat et al. 2012. Characterization of the thermal micro- i
environment of Paraphysa parvida Pocock 1903 (Araneae, Ther-
aphosidae), a spider from Chilean Andes. Journal of Arachnology
40:34-38.
Vetter, R.S. & G.K. Isbister. 2006. Verified bites by the woodlouse
spider, Dysdera crocata. Toxicon 47:826-829. '
Villaseca, S. 1990. La temperature del suelo. Agricultura Tecnica
50:155-160.
Manuscript received 9 December 2013, revised 2 September 2014.
2014. The Journal of Arachnology 42:303-310
Natural history of Phoneulria hoUviemis (Araneae: Ctenidae): habitats, reproductive behavior,
postembryonic development and prey-wrapping
Nicolas A. Hazzi: Seccion de Entomologia, Programa Academico de Biologia, Universidad del Valle, Cali, Colombia.
Email: nicolashazzi@hotmail.com
Abstract. Phoneutria boliviensis (F.O.P.-Cambridge 1897) is a medically important wandering spider distributed from
Central America to northern South America. This study is the first description of the natural history of this species, and
presents data on several aspects of its natural history: reproductive and prey wrapping behavior, postembryonic
development, and habitats in the departments of Valle del Cauca and Quindio, Colombia. Prior to copulation, the male did
not engage in any courtship from a distance, but instead climbed onto the female, adopting the typical copulation position
of “modern wandering spiders” (position III). Females laid up to four egg sacs; between 430-1300 hatchlings emerged after
28-34 days. After hatching, spiderlings had a third claw on all their legs and built an irregular web, where they remained
until the next molt. Sexual maturity occurred after 14-17 molts, and spiders matured 300^65 days after emerging from the
egg sac. The species was found in disturbed habitats associated with both dry and wet tropical forests, usually on the
ground with little litter. Spiders wrapped prey in silk, moving in a stereotypically circular pattern around the prey without
manipulating threads with their legs. Attachments to the substrate involved rapid movements of the anterior spinnerets,
while the others remained immobile.
Keywords: Mating, maternal behavior, Colombia, banana spider
The family Ctenidae is well represented in the Neotropics by
medium to large wandering spiders that usually inhabit the
forest floor and low vegetation; few are arboreal. In this
family, the genus Phoneutria currently comprises eight large
(17^8 mm) nocturnal wandering spider species that are
widely distributed in Central America (Costa Rica) and South
America east of the Andes into northern Argentina (Simo &
Brescovit 2001; Martins & Bertani 2007). They are generally
known as “banana spiders” because they often inhabit this
crop. They are considered aggressive, and among the most
medically important spiders in the world (Foelix 2010). Their
venom has a neurotoxic action (Foelix 2010) and many
researchers have analyzed its components and the epidemiol-
ogy of bites (Biicherl 1953a, b, 1956; Cruz-Hofling et al. 1985;
Marangoni et al. 1993; Pineda & Florez 2002; Florez et al.
2003; Garcia et al. 2008; Maguina et al. 2008).
The natural history of several species in the genus
Phoneutria has been examined in some studies. Biicherl
(1969), Ramos et al. (1998), and Almeida et al. (2000)
presented data on the development, activity, reproduction
seasonality, and habitat use of Phoneutria nigriventer (Key-
serling 1891). Simo & Bardier (1989) described the postem-
bryonic development of P. keyserlingi (F.O.P.-Cambridge
1897). In the Amazon region, Gasnier et al. (2002) and Torres
& Gasnier (2010) offered data on the adult size, sexual
dimorphism, habitat use, and temporal changes in body size
structure of P. fera Perty 1833 and P. reiciyi (F.O.P.-
Cambridge 1897). Dias et al. (2011) modeled the potential
geographical distribution of P. hahiensis Simo and Brescovit
2001, a threatened species endemic to Brazil.
Phoneutria boliviensis (F.O.P.-Cambridge 1897) is widely
distributed in Central America (Costa Rica) to northern South
America (Simo & Brescovit 2001). Except for the brief
mentions by Valerio (1983) and Hazzi et al. (2013) on
geographical distribution expansions, Florez et al. (2003) on
the epidemiology of bites and Jager & Blick (2009) on the
introduction into other countries via commerce in banana
products, nothing is known regarding its general biology. The
following study presents data about the natural history of
Phoneutria boliviensis: reproductive and prey wrapping behav-
ior, postembryonic development, and habitat. It is based on
animals kept in captivity and on complementary field
observations.
METHODS
Habitat. — Collections and nocturnal observations were
made in localities in the Quindio and Valle del Cauca
departments in Colombia (Fig. 1). With the help of a
headlamp, I located spiders by the rellection of the light in
their eyes. Daylight observations were also performed by
turning over rocks and tree trunks and by visual searches of
the vegetation.
Reproductive behavior. — Six females and three males col-
lected from Cali, Aguacatal (Table 1, Fig. 1) were kept about
200 m from the collection locality in 30 X 20 cm terraria, with
soil as substrate and wet cotton wool moistened daily. The
spiders were maintained under ambient conditions of
temperature (day/night approximately 27/25°C), humidity,
and lighting. The spiders were fed cockroaches, Periplaneta
americana, two times a week. This methodology allowed
observations of egg sacs, time of the emergence of spiderlings,
maternal care, and spiderling behavior in the first days. In
addition, one female found with an egg sac was left in the field
and was monitored daily to compare her maternal and
spiderling behavior with those observed in captivity. This
female was found in a cleft formed by two rocks at the side of
a road.
Matings were observed at night involving three males and
four females (two females were immatures that were raised to
maturity, and thus virgins) in the same terraria and conditions
describe above. For each encounter, I carefully introduced the
male into the larger container housing the female’s terrarium
303
304
THE JOURNAL OF ARACHNOLOGY
• MON
30 kilometers
• study areas
ElevatioD (m)
1
0-1000
1
1001 - 2000
1
2001 - 3000
3001 - 4000
>4000
f
Figure 1. — Study areas in the Valle del Cauca and Quindio departments in Colombia. RSC = Reserva Natural San Cipriano; PNR = Parque j'
Natural Regional "El Vinculo”; CEA = Cali “El Aguacatal”; LT = La Tebaida; MON = Montenegro. I
about 20-25 cm from the female. I performed 12 male-female
pairings in all combinations, and both males and females were
given four possible mating opportunities. Male pre-copulatory
and copulatory courtship behavior and copulation are defined
as in Eberhard & Huber ( 1998). Male courtship refers to those
behaviors that induce the female to respond in a way that
favors the male’s reproduction (Eberhard 1996). Copulation
consists of all genitalic contact between a particular male-
female pair, including the insertion of the embolus into the
epigynal opening (Eberhard & Huber 1998).
Post-embryonic development. — In order to determine inter- I
molt period in each instar and number of molts and necessary
time to reach to sexually maturity, I raised 43 spiderlings taken
at random from two egg sacs obtained from two of the six |
females. The spiderlings were housed individually in plastic '
cylinders (4 cm diameter X 6 cm high) until the fifth instar,
when they were transferred to larger plastic cylinders (10 cm
diameter X 15 cm high). A moistened cotton ball was supplied
weekly. Juveniles up to the fifth instar were fed with
Drosophila nielanogaster larvae and adults raised in the j:
Table 1. — General characteristics of the areas studied and ctenids living sympatrically with P. boUviensis. Forest types were classified follow
Holdridge’s life zone. A.M.T. = annual mean temperature; A.M.P. = annual mean precipitation.
Locality
Forest type
Coordinates
(Lat. N; Lon. O)
Elevation
range (m)
A.M.T.
(°C)
A.M.P.
(mm)
Sympatric ctenids
Reserva Natural
San Cipriano
Tropical rainforest
(bp-T)
3° 50' 20"; 76° 53' 52"
0-80
26
5200
Acanthoctemis sp, Aucylometes
hogoteusis. and Ciipieiinitis
granadensis
Parque Natural
regional
“El Vinculo”
Tropical dry
forest (bs-T)
3° 50' 23"; 76° 18' 07"
950-1 100
25
1400
Ciipieiiniii.s binuiadatus
Cali “El Aguacatal”
Tropical dry forest
(bs-T)
3° 27' 31"; 76° 33' 45"
1000-1100
25
1300
C. bimcicidatiis
La Tebaida
Premontane wet
forest (bh-PM)
4° 26' 59"; 75° 48' 01"
1200-1300
22
1700
Ciipieiiniiis bimacukitus and
C. coccineiis
Montenegro
Premontanewet
forest (bh-PM)
4° 33' 13"; 75° 43' 03"
1300-1400
21
2100
Cupienniiis binuicukitus and
C. coccineus
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
305
Figure 2. — Mating position of P. boliviensis.
laboratory. Older spiderlings were fed field-collected crickets
and juvenile Periplaneta americana raised in the laboratory.
Spiderlings were fed and checked for molting three times a
week. I consider spiderlings that recently emerged from the egg
sac as second instar individuals (Foelix 1996).
Vouchers specimens are deposited in the arachnological
collection of Museo de Entomologia de la Universidad del
Valle (MUSENUV), Cali, Colombia.
Prey-wrapping behavior. — Previous studies have shown that
wrapping behavior varies both qualitatively and quantitatively
depending on prey size and species (see references in Barrantes
& Eberhard 2007). In this study, I focused on determining
whether or not Phoneiitria boliviensis exhibited a given general
behavior pattern, rather than whether or not this behavior was
omitted under certain conditions. I always used adults of
Periplaneta americana, a difficult prey for the spiders. In four
of the six females collected, I observed eight prey-wrapping
episodes (two for each female). Video recordings were made
with a digital Canon PowerShot ELPH 100 HS camera.
Behavioral and postembryonic developmental data are
presented as mean ± SD (range: min-max). Because of the
small samples, they are meant only to provide general
descriptions of magnitudes, rather than to characterize the
behavior of this species.
RESULTS
Habitat observations. — Sixty-nine individuals were found in
remnants of dry forests, premontane wet forests transformed
into banana plantations and rain forests (Table I). In the dry
and wet premontane forest, spiders were always associated
with synanthropic environments. I also observed the spiders in
forest edges or adjacent habitats (roadsides). During the day, I
found spiders (n = 20) under rocks, piles of banana leaf litter,
and building rubble (tiles and bricks) near the forests or
banana plantations. At night, I observed spiders (n = 49) on
the ground with scattered litter (n — 40) and a few in low
vegetation, usually below 40 cm above the ground (n = 9).
Mating behavior. — Mating occurred in four of 12 couples
that were placed together. In no case did the male court the
female from a distance. The males reacted to contact with
female silk using palpal movements and began to search for
the female by keeping their palps near the substrate,
maintaining contact with female silk and slowly tapping in
different directions with their first legs. When the male
contacted the female, he turned until they were head-to-head,
and touched her very quickly (less than 2 s) with his forelegs. If
the female was not receptive (n = 8), she rapidly ran away.
However, if she was receptive (n = 4), the male climbed over
her so that they faced opposite directions and she drew in her
legs close to her body so that the patellae of all her legs almost
touched each other above her carapace. The male moved
laterally to the sides of the female’s body and contacted her
epigynum with one palp. The mating position was type HI, as
in Eoelix (2010) (Fig. 2). Copulation lasted less than 15 s and
the male’s extended palp moved rapidly to touch the epigynum
briefly. In three pairs, it was possible to record palpal
insertions; in two, there was only one insertion and in the
other there were two, one on each side of the epigynum. In the
video recording, I observed that the spines on the male’s legs
became erect momentarily at the beginning of each palpal
insertion. After mating completion, the male ran away.
Post-embryonic development. — Five of the six females
attached egg sacs (n = 10) to the terrarium wall, always above
the ground. Egg sacs were white, with a flat face of an average
diameter of 28 mm ± 4 (range 22-33, n = 10) against the wall
and a convex face (Fig. 3). Spiderlings emerged on average 30 ±
2 days (range 28-34, n = 5) after the egg sacs were produced.
The average number of offspring per egg sac was 836 ± 436
(range 430-1300, n = 5). Before hatching, females only left the
egg sacs for short periods, moving down in the terrarium to
drink. However, they still preyed on food that was placed in the
terrarium away from the egg sacs. They were more aggressive
while guarding, lifting their first pair of legs, opening their
fangs, and making lateral movements of the body as is
characteristic of the genus (Simo & Brescovit 2001 ) (Fig 4.).
Twice 1 observed the emergence of spiderlings, one hour
after the females began to bite the egg sac with her chelicerae
repeatedly in different parts about once per minute. After
hatching, spiderlings emerged and built an irregular web where
they remained until their second molt (Figs. 5, 6). Spiderlings
began to leave the communal web 15 days after emerging from
the egg sac when all had molted, and they then began to feed.
Spiderlings in the second instars had a third claw on all their
legs that in the following instars was lost and replaced by a
dense claw tuft.
The mother and offspring behaviors just described were also
observed in the field. The female stayed near the egg sac, while
the spiderlings built the irregular web; when they dispersed a
day after their second molt, she was still nearby. After the
spiderlings had dispersed, the female also vanished.
When the communal web made by the spiderlings was
disturbed by strong vibrations applied with a brush, most of
them moved away a short distance, but returned to the web
after 10 min. When some spiderlings were removed from the
communal web and placed in another terrarium, they soon
formed a group. This behavior ceased within a few days after
the second molt.
306
THE JOURNAL OF ARACHNOLOGY
Figure 3-6. — Maternal behavior and communal web of the spiderlings. 3, Female above the egg sac protecting it, white arrow indicates
attachment threads; 4, female defending the egg sac; 5, Communal web of the spiderlings, white arrow indicates the group of spiderlings; 6, Detail
of the communal web.
Number and duration of the molts. — Four females reached
maturity after 14, 15, 16 and 17 molts respectively. There was
no pattern of increase or decrease in the instar duration
(Table 2). However the duration of the first instar was always
the shortest and presented less variation than the others. The
mean time from emergence of the spiderlings until maturity
was 396.7 ± 72 days (range 300^65).
Table 2. — Duration (days) of Phoneiitria holiviensis nymphal
instars.
Instar
11
Mean ± SD
Range
II
43
1 1 ± 3.0
7-16
III
35
20 ± 2.7
16-26
IV
26
21.1 ± 9.5
9-47
V
19
26 ± 8.3
14-39
VI
16
30 ± 11.7
17-53
VII
6
31 ± 13.8
16-52
VIII
6
25 ± 2.4
22-28
IV
6
23 ± 3.7
20-29
X
5
24.2 ± 2.6
21-28
XI
4
23.7 ± 4.2
18-28
XII
4
27.5 ± 3.3
23-30
XIII
4
41.2 ± 13.2
29-60
XIV
4
28.2 ± 5.6
23-34
XV
3
39.3 ± 10.8
27^7
XVI
2
39 ± 15.5
28-50
XVII
1
29 ± 0
29
Prey-wrapping behavior. — When a spider captured and bit a
cockroach, it waited a few minutes until the insect finished
moving. If the spider was on the floor, she climbed the
terrarium wall (no more than 15 cm) and turned to face down
(Fig. 7A) after the cockroach stopped moving (the antennae
sometimes still moved). The spider inclined her abdomen
toward the wall to attach silk, and then turned in a
semicircular path around the prey keeping the cockroach in
her chelicerae (Fig. 7B), while she made a third attachment to
the surface. The silk from the first attachment still remained
on the spinnerets so that a sheet of silk covered the prey
(Fig. 1C). Holding the cockroach in her chelicerae, the spider
continued this stereotyped circular motion, adding more silk
to the prey. As the cockroach became more tightly attached to
the substrate, the spider sometimes released its hold with the
chelicerae while continuing to wrap it. The attachments disks
were never on the prey, but on the surface around on it.
Throughout this process, the palps repeatedly contacted the
prey. The average number of attachments per turn was 2.4 ±
0.7 SD (range 1-3) and the average total number of
attachments was 9.6 ± 2.1 SD (range 7-13). At the conclusion
of prey wrapping, the spider lifted the cockroach with its
chelicerae and moved slightly forward, causing the threads to
the substrate to tighten. The mean duration of the prey
wrapping was 81 s ± 13 SD (range 65-100).
While the spiders fed, they sometimes repeated prey
wrapping several times, but with shorter durations and fewer
attachments than the initial wrap. In seven of the eight
observations, the wrapping lines formed from the first two
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
307
Figure 7. — Prey wrapping behavior sequence of Phonentria holiviensis (the numbers indicate the order of the attachments). After the third
attachment, the cockroach is fixed to the substrate.
attachment disks that the spider made did not contact the
cockroach. The general pattern of attaching wrapping lines on
prey was in one direction (Fig. 9). When the spider began to
make this circular motion, it was always performed in a
clockwise direction without changing course. I observed that
the silk was slack and consisted of numerous threads. In no
case did any leg hold any line which was being produced or to
which the spider was attaching.
Because the spiders wrapped the prey while on the vertical
glass wall of the terrarium, it was possible to observe the
movement of the spinnerets as they produced silk. Silk
emerged from all three pairs of spinnerets. Only the anterior
Figure 8. — Patterns of attachments of wrapping lines by two individuals of Phoneutria holiviensis (the numbers indicate the order of the
attachments and arrows the direction taken by the spider). The silk is slack and due to the circular movement of her body, the threads do not pass
straight over the prey as schematized, but instead are curved around it.
308
THE JOURNAL OF ARACHNOLOGY
spinnerets moved when an attachment was made in alternated
fashion. The immobile posterior lateral spinnerets (PLS) were
usually in an asymmetric position, depending on the direction
taken by the spider in the circular motion pattern; for instance,
if the spider was moving to the left, the right PLS was always
raised and the left PLS was lowered touching the substrate.
These asymmetric positions of the spinnerets created the silk
sheet shown in Fig. 7D.
DISCUSSION
Plioneiitria holiviensis has been associated with wet and very
wet forest ecosystems with annual precipitation > 2500 mm.
Valerio (1989) indicates that in Costa Rica this species is
restricted to wet and very wet forests in tropical life zones
system (Holdridge system) and altitudes not exceeding 600 m;
Florez et al. (2003) recorded this species in the Uraba region,
Colombia, an area known for its high precipitation; Martins &
Bertani (2007) consider it to be a typical species of the
Amazon region. In this study, I also found F. holiviensis in
rainforests, and also in remnants of dry forests with annual
precipitation of 1300-1400 mm and at elevations of up to
1400 m. Thus this species is not restricted to lowland
rainforests.
In the mating process, male P. holiviensis made palpal
movements when contacting female silk. These movements
apparently are similar to those described in some species of
lycosids (Tietjen & Rovner 1980), and allow the male to locate
the female by following her silk (Tietjen 1977; Tietjen &
Rovner 1980). Male P. holiviensis did not court from a
distance prior to mating. Folly-Ramos et al. (2002) found that
P. nigviventer also lacks courtship. It appears that the female
recognizes the male when he contacts her because if the female
is receptive, she adopts a passive posture when touched.
In contrast, Ciipienniiis spp. Simon 1891 and Ancyloinetes
hogotensis (Keyserling 1877) have elaborate courtship before
mating, involving rhythmic movements of the first pairs of legs
and palpal drumming which sends vibrations through
the substrate (Merrett 1988; Barth 2002). In addition, A.
hogotensis and C coccineus F.O. Pickard-Cambridge 1901 are
unique among ctenids in wrapping the legs of the female with
silk during mating (Merrett 1988; Schmitt 1992). Other ctenid
species like Cteniis niecliiis Keyserling 1891 and Isoctenus sp.
Bertkau 1880 have less elaborate courtship involving only
vibrational motions of the first pair of legs (Folly-Ramos et al.
2002; Pellegati-Franco 2004). The erection of the leg spines at
the beginning of each palpal insertion by the male is due to
increased body pressure during insertion and expansion of the
hematodocha (Foelix 2010).
The mating position of P. holiviensis was type III (Foelix
2010), typical of the “modern wandering spiders” such as
Anyphaenidae, Clubionidae, Lycosidae, Pisauridae, Saltici-
dae, Tengellidae, Trechaleidae and Thomisidae (Sierwald &
Coddington 1988; Costa 1993; Huber 1995; Barrantes 2008;
Foelix 2010). The ctenids species mentioned above, except C.
niecliiis, use this same mating position. Thus this behavior
could be a tentative synapomorphy as families sharing this
trait belong to the monophyletic RTA (retrolateral tibial
apophysis) clade.
According to my observations made of this species both in
captivity and in the field, P. holiviensis demonstrated effective
maternal care, consisting mainly of her remaining with the egg
sac and defending it until the spiderlings emerged and
dispersed within a few days after molting. This behavior by i
mothers could prevent predation on spiderlings because j:
females were more aggressive during this period. Toyama i
(1999) reported a similar maternal behavior in Cheiracanthiwn j
japonicum, which greatly improved survival and development
of eggs as well as spiderlings in the field.
The shape of the egg sac, maternal behavior, the construc-
tion of a communal web by the spiderlings, and dispersal
following the second molt are all traits shared with some other
ctenids such as Phoneutria keyserlingi (Simo 1989); Pam-
hatinga hrevipes (Keyserling 1891); Asthenoctenus borellii !
Simon 1897 (Simo et al. 2000); Cteniis inedius (Folly-Ramos
et al. 2002); Cteniis fasciatm Mello-Leitao 1943 and Enoploc-
teniis cyclothorax (Bertkau 1880), however C. fasciatiis usually ^
put grains of dirt on the egg sac, apparently for camouflage
(Pellegatti-Franco 2004). Other ctenids, such as Ciipienniiis
spp., differ by carrying the egg sac on spinnerets (Barth 2002)
or with the chelicerae, as in Ancyloinetes hogotensis, Cteniis
amphora Mello-Leitao 1930 and C. crulsi Mello-Leitao 1930
(Merrett 1988; Hofer et al. 1994).
It is well known that the middle claw is important for web
spiders because they use it to catch hold of the silk threads of
their webs (Foelix 2010). In Phoneutria holiviensis and maybe
other ctenids mentioned above, the presence of this claw in i
early instars is necessary because the spiderlings build a ,
communal web after emergence. Homann (1971) also men- I
tioned the presence of a middle claw in early instars of Cteniis f
niecliiis, Ciipienniiis salei (Keyserling 1877), and Phoneutria j
keyserlingi. Others ctenids species of Ancyloinetes and Cupien- |
niiis, also have a third claw. The Ciipienniiis adults have a much
reduced middle claw (Barth 2002; H5fer & Brescovit 2000).
According to Silva (2004), the occurrence of a middle claw ^
could be an ancestral condition for the ctenoid spiders.
There are two general contexts in which the spiders wrap
their prey: to restrain active prey and prevent their escape '
(“immobilization wrapping”) and to form more compact and :
manageable packages (“post-immobilization wrapping”) i'
(Eberhard 1967; Robinson et al. 1969; Rovner & Knost i
1974; Barrantes & Eberhard 2007). Phoneutria holiviensis
performed only “post-immobilization wrapping.” The cock-
roach became more compact during the wrapping process, and
became more securely fastened to the vertical substrate. This
allowed the spider to occasionally release the prey with her
chelicerae and chew on another part without falling. The i
circular pattern of wrapping and the movement of the anterior [
spinnerets of P. holiviensis was similar to observations of ,
Rahiclosa ( = Lycosa) rahiila (Walckenaer 1837) and R.
piinctulata (Hentz 1844) (Rovner & Knost 1974), which also
perform this behavior while above the ground (in vegetation).
While wrapping, P. holiviensis does not manipulate threads
with any legs, but rather attaches threads to the substrate
through body movements. Pulling wrapping silk using
movements of the body is ancestral in araneomorph spiders
and its homology is supported by the similarity in their [
asymmetrical use of PLS described in several families j
(Barrantes & Eberhard 2007). Such asymmetry alters the i
distribution of lines on the prey package from that expected if
the spinnerets were used symmetrically. In the case of the prey-
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
309
wrapping behavior of P. boliviensis, the asymmetric position
of the PLS create a silk sheet that encases the prey more
efficient than if the PLS were in a symmetric position, creating
only a swath of lines.
In Rabidosa rahida, Rovner & Knost (1974) sealed each pair
of spinnerets separately with paraffin to identify the functions
of the types of silk they produced during prey wrapping. The
anterior spinnerets produced attachment discs with lines from
the pyriform glands. In addition, the anterior spinnerets
produced drag lines from the ampullate glands. The median
and posterior spinnerets produced wrapping silk from the
aciniform glands. The movements of the anterior spinnerets of
P. boliviensis while attaching lines to the wall presumably
resulted in the zigzag pyriform lines typically seen in
attachment discs.
ACKNOWLEDGMENTS
I am grateful to William Eberhard (Smithsonian Tropical
Research Institute) for his help in improving this manuscript
and Carlos Valderrama (Universidad Icesi, Colombia) for
his valuable comments throughout the development of
the project. I also thank Miguel Simo (Universidad de la
Republica, Uruguay) for corroborating the identification of
the species and providing literature; Carmen E. Posso
(MUSENUV) for making available the colony of cockroaches
for feeding the spiderlings and behavioral observations of
prey-wrapping; Marcela Delgado (Universidad Icesi, Colom-
bia) for helping me on some occasions with the maintenance of
the spiderlings; and Jairo A. Moreno (Seccion Entomologia,
Univalle, Colombia) for processing Figure 2.
LITERATURED CITED
Almeida, C.E., E.F. Ramos, E. Gouvea, M. Carmo-Silva & J. Costa.
2000. Natural history of Ctenus niedius Keyserling, 1891 (Araneae.
Ctenidae) I: observations on habitats and the development of
chromatic patterns. Revista Brasileira de Biologia 60:503-509.
Barrantes, G. & W.G. Eberhard. 2007. The evolution of prey
wrapping behaviour in spiders. Journal of Natural History
41:1631-1658.
Barrantes, G. 2008. Courtship behavior and copulation in Teiigellu
radiatci (Araneae, Tengellidae). Journal of Arachnology 36:606-
608.
Barth, F.G. 2002. A Spider's World: Senses and Behavior. Springer,
Berlin.
Biicherl, W. 1953a. Dosagem comparada das atividades dos extratos
glandulares e do veneno puro de Phoneutria nigreventer. Memorias
do Instituto Butantan 25:1-22.
Biicherl, W. 1953b. Novo proceso de obtencao de veneo seco, puro de
Phoneutria nigreventer e titulacao da LD5Q em camundongos.
Memorias do Instituto Butantan 25:153-176.
Biicherl, W. 1956. Studies on dried venom of Phoneutria fera Perty,
1833. Venoms 44:95-97.
Biicherl, W. 1969. Biology and venoms of the most important South
American spiders of the genera Phoneutria, Loxosceles, Lycosa and
Latrodectus. American Zoologist 9:157-159.
Costa, F.G. 1993. Cohabitation and copulation in Ixeuticus nuirtius
(Araneae, Amaurobiidae). Journal of Arachnology 21:258-260.
Cruz-Hofling, M.A., S. Love, G. Brook & L.W. Duchen. 1985.
Effects of Phoneutria nigriventer spider venom on mouse peripheral
nerve. Quarterly Journal of Experimental Physiology 70:623-640.
Dias, M.A., M. Simo, 1. Castellano & A.D. Brescovit. 2011. Modeling
distribution of Phoneutria hahiensis (Araneae: Ctenidae): an
endemic and threatened spider from Brazil. Sociedade Brasileira
de Zoologia 28:432-439.
Eberhard, W.G. 1967. Attack behavior of diguetid spiders and the
origin of prey wrapping in spiders. Psyche 74:173-181.
Eberhard, W.G. 1996. Female Control: Sexual Selection by Cryptic
Female Choice. Princeton University Press, Princeton, New Jersey.
Eberhard, W.G. & B.A. Huber. 1998. Courtship, copulation, and
sperm transfer in Leucauge niariaua (Araneae, Tetragnathidae)
with implications for higher classification. Journal of Arachnology
26:342-368.
Florez, E., A. Ortiz & M. Montoya. 2003. Accidentes por mordedura
de la arana de las bananeras Phoneutria boliviensis (Araneae:
Ctenidae) en la region de Uraba, Colombia. Entomologo 96:1-4.
Foelix, R. 2010. Biology of spiders. 3rd ed. Oxford University Press,
New York.
Folly-Ramos, E., C.E. Almedia & J. Costa. 2002. Natural history of
Ctenus niedius Keyserling, 1891 (Araneae, Ctenidae) II: Life cycle
and aspects of reproductive behavior under laboratory conditions.
Revista Brasileira de Biologia 62:787-793.
Garcia, L.F., L.E.A. Pedrosa & D.R.B. Rosada. 2008. An easy
method for handling the genus Phoneutria (Araneae. Ctenidae) for
venom extraction. Journal of Arachnology 36:604-605.
Gasnier, T.R. & H. Hofer. 2001. Patterns of abundance of four
species of wandering spiders (Ctenidae: Ctenus) in a forest in
Central Amazonia. Journal of Arachnology 29:95-103.
Gasnier, T.R., C.S. de Azevedo. M.P. Torres-Sanchez & H. Hofer.
2002. Adult size of eight hunting spider species in central
Amazonia: temporal variations and sexual dimorphisms. Journal
of Arachnology 30:146-154.
Hazzi, N.A.. C. Valderrama, A.D. Brescovit, D. Polotow & M. Simo.
2013. New records and geographical distribution of ctenid spiders
(Araneae: Ctenidae) in Colombia. Zootaxa 3709:243-254.
Hofer, H. & A.D. Brescovit. 2000. A revision of the neotropical spider
genus Ancylometes Bertkau (Araneae: Pisauridae). Insect System-
atics and Evolution 31:323-360.
Hofer, H., A.D. Brescovit & T. Gasnier. 1994. The wandering spiders
of the genus Ctenus (Ctenidae: Araneae) of Reserva Ducke, a
rainforest reserve in central Amazonia. Andrias 13:81-98.
Homann, H. 1971. Die Augen der Araneae: Anatomic, Ontogenie
und Bedeutung fiir die Systematik (Chelicerata, Arachnida).
Zeitschrift fur Morphologie der Tiere 69:201-272.
Huber, B.A. 1995. Genital morphology and copulatory mechanics in
Anyphaena accentuate (Anyphaenidae) and Cluhiona pallidula
(Clubionidae: Araneae). Journal of Zoology 235:689-702.
Jager, P. & T. Blick. 2012. Zur Identifikation einer nach Deutschland
eingeschleppten Kammspinnenart (Araneae: Ctenidae: Phoneu-
tria). Arachnologische Mitteilungen 38:33-36.
Maguina, V.C., L.A. Soto, A.B. Juarez, M.A. Bruno, A.C. Villon &
F.O. Plengue. 2008. Primer reporte de Phoneutrismo en el Peru.
Presentacion de dos casos. Revista Medica Herediana 19:128-133.
Maragoni, S., N.C. Borges, R.A. Marangoni, E. Atunes, C.A. Viera
& J.C. Novello et al. 1993. Biochemical characterization of a
vascular smooth muscle contracting polypeptide purified from
Phoneutria nigriventer (armed spider) venom. Toxicon 31:377.
Martins, R. & R. Bertani. 2007. The non-Amazonian species of the
Brazilian wandering spiders of the genus Phoneutria Perty, 1833
(Araneae: Ctenidae), with the description of a new species.
Zootaxa 1526:1-36.
Merrett, P. 1988. Notes on the biology of the neotropical pisaurid,
Ancylometes hogotensis (Araneae: Pisauridae). Bulletin of British
Arachnological Society 7:197-201.
Pellegatti-Franco, F. 2004. Biologia e Ecologia populacional de
Ctenus fasciatus Mello-Leitao e Enoploctenus cyclothora.x (Bert-
kau) em cavernas do alto Riberira, Iporanga, sp (Araneae:
Ctenidae). Ph.D. thesis, Instituto de Biociencias da USP, Sao
Paulo, Brazil.
310
THE JOURNAL OF ARACHNOLOGY
Pineda, D. & E. Florez. 2002. Mordeduras de aranas. Pp. 71-88. In
Accidentes por animales venenosos. (D. Pineda, ed.). Instituto
Nacional de Salud, Bogota.
Ramos, E.F., C.E. Almeida, E. Gouvea & M. Carmosilva. 1998.
Considerapoes sobre a atividade de locomo^ao, preferencia por
ecotopos e aspectos territorials de Phoneutria nigriventer (Keyserling,
1891), (Araneae, Ctenidae). Revista Brasileira de Biologia 58:71-78.
Robinson, H.M., H. Mirick & O. Turner. 1969. The predatory
behavior of some araneid spiders and the origin of immobilization
wrapping. Psyche 76:487-501.
Rovner, J.S. & S.J. Knost. 1974. Post-immobilization wrapping of
prey by lycosid spiders of the herbaceous stratum. Psyche
81:398-414.
Sierwald, P. & J.A. Coddington. 1988. Functional aspects of the male
palpal organ in Dolomedes tenebrosiis, with notes on the
mating behavior (Araneae, Pisauridae). Journal of Arachnology
16:262-265.
Silva, D. 2004. Higher-level relationships of the spider family
Ctenidae (Araneae: Ctenoidea). Bulletin of the American Museum
of Natural History 274:1-86.
Simo, M. & G. Bardier. 1989. Desarrollo postembrionario de
Phoneutria keyserlingi (Pickard-Cambridge) 1897 (Araneae, Cte-
nidae). Boletin de la Sociedad Zoologica del Uruguay 5:15-16.
Simo, M. & A.D. Brescovit. 2001. Revision and cladistic analysis of
the Neotropical spider genus Phoneutria Perty, 1833 (Araneae,
Ctenidae), with notes on the related Cteninae. Bulletin of the
British Arachnological Society 12:67-82.
Simo, M., V. Vazquez & U. Gonzalo. 2000. Estudio comparativo de la I
fenologia y el habitat de Ctenus taeniatus KEYSERLING 1891 y
Asthenoctenus horellii SIMON 1897 en el Uruguay (Araneae, ■
Ctenidae). Boletin de la Sociedad Zoologica del Uruguay, 2° epoca 1,
12:32M0. " I,
Schmitt, A. 1992. Conjectures on the origins and functions of a bridal 1
veil spun by the males of Cupiennius coccineus (Araneae, Ctenidae).
Journal of Arachnology 20:67-68.
Tietjen, W.J. 1977. Dragline following by male lycosid spiders. Psyche
84:164-178. " j
Tietjen, W.J. & J.S. Rovner. 1980. Physico-chemical trail-following i
behaviour in two species of wolf spiders: sensory and etho- j
ecological concomitants. Animal Behaviour 28:735-741.
Torres-Sanchez, M.P. & T.R. Gasnier. 2010. Patterns of abundance '
and body size structure of Phoneutria reidyi and P. /era (Araneae:
Ctenidae) in the Central Amazonian rainforest. Journal of j
Arachnology 38:433-440. '
Toyama, M. 1999. Adaptive advantages of maternal care and
matriphagy in a foliage spider, Chiracanthium japoniciini (Araneae:
Clubionidae). Journal of Ethology 17:33-39.
Valerio, C.E. 1983. Sobre la presencia de Phoneutria boUviensis (F.O.P
Cambridge) (Araneae, Ctenidae) en Costa Rica. Journal of
Arachnology 11:101-102.
2014. The Journal of Arachnology 42:31 1-314
SHORT COMMUNICATION
The mechanism behind plasticity of web-building behavior in an orb spider facing spatial constraints
Thomas Hesselberg': Smithsonian Tropical Research Institute, Apartado 0843-03092, Balboa, Ancon, Republic of
Panama. E-mail: thomas.hesselberg@zoo.ox.ac.uk
Abstract. Orb spiders demonstrate an impressive ability to adapt their web-building behavior to a wide range of
environmental and physiological factors. However, the mechanisms behind this plasticity remain poorly understood.
Behavioral plasticity can be categorized as either developmental, where new neural pathways arise from learning, or
activational, which rely on more costly pre-existing neural pathways. Here 1 argue that orb spiders and their webs in general
and their response to spatial constraints in particular make an ideal model system in which to explore these two
mechanisms further. I show that the spider Eiislala illicita (O. Pickard-Cambridge 1889) immediately modifies its first orb
web after being placed in spatially confined experimental frames without showing subsequent improvements in design of
the second web. Thus, these data are in accord with the hypothesis that this spider relies on activational behavioral
plasticity, which might be linked to its preferred habitat in the wild.
Keywords: Behavioral flexibility, learning, experience, web geometry, Eiistaki illicita
The ability of an animal to rapidly adapt its behavior to changes in
its environment, so-called behavioral plasticity or behavioral fiexibil-
ity, has been described from a wide range of vertebrate and
invertebrate taxa. Phenotypic plasticity in general, and behavioral
plasticity in particular, has previously been recognised as arising
either from an innate pre-programmed pathway or from internal
physiological or external environmental changes including develop-
mental changes and learning (West-Eberhard 2003; Mery & Burns
2010). Most studies focus on the interaction between environmental
change and the evolution of learning. Initially it was assumed that
learning was always favored in variable environments, but more
detailed experimental and theoretical studies show that learning is
only favored when the environment changes relatively little within an
individual lifetime and shows predictable changes between genera-
tions (so-called coarse-grained environmental variation). Innate
behavior is favored when the environment changes randomly and
unpredictably within generations (so-called fine-grained environmen-
tal variation) (Stephens 1991; Dunlap & Stephens 2009).
The above and similar studies have significantly increased our
understanding of the evolution of learning, but the relationship
between behavioral plasticity and learning remains poorly defined.
However, this relationship has recently been the subject of a review by
Snell-Rood (2013), in which she defined two different kinds of
behavioral plasticity based on separate costs and benefits. Develop-
mental behavioral plasticity is the slower process that requires a
physical re-organisation of the underlying neural pathways caused by,
for example, learning, which is hypothesised to be favoured in
environments that show coarse-grained variation. Activational
behavioral plasticity, which is an immediate reponse that relies on
pre-configured neural pathways, is favoured in environments that
show fine-grained variation. Both require significant initial invest-
ment in costly neural tissue, but developmental behavioral plasticity
allows animals to prune and optimize the neural network over time,
while activational behavioral plasticity relies on a constant amount of
neural tissue (Snell-Rood 2013). However, the two mechanisms do
not necessarily operate completely separately. What may look like
activational behavioral plasticity in the adult animal may have arisen
through interactions between the genes and the environment
including learning processes in the juvenile animal. Thus activational
‘Current Address; Department of Zoology, University of Oxford,
South Parks Road, Oxford, 0X1 3PS, United Kingdom
behavioral plasticity that does not involve any learning in the present
may be the result of neural pathways that were fixed through
developmental behavioral plasticity in the past. More experimental
data is required to investigate the prevalence and interaction of these
two types of behavioral plasticity.
Here I propose that orb spiders and their webs constitute an ideal
model system in which to study behavioral plasticity. Orb spiders
show an impressive ability to modify their webs to a range of
environmental and physiological factors including temperature
(Vollrath et al. 1997), wind (Vollrath et al. 1997; Liao et al. 2009),
prey size and type (Nakata 2007; Blamires et al. 2011), silk availability
(Eberhard 1988; Vollrath et al. 1997), leg loss (Pasquet et al. 2011)
and spatial constraints (Ades 1986; Vollrath et al. 1997; Harmer &
Herberstein 2009). However, the majority of these studies tested either
only the first web or allowed the spiders a week or more to acclimatize
to experimental conditions before testing them, and so do not allow
us to unravel whether spiders immediately adapt their webs to the new
condition (i.e., activational behavioral plasticity) or improve their
webs gradually as they gain more experience with the condition
(i.e., developmental behavioral plasticity). Given that inexperienced
spiders build perfectly normal webs (Reed et al. 1970) and that
spiders do not improve webs with age or size (Eberhard 2007;
Hesselberg 2010), a reliance on developmental behavioral plasticity
is perhaps less likely. However, orb spiders readily learn to avoid
dangerous and distateful prey (Henaut et al. 2014); gradually alter
their sticky spiral mesh size, web size and web asymmetry based on
recent prey capture experiences (Heiling & Herberstein 1999; Vernier
et al. 2000); improve the size, planarity and verticality in subsequent
webs built at the same site (Zschokke & Vollrath 2000; Nakata &
Ushimaru 2004); and also seem to gradually improve their
locomotory and web-building skills under weightless conditions in
space (Witt et al. 1977).
Here I propose that spiders' adaptation to building webs in
spatially constrained spaces is particularly useful for studying
behavioral plasticity as it is ecologically relevant and has been
studied in a number of different species (Ades 1986; Vollrath et al.
1997; Krink & Vollrath 2000; Harmer & Herberstein 2009; Barrantes
& Eberhard 2012; Hesselberg 2013). I re-analysed previously collected
data on behavioral fiexibility in Eiistala illicita (O. Pickard-Cam-
bridge 1889), which successfully built webs in size-limited experimen-
tal frames (Hesselberg 2013). Late instar female spiders were collected
in a dry tropical rain forest in Panama City, Panama (9°N, 80°W) and
311
312
THE JOURNAL OF ARACHNOLOGY
!
f
i
Figure 1. — Differences in area utilization (A) and shape (B) between first (dark grey bars) and second (light grey bars) webs of Eustala illicita
built in experimental frames (Control (N = 5): 30 X 30 cm; Vertical (A = 8): 15 X 30 cm; Horizontal (A=6): 30 X 15 cm; Small (A = 10): 15 X
15 cm). The error bars indicate the standard error of the mean. The inset on figure B gives an interpretation of the numerical shape values with a
value of 0 indicating a perfect circle. Shape was calculated using the following equation (dh - dv)/(dh + dv), where dh and dy is the horizontal and
vertical diameter of the web.
were given a week to acclimatize to building webs in standard frames
(30 X 30 X 5 cm) in the laboratory during which they were watered
and fed fruit flies regularly after which their webs were cut into a
single strand with a soldering iron (see Hesselberg 2013 for a more
detailed description of methods). Spiders that built normal-looking
webs nearly daily were included in the experiment, which consisted of
transferring spiders to experimental frames (control frames: 30 X 30
X 5 cm, vertical frames: 15 X 30 X 5 cm, horizontal frames: 30 X 15
X 5 cm and small frames: 15 X 15X5 cm), where they were kept for
three days with any webs being photographed and subsequently
destroyed with a soldering iron as described above. Spiders were given
water but not fed throughout the three-day experimental period. In
the present study I used the spiders that built multiple webs in the
three day period to compare the first web built on day 1 with the
second web built on day 2 or day 3. As only about half the spiders
built three webs, I decided to compare only web 1 and 2. A range of
web parameters were measured from digital photographs using
ImageJ (vl.41. National Institute of Health, USA) and were analysed
with IBM SPSS V. 20 (IBM Corporation 2011) using a significance
level of 5%. The tests performed were either a repeated measures
ANOVA with web number as the within-subject factor and
experimental frame as between-subject factor or a paired t-test.
The main parameters of interest were the area utilization (i.e. the
proportion of the available area in the frame taken up by the capture
spiral) and the shape of the web (Vollrath et al. 1997; Krink &
Vollrath 2000; Hesselberg 2013). As shown in Fig. lA, this study
found only minor and non-significant differences in area utilization
between first and second webs across all four experimental treatments
(repeated measures ANOVA: F(i,25) = 0.12, P = 0.915) but, as
expected, spatially constrained spiders utilized a significantly higher
proportion of the available area than the control spiders (repeated
measures ANOVA: F(3_25) = 5.56, P = 0.005). Similarly, there were
no differences in shape between the first and the second web across
the different experimental frames (repeated measures ANOVA: F(|,25)
= 2.17, P — 0.153) but, as expected, there were significant differences
in shape between webs in the different treatments (repeated measures
ANOVA: F(3,25) = 173.39, P < 0.001), with control and small frames
resulting in almost round webs while the vertical frames had vertically
elongated webs and the horizontal frames had horizontally elongated
webs (Fig. 1 B). The repeated measures ANOVA found no significant
interactions between web number and frame shape for either area
utilization or shape (test results not shown). The similarity of first and
second webs across all the experimental frames was further supported
by the lack of differences between first and second webs in a range of
web parameters for all four treatments (Table 1), except that mesh
height in the horizontal frame was slightly larger in the second web.
In conclusion, the data presented here suggest that E. illicita
immediately adjusts its first orb web to match the experimentally
constrained space with no improvements in shape or area utilization
in the second webs built under the same conditions. Although the
present lack of statistical differences could be attributed to the
relatively small sample size, none of the measured parameters show
any consistent trends towards better adapted, larger or denser second
webs. Eustala illicita therefore appears to rely on activational
behavioral plasticity to adapt its web to spatial constraints, which
the spider probably frequently encounters in its natural habitat. It is
almost exclusively found in relative high densities within the branches ;
of the ant acacia Acacia collinsii, which might give rise to competition
for available space (Hesselberg & Triana 2010; Styrsky 2014). As the
individual spiders grow larger, they are therefore likely to be subject
to fine-grained environmental variation as they move around on the }
acacia in search of suitable web-building sites. Since the spiders used i
in this study were caught in the wild, however, it is possible that the
present behavior is the result of earlier developmental behavioral j
plasticity that has resulted in fixed neural pathways for dealing with
spatial constraints. In this regard the present behavior can be viewed
as an example of context-dependent behavior in that spiders utilize :
earlier learning to adapt their web-building behavior when facing i
similar constraints. Such context-dependent learning has previously i
been found in spiders (Skow & Jakob 2006), although the two very s
different contexts in this study in terms of learning in the complex ;
natural environment and using this learning in the much simpler
artificial environment in the laboratory renders this less likely. I
Finally, there is also the possibility that no learning or plasticity takes
place and that the ability to adapt their webs to spatial constraints is a
passive emergent property of the spider’s web-building behavioral
rules. This, however, is unlikely for the following reasons: the spiders
in this experiment and in others (Vollrath et al. 1997) readily adapt
their webs to many different types of spatial constraints; orb spiders
in general match the size and shape of their webs to their available silk I
resources (Eberhard 1988) and therefore probably gather information
during their exploratory behavior relevant to the size and shape of |
their future webs (Vollrath 1992); and other species of orb spiders,
likely using similar behavioral rules, are unable to adapt their webs to
limited space (Hesselberg 2013). Given the discussion above and
because the present study only investigates learning over a short
period of time for only one situation, that of web-building behavior
in spatial constraints, this study provides a relative weak test for
the role of learning in behavioral plasticity of web-building behavior
generally. However, the activational behavioral plasticity hypothesis
is further supported by the strong either-or response in web-building :
frequency between spiders that match their webs to available space |
(Vollrath et al. 1997) and those that do not (Hesselberg 2013) as well j
as the immediate response in web parameters observed in Cyclosa
octotuherculata (Karsch 1879) to feeding and prey detection '
experiences (Nakata 2007, 2012).To determine whether orb spiders
HESSELBERG— WEB-BUILDING PLASTICITY AND SPATIAL CONSTRAINTS
313
Table 1. — A comparison between first and second webs of Eustala illicita facing spatial constraints. Measures are given as mean ±
standard error.
First web
Second web
Paired r-test
P -value
CONTROL FRAME
Number of webs
5
5
Number of radii
28.8 ± 3.3
31.0 ± 2.2
-1.77
0.151
Number of spirals
32.5 ± 4.7
33.1 ± 4.4
-0.58
0.591
Mesh height (cm)
0.25 ± 0.03
0.24 ± 0.04
0.37
0.733
Vertical assymetry'
-0.51 ± 0.04
-0.54 ± 0.02
0.82
0.458
VERTICAL FRAME
Number of webs
8
8
Number of radii
31.4 ± 1.6
33.1 ± 1.5
-1.07
0.320
Number of spirals
31.9 ± 1.7
29.2 ± 1.8
1.52
0.173
Mesh height (cm)
0.20 ± 0.01
0.20 ± 0.01
-0.73
0.487
Vertical assymetry'
-0.44 ± 0.03
-0.40 ± 0.06
-0.70
0.506
HORIZONTAL FRAME
Number of webs
6
6
Number of radii
33.5 ± 1.4
35.7 ± 1.7
-1.23
0.273
Number of spirals
33.9 ± 2.4
31.7 ± 1.4
1.49
0.193
Mesh height (cm)
0.18 ± 0.01
0.19 ± 0.01
-3.10
0.027*
Vertical assymetry'
-0.45 ± 0.02
-0.47 ± 0.04
Z = -0.67
0.500
SMALL FRAME
Number of webs
10
10
Number of radii
29.2 ± 1.4
29.4 ± 1.3
-0.12
0.907
Number of spirals
25.4 ± 1.6
24.7 ± 1.3
0.49
0.639
Mesh height (cm)
0.17 ± 0.01
0.18 ± 0.01
-1.44
0.184
Vertical assymetry'
-0.42 ± 0.05
-0.37 ± 0.07
-0.85
0.419
' Vertical asymmetry was calculated using the following equation: (ru — ri)/(ru + n), where ru and q are the upper (above hub) and lower (below
hub) web radii. The Wilcoxon Signed Rank test (Z) was used where data could not be normalized.
generally rely exclusively on activational behavioral plasticity, or on a
combination of the two behavioral plasticity mechanisms, to adapt
their behavior to changes in the environment requires further
comparative studies in a range of situations including naturally
occurring ones such as leg loss and experimental ones such as changes
in the magnitude or direction of gravity.
ACKNOWLEDGMENTS
The collection of the original data upon which this study was based
was funded by a Smithsonian Institution Postdoctoral Fellowship.
The author would like to thank William Eberhard for his useful
comments on an earlier version of this paper as well as the very
valuable comments from two anonymous reviewers.
LITERATURE CITED
Ades, C. 1986. A construpao de teia geometrica como programa
comportamental. Ciencia e Cultura 38:760-775.
Barrantes, G. & W.G. Eberhard. 2012. Extreme behavioral adjust-
ments by an orb-web spider to restricted space. Ethology
118:438-449.
Blamires, S.J., Y.-C. Chao, C.-P. Liao & I.M. Tso. 2011. Multiple
prey cues induce foraging flexibility in a trap-building predator.
Animal Behaviour 81:955-961.
Dunlap, A.S. & D.W. Stephens. 2009. Components of change in the
evolution of learning and unlearned preference. Proceedings of the
Royal Society of London. Series B 276:3201-3208.
Eberhard, W.G. 1988. Behavioral flexibility in orb web construction:
effects of supplies in different silk glands and spider size and
weight. Journal of Arachnology 16:295-302.
Eberhard, W.G. 2007. Miniaturized orb-weaving spiders: behavioural
precision is not limited by small size. Proceedings of the Royal
Society of London. Series B 274:2203-2209.
Harmer, A.M.T. & M.E. Herberstein. 2009. Taking it to extremes:
what drives extreme web elongation in Australian ladder web
spiders (Araneidae: Telaprocera maiidae)! Animal Behaviour
78:499-504.
Heiling, A.M. & M.E. Herberstein. 1999. The role of experience in
web-building spiders (Araneidae). Animal Cognition 2:171-177.
Henaut, Y., S. Machkour-M’Rabat & J.-P. Lachaud. 2014. The role
of risk-avoidance strategies during spider-ant interactions. Animal
Cognition 17:185-195.
Hesselberg, T. 2010. Ontogenetic changes in web design in two orb-
web spiders. Ethology 116:535-545.
Hesselberg, T. 2013. Web-building flexibility differs in two spatially
constrained orb spiders. Journal of Insect Behavior 26:283-303.
Hesselberg, T. & E. Triana. 2010. The web of the acacia orb-spider
Eustala illicita (Araneae: Araneidae) with notes on its natural
history. Journal of Arachnology 38:21-26.
Krink, T. & F. Vollrath. 2000. Optimal area use in orb webs of the
spider Araneus diadematus. Naturwissenschaften 87:90-93.
Liao, C.-P., K.-J. Chi & I.-M. Tso. 2009. The effects of wind on trap
structural and material properties of a sit-and-wait predator.
Behavioral Ecology 20:1194-1203.
Mery, F. & J.G. Burns. 2010. Behavioral plasticity: an interaction
between evolution and experience. Evolutionary Ecology 24:
571-583.
Nakata, K. 2007. Prey detection without successful capture affects
spider’s orb-web building behaviour. Naturwissenschaften 94:
853-857.
Nakata, K. 2012. Plasticity in an extended phenotype and reversed up-
down asymmetry of spider orb webs. Animal Behaviour 83:821-826.
Nakata, K. & A. Ushimaru. 2004. Differences in web construction
behavior at newly occupied web sites between two Cyclosa species.
Ethology 110:397^11.
314
THE JOURNAL OF ARACHNOLOGY
Pasquet, A., M. Anotaux & R. Leborgne. 201 1. Loss of legs; is it or
not a handicap for an orb- weaving spider? Naturwissenschaften
98:557-564.
Reed, C.F., P.N. Witt, M.B. Scarboro& D.B. Peakall. 1970. Experience
and the orb web. Developmental Psychobiology 3:251-265.
Skow, C.D. & E.M. Jakob. 2006. Jumping spiders attend to context
during learned avoidance of aposematic prey. Behavioral Ecology
17:34-40.
Snell-Rood. E.C. 2013. An overview of the evolutionary causes and con-
sequences of behavioural plasticity. Animal Behaviour 85:1004-101 1.
Stephens, D.W. 1991. Change, regularity, and value in the evolution
of animal learning. Behavioral Ecology 2:77-89.
Styrsky, J.D. 2014. An orb-weaver spider exploits an ant-acacia
mutualism for enemy-free space. Ecology and Evolution 4:276-283.
Vernier, S., A. Pasquet & R. Leborgne. 2000. Web-building behavior
in the orb-weaving spider Zygiella \-notata: influence of experi-
ence. Animal Behaviour 59:603-611.
Vollrath, F. 1992. Analysis and interpretation of orb spider
exploration and web-building behavior. Advances in the Study of
Behavior 21:147-199.
Vollrath, F., M. Downes & S. Krackow. 1997. Design variability in
web geometry of an orb-weaving spider. Physiology & Behavior
62:735-743.
West-Eberhard, M.J. 2003. Developmental Plasticity and Evolution.
Oxford University Press, New York.
Witt, P.N., M.B. Scarboro, R. Daniels, D.B. Peakall & R.L. Cause.
1977. Spider web-building in outer space: evaluation of records
from the skylab experiment. Journal of Arachnology 4:115-124.
Zschokke, S. & F. Vollrath. 2000. Planarity and size of orb-webs built
by Araneus diadematus (Araneae: Araneidae) under natural and
experimental conditions. Ekologia 19:307-318.
Manuscript received 10 January 2014, revised 7 July 2014.
2014. The Journal of Arachnology 42:315-317
SHORT COMMUNICATION
Development of novel microsatellite markers for the spider genus Loxosceles (Sicariidae) using
next-generation sequencing
Enrfc Planas, Laia Bernaus and Carles Ribera: Institut de Recerca de la Biodiversitat (IRBio) and Departament de
Biologia Animal, Facultat de Biologia, Universitat de Barcelona, Diagonal 643, 08028, Barcelona. E-mail;
cribera@ub.edu
Abstract. We report the step-by-step process of developing de novo microsatellite (SSR) loci in two Loxosceles spider
species. We used reads obtained with next-generation sequencing (Roche 454) to select hundreds of potentially-amplifiable
SSRs. After testing amplification and cross-amplification, we characterized 18 SSRs, 11 of which were polymorphic in
Loxosceles rufescens (Dufour 1820) and seven of which were polymorphic in L. sp. Fuerteventura - Lanzarote. This method
is a relatively fast and economic procedure for the development of fast-evolving nuclear markers in spiders.
Keywords: 454, nuclear markers, cross-amplification, Mediterranean, Canary Islands
Microsatellites (SSRs: simple sequence repeats) are popular
codominant genetic markers used in many areas of research, including
molecular ecology and population genetics. They consist of tandem
repeats of very short nucleotide motifs (1-6 bases long). One property
that makes SSRs attractive for evolutionary studies is their high
mutation rate (Guichoux et al. 2011). However, the technical and
economic effort required for developing de novo SSRs in organisms
for which no or few genomic resources are available (the so-called
non-model organisms) has, until recently, prohibited wide implemen-
tation. The recent emergence of next-generation sequencing technol-
ogies has reduced the economic and technical difficulties associated
with developing SSRs (Santana et al. 2009), and has boosted their
usage in a wide range of organisms, including spiders (Esquivel-
Bobadilla et al. 2013; Parmakelis et al. 2013), a group in which the
development and application of microsatellites has been limited
(Brewer et al. 2014),
In this study, we focused on spiders of the genus Loxosceles
Heineken & Lowe 1832 (Araneae: Sicariidae) from the Mediterranean
Basin and the Canary Islands. Loxosceles rufescens (Dufour 1820) is
considered cosmopolitan (World Spider Catalog 2014), but is native
to the Mediterranean (Gertsch 1967; Duncan et al. 2010; Planas et al.
2014). In this region, several deep mitochondrial lineages have been
detected (Duncan et al. 2010; Planas et al. 2014), some of which lack
geographic structure as a consequence of the confounding effects of
human-mediated transportation. Recently, Planas and Ribera (2014)
discovered an endemic group of seven lineages of Loxosceles spiders
in the Canary Islands. The two easternmost islands in this
archipelago, Fuerteventura and Lanzarote, harbor one of these
identified lineages. Despite the relatively impoverished fauna of
Fuerteventura and Lanzarote, these two islands, together with the
surrounding islets, have been shown to be ideal systems to study
phylogeographical processes (i.e., Bidegaray-Batista et al. 2007;
Macias-Hernandez et al. 2013). Here, we acquired fast-evolving
nuclear loci for the study of fine-scale evolutionary processes in the
Loxosceles species endemic to Fuerteventura - Lanzarote (hereinafter
Loxosceles sp. FV-LZ), and for contrasting the mitochondrial
patterns observed within L. rufescens across the Mediterranean Basin
(Planas et al. 2014).
We used next-generation sequencing to obtain SSRs and describe
the step-by-step process from DNA extraction to characterization of
selected markers. Genomic DNA was extracted from the legs of three
specimens of Loxosceles, two of which belong to two different
evolutionary lineages (A6 and B3; Planas et al. 2014) within L.
rufescens, and a third belonging to Loxosceles sp. FV-LZ, using the
SpeedTools Tissue DNA Extraction Kit (Biotools) following manu-
facturer’s protocols. We conducted pyrosequencing on a Roche Life
Science 454 GS-FLX System at the University of Barcelona's
Scientific-Technical Services. Roche 454 is a next-generation sequenc-
ing technology that obtains larger average fragment sizes, thus
increasing the probability that the fragments containing SSRs have
flanking regions to enable primer design. We pooled samples using
individual multiplex identifiers (MIDs), together with an Echimister
sepositus sample (Garcia-Cisneros et al. 2013), within half a plate
because physical separation decreases the overall number of
sequences obtained. We acquired a total of 143,708 reads with a
mean length of 341.86 bp for Loxosceles sp. FV-LZ, 45,377 (mean
length 313.91 bp) for L. rufescens A6, and 195,081 (mean length
346.24 bp) for L. rufescens B3.
Raw data were processed with the Roche’s 454 pipeline using
default settings for quality control and with seqclean (https://
sourceforge.net/projects/seqclean/) to remove low quality sequences
and contaminants. Sequence reads from duplicated loci and mobile
elements were identified in iQDD (Meglecz et al. 2010) using default
parameters and were excluded from further analyses. We searched for
reads with SSRs using iQDD, and retained those meeting a series of
requirements suggested by Guichoux et al. (2011). Specifically, we
looked exclusively for SSRs with perfect motif repetition, improving
the probability that the SSRs follow a stepwise mutation model. We
searched for SSRs with a minimum of 1 1 repeats in dinucleotides and
eight repeats in tri-, tetra-, penta- and hexanucleotides, but no more
than 16 repeats in both cases. Primers for selected SSRs were designed
with the software PRIMER 3 (Rozen & Skaletsky 2000) included in
iQDD. We avoided designing primers in flanking regions containing
short repeats (e.g., nanosatellites), and we selected putative PCR
products between 90 and 500 bp in length. Among all possible primer
combinations for each SSR, we kept those with better evaluation
based on the penalty score of the primer pairs after applying stringent
parameters to ensure amplification (i.e., no primer-dimer interaction,
similar annealing temperature, GC primer end content, and primer
end stability). The number of reads containing SSR and the number
of those with suitable Hanking PCR-primer sites are shown in
Table 1. Dinucleotides were the most frequent SSR, followed by tri-,
tetra-, penta- and hexanucleotides (Table 1 ). Even after applying
stringent parameters for SSR selection, we obtained over 800 SSRs
that met the requirements specified above. We should note that
relaxed selection criteria rigor (e.g., allowing for a minimum number
315
316
THE JOURNAL OF ARACHNOLOGY
Table 1. — Number of reads containing SSRs and number of potentially ampiifiable SSRs. Individual cells in the table record the number of
reads obtained from each individual (Loxosceles sp. FV-LZ / L. nifesceiis A6 / L. rufescens B3).
Dinucleotides
Trinucleotides
Tetranucleotides
Pentanucleotides
Hexanucleotides
Reads containing SSRs
Reads with potentially
3525/961/4261
334/141/673
38/34/181
3/0/6
0/0/1
ampiifiable SSRs
327/107/206
37/21/87
1/1/7
1/0/5
0/0/0
of eight tandem repeats) would have increased substantially the number
of yielded SSRs. We selected 58 among the hundreds of candidate SSRs,
considering the length of the expected PCR product. We then tested
their amplification and cross-amplification success in eight individuals,
four from L. rufescens and four from L. sp. FV-LZ. That is, we tested
SSRs obtained from reads of L. rufescens for amplification in L. sp. FV-
LZ individuals and vice versa. Of the 58 SSRs tested, 40 were rejected
because PCR amplification was unsuccessful.
We retained the 1 8 SSR loci with higher amplification success and
labeled the forward primers with fluorescent dye. We tested for
polymorphism using 38 L. rufescens individuals from four different
localities, and 16 Loxosceles sp. FV-LZ individuals from four
different localities. We conducted PCR reactions in a final volume
of 10 pL using Biotools Pfu DNA Polymerase (Biotools). Annealing
temperatures ranged between 42° and 58° C for all primer pairs. We
pooled PCR products according to dye type and expected allele size
ranges, and genotyped them in an ABI 3730XLs automated sequencer
at Macrogen (Seoul) with the internal size standard 500 LIZ. We used
the Microsatellite Plugin 1.3 in Geneious 6.1.6 (Biomatters) for allele
calling. For each locus, the primer sequences, number of alleles (Na),
and observed (Hq) and expected (He) heterozygosity are listed in
Table 2.
All but one SSR were polymorphic for at least one of the two
species analyzed. One SSR (ME083) obtained from L. rufescens reads
Table 2. — Characteristics of 18 microsatellite loci, tested with 38 samples of Loxosceles rufescens from four different localities, and 16 samples
of Loxosceles sp. FV-LZ from four different localities. Locus name, accession number, repeat motif and primer sequences (F: forward, R:
reverse) are listed for each locus. In the last four columns of the table, L. rufescens data are presented in the first row for total number of alleles,
allele size (bp), expected heterozygosity (He) and observed heterozygosity (Ho), and Loxosceles sp. FV-LZ in the second row.
Locus
Accession
number
Repeat motif
Primer sequence (5 '-3')
Total number
of alleles
Allele size
(bp)
Ho
He
ME0I2
KM879453
(AGAT)
F: GTGGGTGGTCCATTGATAGG
8
137-165
0.57
0.77
R: TTTAACAAGACGCAGCGAAA
-
-
-
-
ME031
KM879448
(AAAT)
F: AAACTTCGATTTATTTTGTTTCTTG
4
89-109
0.19
0.66
R: AAATGTCTGGCGGATCAGAA
-
-
-
-
ME034
KM879450
(AAAT)
F: CGTCTGCAGTGTGAACGG
6
93-149
0.47
0.71
R: ATATGTGCTTTTGCGCCTGT
-
-
-
-
ME064
KM879451
(AAAT)
F: TCTGTAAATGGATTCTCATCTGTTG
2
151-155
0.13
0.12
R: TCGTCCAACCATCCTCTTTC
-
-
-
-
ME067
KM879446
(AGAT)
F: TGTGATGTACCTGCGTTCGT
4
142-160
0.11
0.10
R: GCAAGATCAACCCACAACCT
-
-
-
-
ME077
KM879454
(AAACT)
F: TATGTAATCACCGGGGTTGG
3
152-177
0.21
0.55
R: CGTGCAATCTGGTTAACTTCG
-
-
-
-
ME083
KM879445
(ACACT)
F: TAGGGAATGGAATGGCAGAC
1
160-160
0
0
R: TTTGCAGATTTGATCTGGGAC
1
163-163
0
0
ME088
KM879449
(AAAT)
F: AGCGTTGATACAGGTGGTCC
3
208-254
0.10
0.59
R: TCACTGCACAGTGTAAAGCCA
-
-
-
-
ME103
KM879452
(AAT)
F: TTAGCGACCTTCCCTGTCAC
6
262-280
0.34
0.73
R: TGGTAAACGGGAGGACTAGG
-
-
-
-
ME113
KM879447
(AAT)
F: AACCTGAAGGGCTGATGAAT
6
75-96
0.37
0.78
R: CAGGAGCAGGATGCCATATT
-
-
-
-
CAOOl
KM879461
(AAT)
F: ATGTATCACGCGCCTTTTG
-
-
-
-
R: GTTGTCTGGAGCAAACAGCA
5
75-93
0.60
0.72
CA003
KM879460
(AAT)
F: TGTACCAGGGGCTGGTCTAA
-
-
-
-
R: CATACGTGGTGGCAGCATAC
5
66-92
0.28
0.73
CA027
KM879457
(AAGTG)
F; TACCACAAGGGGAGAATCCA
3
103-113
0.39
0.32
R: AAGCCAGAGGTGCAATTGTT
10
132-182
0.40
0.79
CA030
KM879462
(AAT)
F: AGGTGTGGCACTACCGTTTT
-
-
-
-
R: CAAATGAGCATTCAACCTCG
7
133-157
0.46
0.70
CA038
KM879458
(AAT)
F: ATGTTTGAGGGGTCTCGTTG
-
-
-
-
R: ACATGATGCCCCACGATAAT
4
272-284
0.93
0.69
CA105
KM879455
(AC)
F: TAAATAACCTGATATCGGATCTATGAC
-
-
-
-
R: AAAGTATATCGGACAAACATCCAACC
5
255-267
0.75
0.75
CA238
KM879459
(AG)
F: GGCACCCCAGACTAACAAGA
1
233-233
0.00
0.00
R: ACCTCTGGCACGAATACACC
4
221-231
0.93
0.69
CA243
KM879456
(AT)
F: AATAACGGAGACCGTGCAAC
5
225-279
0.68
0.64
R: CCTCCAGTATCCGAAGACGA
-
-
-
-
PLANAS ET AL.— MICROSATELLITE MARKERS FOR LOXOSCELES
317
amplified successfully in Loxosceles sp. FV-LZ individuals, although
it was monomorphic in both species. Three SSRs obtained from L. sp.
FV-LZ reads amplified successfully in L. rufescens, and was
monomorphic in one locus (CA238) and polymorphic in the other
two loci (CA027 and CA243). In total, 11 polymorphic SSRs were
developed for L. rufescens and seven for L. sp. FV-LZ.
Results from this study suggest that next-generation sequencing is
an efficient and cost-effective procedure for the fast development of
microsatellite loci in spiders. Despite the close phylogenetic relation-
ship of the two species used in this study {Planas & Ribera 2014), the
cross-amplification rate for the microsatellites was low. The few SSRs
that cross-amplified successfully were found to be monomorphic or
less polymorphic in the species from which they were not initially
obtained (except for CA243). Thus, we advise developing specific
microsatellites for each target species. We obtained thousands of
reads by sequencing three Loxosceles specimens in half a Roche 454
plate, and we used a fast bioinformatic pipeline applying stringent
selection criteria to identify hundreds of potentially amplifiable SSRs.
Although 454 sequencing was preferred for the longer read lengths
obtained which facilitates the design of PCR primers, a similar
approach for SSR development has been successfully implemented
using alternative, more cost-effective sequencing technologies (i.e.,
Illumina) (Castoe et al. 2012, but see Drechsler 2013).
ACKNOWLEDGMENTS
We are grateful to B. Fuste, A. Garcia-Cisneros and R. Perez-
Portela for providing advice during the initial steps of the study, and
M. Metallinou and E.E. Saupe for reviewing language usage. Funding
for this research was provided by CGL2008-03385 Project (Ministerio
de Ciencia y Tecnologia, Spain). E.P. was supported by a FPI grant
from the Ministerio de Ciencia y Tecnologia, Spain (BES-2009-
015871).
LITERATURE CITED
Bidegaray-Batista, L., N. Macias-Hernandez, P. Oromi & M.A.
Arnedo. 2007. Living on the edge: demographic and phylogeo-
graphical patterns in the woodlouse-hunter spider Dysdera
kmcerotensis Simon, 1907 on the eastern volcanic ridge of the
Canary Islands. Molecular Ecology 16:3198-3214.
Brewer, M.S., D.D. Cotoras, P.J. Croucher & R.G. Gillespie. 2014.
New sequencing technologies, the development of genomics tools,
and their applications in evolutionary arachnology. Journal of
Arachnology 42:1-15.
Castoe, T.A., A.W. Poole, A.P.J. de Koning, K.L. Jones, D.F.
Tomback & S.J. Oyler-McCance et al. 2012. Rapid microsatellite
identification from Illumina paired-end genomic sequencing in two
birds and a snake. PloS One 7:e30953.
Drechsler, A., D. Geller, K. Freund, D.S. Schmeller, S. Kiinzel & O.
Rupp et al. 2013. What remains from a 454 run: estimation of
success rates of microsatellite loci development in selected newt
species (Calotriton asper, Lisso triton helveticus, and Tritiirus
cristatus) and comparison with Illumina based approaches.
Ecology and Evolution 3:3947-3957.
Dufour, L. 1820. Descriptions de cinq arachnides nouvelles. Amiales
Generales des Sciences Physiques 5:198-209.
Duncan, R.P., M.R. Rynerson, C. Ribera & G.J. Binford. 2010.
Diversity of Loxosceles spiders in Northwestern Africa and
molecular support for cryptic species in the Loxosceles rufescens
lineage. Molecular Phylogenetics and Evolution 55:234-248.
Esquivel-Bobadilla, S., O.A. Lozano-Garza, F.J. Garcia-De-Leon,
I.D.L.A. Barriga-Sosa & M.L. Jimenez. 2013. Development and
characterization of 14 microsateliite loci in the beach wolf spider
[Arctosa littoralis), using next-generation sequencing. Conserva-
tion Genetics Resources 5:261-263.
Garcia-Cisneros, A., C. Valero-Jimenez, C. Palacin & R. Perez-
Portela. 2013. Characterization of thirty two microsatellite loci for
three Atlanto-Mediterranean echinoderm species. Conservation
Genetics Resources 5:749-753.
Gertsch, W.J. 1967. The spider genus Loxosceles in South America
(Araneae, Scytodidae). Bulletin of the American Museum Natural
History 136:117-174.
Guichoux, E., L. Lagache, S. Wagner, P. Chaumeil, P. Leger & O.
Lepais et al. 2011. Current trends in microsateliite genotyping.
Molecular Ecology Resources 11:591-611.
Lowe, R.T. 1832. Descriptions of two species of Araneidae, natives of
Madeira. The Zoological Journal 5:320-323.
Macias-Hernandez, N., L. Bidegaray-Batista, P. Oromi & M.A.
Arnedo. 2013. The odd couple: contrasting phylogeographic
patterns in two sympatric sibling species of woodlouse-hunter
spiders in the Canary Islands. Journal of Zoological Systematics
and Evolutionary Research 5:29-37.
Meglecz, E., C. Costedoat, V. Dubut, A. Gilles, T. Malausa & N.
Pech et al. 2010. QDD: a user-friendly program to select
microsateliite markers and design primers from large sequencing
projects. Bioinformatics 26:403-404.
Parmakelis, A., K. Balanika, S. Terzopoulou, F. Rigal, R.R. Beasley
& K.L. Jones et al. 2013. Development of 28 polymorphic
microsateliite markers for the endemic Azorean spider Sancus
acoreensis (Araneae, Tetragnathidae). Conservation Genetics
Resources 5:1133-1134.
Planas, E. & C. Ribera. 2014. Uncovering overlooked island diversity:
colonization and diversification of the medically important spider
genus Loxosceles (Arachnida: Sicariidae) on the Canary Islands.
Journal of Biogeography 41:1255-1266.
Planas, E., E.E. Saupe, M.S. Lima-Ribeiro, A.T. Peterson & C.
Ribera. 2014. Ecological niche and phylogeography elucidate
complex biogeographic patterns in Loxosceles rufescens (Araneae,
Sicariidae) in the Mediterranean Basin. BMC Evolutionary
Biology 14:195.
Rozen, S. & H. Skaletsky. 2000. Primer3 on the WWW for general
users and for biologist programmers. Methods Molecular Biology
132:365-386.
Santana, Q.C., M.P. Coetzee, E.T. Steenkanip, O.X. Mlonyeni, G.N.
Hammond & M.J. Wingfield et al. 2009. Microsateliite discovery
by deep sequencing of enriched genomic libraries. Biotechniques
46:217-223.
World Spider Catalog. 2014. World Spider Catalog, Version 15.5.
Natural History Museum Bern. Online at http://wsc.nmbe.ch
Manuscript received 19 December 2013, revised 17 September 2014.
2014. The Journal of Arachnology 42:318-321
SHORT COMMUNICATION
Pre-ballooning in Ummidia Thorell 1875 (Araneae: Ctenizidae) from the Interior Highlands, USA:
second accoont from the region and review of mygalomorph ballooning
J. Ray Fisher, Danielle M. Fisher, Michael J. Skvarla and Ashley P. G. Dowling: Department of Entomology, University
of Arkansas, Fayetteville, Arkansas, 72701, USA. Email: jrfisher@uark.edu
Abstract. The present study represents the second record of pre-ballooning behavior in Arkansas Ummidia Thorell 1875
(Ctenizidae). Mygalomorph ballooning is discussed and our observations are compared with previous authors’
observations. Photographs and video of the behavior are included. Images and discussion are provided detailing genus-
level identification of the spiderlings.
Keywords: Trapdoor spider, aerial dispersal, videography
Although most non-araneomorph spiders do not disperse aerially
like many araneomorphs, ballooning has been recorded from
mygalomorphs in three families. Bel! (2005) reviewed ballooning
accounts across arthropods and listed five mygalomorph ballooners:
Missulena insignis (Cambridge 1877) (Actinopodidae); Atypus affinis
Eichwald 1830 and Sphodros atkmticus Gertsch & Platnick 1980
(Atypidae); and Conothele malayana (Doleschall 1859) and Ummidia
Thorell 1875 (Ctenizidae). This list combined accounts of confirmed
ballooning (M insignis [Main 1976, 1981; Brunet 1994]; 5. atlanticus
[Coyle 1983, Coyle et al. 1985]; and an unidentified Ummidia [Coyle
1985]), as well as pre-ballooning accounts without observed
ballooning (A. affinis [Enock 1885; Bristowe 1941]; S. rufipes
(Latreille 1829) [Muma & Muma 1945]; C. malayana [Main 1957,
1976]; and U. carabivora (Atkinson 1886) [Baerg 1928]). Additionally,
Eberhard (2005) described ballooning in Costa Rican Ummidia. Main
(1981) noted the oddity that Missulena Walckenaer 1805 and
Actinopus Perty 1833 have similar distributions across Australia,
even though Actinopus was not known to balloon. Solving this
mystery and adding to the list of ballooning mygalomorphs, Ferretti
et al. (2013) confirmed ballooning in an unidentified Actinopus. Most
of these species have in common large ranges that cross water
barriers, including accounts on islands (e.g., Ummidia from St.
Vincent [Simon 1891]; Conothele from Pacific Islands and Seychelles
[Pocock 1898; Berlaiid 1938; Roewer 1963, Saaristo 2002]).
The present study provides information for Ummidia, which are the
most common ctenizids in the eastern U.S. They are immediately
identifiable by a dorsal saddle-shaped indention on the third tibiae,
which has been suggested to aid in securing them in the burrow (Coyle
1981). There are 25 described species of Ummidia, with 18 in the New
World (10 USA, five Centra! America, three South America) and
seven in the western Mediterranean (Platnick 2014). However,
perhaps as many as 100 (Platnick, via Bond & Coyle 1995) are left
undescribed (Bond & Hendrixson 2005). The trans-Atlantic distribu-
tion has traditionally been considered the result of human introduc-
tion, but this hypothesis was recently rejected with molecular evidence
(Opatova et al. 2013). Instead, Ummidia were likely widespread in
Laurasia, rendering Old World species much older than previously
suspected. Interestingly, unlike other organisms, New and Old World
lineages diverged later than the breakup of Laurasia, which the
authors attributed to gene flow on either side of the newly opening
Atlantic ocean due to the ability of Ummidia to disperse by
ballooning. A related genus, Conothele, has a non-overlapping
Australasian distribution and the characters differentiating Conothele
from Ummidia are variable (Main 1985), leaving geography and
burrow construction as the best distinguishers (Haupt 2005; Decae
2010). Further, the molecular analyses of Opatova et al. (2013) ji
showed only a small amount of divergence between Conothele and j
Ummidia. In short, there is great need for a revision of New World jj
Ummidia, as well as phylogenetic investigation of the generic complex [
{Conothele -t Ummidia), at which point, Conothele will likely be !
lumped with Ummidia. Ballooning by Conothele spiderlings is
currently unknown.
Field photographs and video were taken with an iPhone 4S, which '
was the only camera available at the time, highlighting an example of '
such technology used for natural history. Video taken of this behavior
can be found at https://www.youtube.com/watch?v=gleB4sIrDQw. [
The video was compiled with Adobe Premiere Pro CS6. Morpholog- E
ical images were montaged from many stereomicrographs (20-30 for t
habitus and 8-14 for appendages) using Helicon Focus 6. !|
Following the accounts of Baerg (1928), this study presents the i|
second record of pre-ballooning behavior of Arkansas Ummidia. On i[
the afternoon (15:00-16:00) of 22 March 2014, on a trail that |
paralleled a paved road (100-200 m away) at Devil’s Den State Park,
Arkansas (35° 46' 51.54"N 94° 15' 22.74"W; elev. 395 m), six Ummidia \
spiderlings were observed climbing an oak (Qiiercus, Diameter at |
Breast Height (DBH) approx. 24 cm) on a vertical 2-6 mm wide silk
band. The silk band rose approximately 6 m along the trunk and then
continued along a horizontal limb where it bifurcated several times
and was eventually lost after about 2 m (Fig. lA, C). The observation
spanned approximately 30 min, although all six spiderlings were
discovered in the first 5 min. The oak was atop a steep slope that
overlooked a valley and was therefore exposed to wind gusts *
(Fig. IB). Other conditions were as follows: 13°-15°C; wind 1.8- j
4.5 m/s; recently turned cloudy, prior to light rain. At the base of the j.
tree the silk band apered to a few strands, where it was soon lost; not j
even single-strands could be found (Fig. IE). Although we have I
previously found Ummidia burrows on steep slopes in the area,
careful examination of the area surrounding the ballooning tree failed
to uncover either the maternal burrow, or ground silk trails.
Ballooning spiderlings were not directly observed, but this silk [
band-making behavior as an antecedent to ballooning in Ummidia is [
well known (Coyle 1985, Eberhard 2005). [
Most of these observations conform to what has been previously ^
described for Ummidia by Baerg (1928) and Coyle (1985). Compared
with most observations of mygalomorph ballooning, the pre- ;
ballooning bands observed by Baerg (1928) in Arkansas were much |
longer both horizontally on the ground leading from the maternal
burrow to the ballooning tree (3-21 m; 8.5 m avg.) and vertically
along the ballooning tree (4-9 m). For example, the band observed by [
Coyle (1985) was only 0.9 m vertically on a tombstone and 1.5 m |
318
FISHER ET AL.— PRE-BALLOONING IN UMMIDIA SPIDERS
319
Figure 1. — Ballooning site. A. south-facing view of ballooning tree overlooking the valley; B. east-facing view of ballooning tree depicting
steep slope; C. pre-ballooning silk band on trunk, leading to horizontal limb; D. spiderling climbing pre-ballooning band; E. base of tree showing
pre-ballooning band diffusing quickly into litter. Red arrows indicate ballooning limb.
horizontally on the ground. Our observations are similar to Baerg's in
the following ways; emergence date (15-22 March); silk band width
(2 mm) and height (4-9 m); silk band ending on a horizontal limb;
and tree size (not less than 15 cm DBH). The present observation
occurred in the afternoon and Baerg (1928) described primarily
morning activity ending mid-day. However, given the sparse activity
and well-developed silk band, we suspect these individuals represent-
ed the last members of a ballooning event.
Steep slopes of sparsely wooded, disturbed habitats are commonly
noted as preferred Unimidia habitat. Baerg (1928) made many pre-
ballooning observations over several years on the University of
Arkansas (UA) campus, which certainly was disturbed and sparsely
wooded, but lacked steep slopes. Despite continued searching over
five years, we failed to find either burrows or ballooning spiderlings in
the area surrounding campus, which suggests a significantly
diminished population since 1928. However, we have found many
Unuuidia burrows on steep slopes in second-growth oak/hickory
forest of northwestern Arkansas, including at Devil’s Den State Park.
The presence of pre-ballooning behavior similar to Baerg’s observa-
tions (i.e., long silk trails) in naturalized forest, which is much less
open than UA’s campus, confirms the use of this method outside of
an urbanized setting. That said, because of the position of the
ballooning tree (Fig. lA, B) and time of year (i.e., pre-bud-break),
once acquiring their position on the horizontal limb, the spiderlings
were functionally in an open area for ballooning.
With regard to identification, Baerg (1928) suggested that U.
carahivora, known from the east coast, was actually widespread in the
U.S. and identified his Arkansas specimens as this species. Indeed, as
discussed above, aerial dispersal does enable large distributions.
However, several pieces of evidence suggest that the spiderlings we
320
THE JOURNAL OF ARACHNOLOGY
Figure 2. — Spiderling genus-level identification. A. dorsal habitus; B. lateral prosoma (right appendages removed), note ocular tubercle
(arrow); C. pedipalp, note single clavate trichobothriimi (dotted arrow) and ventral curvy spines (arrows); D. leg III, note trochanteral apophysis
(dotted arrow) and tibial depression (arrow); E. eye group. Not to scale.
observed may not be U. carabivora. First, Ummidia is already
suspected to contain considerable undescribed diversity. Second,
specimens from this region exhibit longer pre-ballooning bands than
what has been previously described for the genus. And third, the
Interior Highlands are known to have a high rate of endemism
(Redfearn 1986; Allen 1990; Robison & Allen 1995; Skvarla et al.
2013), but these endemics are often overlooked by surveys and
specimens from the region are rarely included in phylogenetic
analyses. Ultimately, a large-scale, integrative investigation of the
genus in the New World is needed before confidence in species
identification is warranted. Therefore, we refrain from suggesting
species identification at this time, but offer the following discussion
on genus-level identification of juvenile Ummidia.
Juvenile morphology in most animals (including spiders) is regularly
overlooked, despite juveniles of certain taxa being frequently noticed and
collected. This is evidenced by the prevalence of amateur naturalists not
only photographing spiderlings, but also documenting pre-ballooning
behavior in Ummidia on websites like Flickr.com and Bugguide.net.
However, we are not aware of primary literature containing useable
information on the identification of Ummidia immatures.
Decae (2010) lists five characteristics that differentiate ummidiines
{Ummidia -h Conothele) from other ctenizids as follows: 1) proximal
dorsal glaborous depression on tibia III; 2) sharp apophysis on
dorsolateral trochanter III; 3) dorsal clavate trichobothria on tarsi; 4)
lateral curvy spines on distal podomeres of leg I, II, and pedipalps;
and 5) compact eye-group (Fig. 2E) on an ocular tubercle (Fig. 2B).
Each of these characters is apparent in the spiderling, although the
trochanteral apophysis (Fig. 2D) and curvy spines (Fig. 2C) are not
fully developed. Additionally, clavate trichobothria are absent from
the legs, but a single clavate trichobothrium (Fig. 2C) is present on
pedipalpal tarsi and is proportionally larger than on adult specimens.
Noteworthy are the readily apparent tibial depressions commonly
implemented as a diagnostic character for adults (Fig. 2D).
LITERATURE CITED
Allen, R.T. 1990. Insect endemism in the Interior Highlands of North
America. Florida Entomologist 73:539-569.
Baerg, W.J. 1928. Some studies of a trapdoor spider (Araneae:
Aviciilariidae). Entomological News 39:1^.
FISHER ET AL.— PRE-BALLOONING IN UMMIDIA SPIDERS
Bell, J.R., D.A. Bohan, E.M. Shaw & G.S. Weyman. 2005.
Ballooning dispersal using silk: world fauna, phylogenies, genetics
and models. Bulletin of Entomological Research 95:69-1 14.
Berland, L. 1938. Araignees des Nouvelles Hebribes. Annales de la
Societe Entomologique de France 107:129-131.
Bond, J.E. & F.A. Coyle. 1995. Observations on the natural history of
an Ummidia trapdoor spider from Costa Rica (Araneae, Ctenizi-
dae). Journal of Arachnology 23:157-164.
Bond, J.E. & B.E. Hendrixson. 2005. Pp. 43^4. In Spiders of North
A,merica: an identification manual. (D. Ubick, P. Paquin, P.E.
Cushing & V. Roth, eds.). American Arachnological Society.
Bristowe, W.S. 1941. The Comity of Spiders. Ray Society, London.
Brunet, B. 1994. The Silken Web. Reed Books, Sydney.
Coyle, F.A. 1981. Notes on the behaviour of Ummidia trapdoor
spiders (Araneae, Ctenizidae): burrow construction, prey capture,
and the functional morphology of the peculiar third tibia. Bulletin
of the British Arachnological Society 5:159-165.
Coyle, F.A. 1983. Aerial dispersal by mygalomorph spiderlings
(Araneae, Mygalomorphae). Journal of Arachnology 11:283-286.
Coyle, F.A. 1985. Ballooning behavior of Ummidia spiderlings
(Araneae, Ctenizidae). Journal of Arachnology 13:137-138.
Coyle, F.A., M.H. Greenstone, A-L. Hultsch & C.E. Morgan. 1985.
Ballooning mygalomorphs: estimates of the masses of Sphodros
and Ummidia ballooners (Araneae: Atypidae, Ctenizidae). Journal
of Arachnology 13:291-296.
Decae, A.E. 2010. The genus Ummidia Thorell 1875 in the western
Mediterranean, a review (Araneae: Mygalomorphae: Ctenizidae).
Journal of Arachnology 38:328-340.
Eberhard, W.G. 2005. Dispersal by Ummidia spiderlings (Araneae,
Ctenizidae): ancient roots of aerial webs and orientation? Journal
of Arachnology 34:254-257.
Enock, F. 1885. The life-history of Atypus piceus, Sulz. Transactions
of the Entomological Society of London 1885:389-420.
Ferretti, N., G. Pompozzi, S. Copperi & L. Schwerdt. 2013. Aerial
dispersal by Actimpus spiderlings (Araneae: Actinopodidae).
Journal of Arachnology 41:407^08.
Haupt, J. 2005. On the taxonomic position of the East Asian species
of the genus Ummidia Thorell, 1875 (Araneae: Ctenizidae).
European Arachnology. In European Arachnology 2005. (C.
Deltshev & P. Stoev, eds.). Acta Zoologica Bulgarica, Supple-
mentum 1:77-79.
Main, B.Y. 1957. Occurrence of the trap-door spider Conothele
malayana (Doleschall) in Australia (Mygalomorpha: Ctenizidae).
Western Australian Naturalist 5:209-216.
321
Main, B.Y. 1976. Spiders. Collins, Sydney.
Main, B.Y. 1981. Australian spiders: diversity, distribution and
ecology. Pp. 808-852. In Ecological Biogeography of Australia.
(A. Keast, ed.). Junk, The Hague.
Main, B.Y. 1985. Further studies on the systematics of ctenizid
trapdoor spiders: a review of the Australian genera (Araneae:
Mygalomorphae: Ctenizidae). Australian Journal of Zoology,
Supplement 108:1-84.
Muma, M.H. & K.E. Muma. 1945. Biological notes on Atypus bicolor
Lucas (Arachnida). Entomolgical News 56:122-126.
Opatova, V., J.E. Bond & M.A. Arnedo. 2013. Ancient origins of the
Mediterranean trap-door spiders of the family Ctenizidae (Ara-
neae, Mygalomorphae). Molecular Phylogenetics and Evolution
69:1135-1145.
Pocock, R.I. 1898. Scorpions, pedipalpi and spiders collected by Dr.
Willey in New Britain, the Salomon Islands, Loyalty Islands etc. In
Willey A. Zoological results based on material from New Britain,
New Guinea, Loyalty Islands and elsewhere, collected during the
years 1895, 1896 and 1897, by Arthur Willey. Vol. I. University
Press, Cambridge.
Platnick, N.I. 2014. The world spider catalog, version 15. American
Museum of Natural History, Online at http://research.amnh.org/
entomology/spiders/catalog/index.html DOI: 10.553 1/db.iz. 0001 .
Redfearn, P.L., Jr. 1986. Bryogeography of the Interior Highlands of
North America: taxa of critical importance. Bryologist 89:32-34.
Robison, H.W. & R.T. Allen. 1995. Only in Arkansas. A Study of the
Endemic Plants and Animals of the State. The University of
Arkansas Press, Fayetteville, Arkansas.
Roewer, C.F. 1963. Araneina: Orthognatha, Labidognatha. Insects of
Micronesia 3:104-132.
Saaristo, M.I. 2002. New species and interesting new records of
spiders from Seychelles (Arachnida, Araneaea [sic]). Phelsuma 10,
Supplement: A 1-31.
Simon, E. 1891. On the spiders of the island of St. Vincent. Part 1.
Proceedings of the Zoological Society of London 1891:549-575.
Skvarla, M.J., J.R. Fisher & A.P.G. Dowling. 2013. On some mites
(Acari: Prostigmata) from the Interior Highlands: descriptions of
the male, immature stages, and female reproductive system of
Pseiidocheylus ameri twins (Ewing, 1909) and some new state
records for Arkansas. Zootaxa 3641:401-419.
Manuscript received 15 July 2014, revised 11 September 2014.
2014. The Journal of Arachnology 42:322-323
INSTRUCTIONS TO AUTHORS
(revised November 2014)
General: The Journal of Arachnology publishes scientific
articles reporting novel and significant observations and data
regarding any aspect of the biology of arachnid groups. Feature
articles and short communications must be scientifically rigorous
and report substantially new infomiation. Submissions that are
overly narrow in focus (e.g., local faunal lists, descriptions of a
second sex or of a single species without additional discussion of
the significance of this infomiation), have poorly substantiated
observational data, or that present no new information will not
be considered. Book reviews will not be published.
Manuscripts must be in English and should be prepared in
general accordance with the current edition of the Council of
Biological Editors Style Manual unless instructed otherwise
below. Use the active voice throughout. Authors should
consult a recent issue of the Journal of Arachnology for
additional points of style. Manuscripts longer than three
printed journal pages (12 or more double-spaced manuscript
pages) should be prepared as Feature Articles, shorter papers
as Short Communications. Review Articles will be published
from time to time. Suggestions for review articles may be sent
to the Managing Editor. Unsolicited review articles are also
welcomed. All review articles will be subject to the same review
process as other submissions.
Submission: Submissions must be sent electronically in
Microsoft Word foraiat (not PDF) to the Managing Editor of
the Journal of Arachnology: Richard S. Vetter, Managing Editor,
Department of Entomology, University of California, Riverside,
CA USA 92521 [E-mail: rick.vetter(@ucr.edu]. The entire
manuscript should be submitted as one Word document.
Figures, included in the Word document, should be at low
resolution for the initial review.
The Managing Editor will acknowledge receipt of the
manuscript, assign it a manuscript number and forward it to
an Associate Editor for the review process. Correspondence
relating to manuscripts should be directed to the Associate
Editor and should include the manuscript number. If the
manuscript is accepted, the author will be asked to submit the
final copy electronically to the Associate Editor. Submission
of final illustrations is detailed below. Authors are expected to
return revisions promptly. Revised manuscripts that are not
returned in a reasonable time period (no longer than six
months for minor revisions and one year for major revisions)
will be considered new submissions.
Voucher Specimens: Specimens of species used in your
research should be deposited in a recognized scientific institu-
tion. All type material must be deposited in a recognized
collection/institution.
FEATURE ARTICLES
Title page. — The title page includes the complete name,
address, and telephone number of the corresponding author; a
FAX number and electronic mail address if available; the title
in sentence case, with no more than 65 characters and spaces
per line in the title; each author’s name and address; and the
running head.
Running head. — The author’s surname(s) and an abbreviat-
ed title should be typed in all capital letters and must not i:
exceed 60 characters and spaces. The running head should be
placed near the top of the title page.
Abstract. — Length: < 250 words for Feature Articles; <150 ■
words for Short Communications.
Keywords. — Give 3-5 appropriate keywords or phrases
following the abstract. Keywords should not duplicate words
in the title.
Text. — Double-space text, tables, legends, etc. throughout. ;
Except for titles and headers, all text should be left-justified. |'
Add line numbers, continuous from the first page. Three levels !
of heads are used.
• The first level (METHODS, RESULTS, etc.) is typed in i
capitals and centered on a separate line. '
• The second level head begins a paragraph with an indent :i
and is separated from the text by a period and a dash. ■
• The third level may or may not begin a paragraph but is ■
italicized and separated from the text by a colon. "
Use only the metric system unless quoting text or refe- ''
Fencing collection data. If English measurements are used when I
referencing collection data, then metric equivalents should also j
be included parenthetically. All decimal fractions are indicated i
by a period (e.g., —0.123). Include geographic coordinates for
collecting locales if possible, using one of the following formats: I
0°12'32"S, 29°52'17"E or 0.2089°S, 29.8714°E. i
Citation of references in the text: Cite only papers already
published or in press. Include within parentheses the surname
of the author followed by the date of publication. A comma
separates multiple citations by the same author(s) and a
semicolon separates citations by different authors, e.g., (Smith j
1970), (Jones 1988; Smith 1993), (Smith & Jones 1986, 1987; 1
Jones et al. 1989). Include a letter of permission from any |
person who is cited as providing unpublished data in the form :
of a personal communication. ;
Citation of taxa in the text: Include the complete taxonomic
citation (author & year) for each arachnid taxon when it
first appears in the abstract and text proper. For example,
Araneus diadematus Clerck 1757. For Araneae, this information
can be found online at www.wsc.nmbe.ch. Citations for ,
scorpions can be found in the Catalog of the Scorpions of the S
World (1758-1998) by V. Fet, W.D. Sissom, G. Lowe & ^
M.E. Braunwalder. Citations for the smaller arachnid orders
(pseudoscorpions, solifuges, whip scorpions, whip spiders, i;
schizomids, ricinuleids and palpigrades) can be found at museum.
wa.gov.au/catalogues-beta/. Citations for some species of Opiliones j
can be found in the Annotated Catalogue of the Laniatores of the li
New World (Araclmicki, Opiliones) by A.B. Kury. |
Literature Cited. — Use the following style and fonnatting
exactly as illustrated; include the full unabbreviated journal i
title. Personal web pages should not be included in Literature
Cited. These can be cited within the text as (John Doe, pers. !
website) without the URL. Institutional websites may be 1
included in Literature Cited. If a citation includes more than ,
322
INSTRUCTIONS TO AUTHORS
323
six authors, list the first six and add “et al.” to represent the
others.
Binford, G. 2013. The evolution of a toxic enzyme in sicariid
spiders. Pp. 229-240. In Spider Ecophysiology. (W.
Nentwig, ed.). Springer-Verlag, Heidelberg.
Cushing, P.E., P. Casto, E.D. Knowlton, S. Royer, D. Laudier,
D.D. Gaffm et al. 2014. Comparative morphology and
functional significance of setae called papillae on the pedipalps
of male camel spiders (Arachnida, Solifugae). Annals of the
Entomological Society of America 107:510-520.
Harvey, M.S. & G. Du Preez. 2014. A new troglobitic
ideoroiicid-pseudoscorpion (Pseudoscorpiones: Ideoroncidae)
from southern Africa. Journal of Arachnology 42:105-1 10.
Platnick, N.I. 2014. The World Spider Catalog, Version 15.0.
American Museum of Natural History, New York. Online
at http ://research . amnh . org/iz/spiders/catalog/
Roewer, C.F. 1954. Katalog der Araneae, Volume 2a. Institut
Royal des Sciences Naturelles de Belgique, Bruxelles.
Rubio, G.D., M.O. Arbino & P.E. Cushing. 2013. Ant
mimicry in the spider Myrmecotypus iguazu (Araneae:
Corinnidae), with notes about myrmecomorphy in spiders.
Journal of Arachnology 41:395-399.
Footnotes. — Footnotes are permitted only on the first printed
page to indicate current address or other infomiation concern-
ing the author. All footnotes are placed together on a separate
manuscript page. Tables and figures may not have footnotes.
Taxonomic articles. — Consult a recent taxonomic article in
the Journal of Arachnology for style or contact the Subject
Editor for Taxonomy and Systematics. Papers containing
original descriptions of focal arachnid taxa should be listed in
the Literature Cited section.
Tables. — Each table, with the legend above, should be
placed on a separate manuscript page. Only horizontal lines
(no more than three) should be included. Tables may not have
footnotes; instead, include ail information in the legend.
Illustrations. — Original illustrations should be sent electron-
ically as part of the Word document when the_ manuscript is
submitted. Distribution maps should be considered figures and
numbered consecutively with other figures. (Authors wishing to
submit figures as hard copies should contact the Editor-in-Chief
for specifications.) At the submission and review stages, the
resolution should be low while still allowing editors and reviewers
to view figures effectively. Final illustrations must be submitted
to the Editor-in-Chief, typically by e-mail or on a CD, to ensure
that the electronic versions meet publication standards and that
they match the printed copy. All figures should be 10-18 cm (4-7
inches) wide and no more than 23 cm (9 inches) high. The
resolution should be at least 300 dpi (or ppi) for halftone or
color figures and 1200 dpi for line drawings. A Guide to the
Digital Art Specs for Allen Press is available as a PDF online at:
http://allenpress.com/resources/library. At the discretion of the
Editor-in-Chief, a figure can be rendered in color in the online
version but in monochrome in the journal’s printed version, or
in color in both versions if warranted by the figure’s context and
content. Most figures will be reduced to single-column width
(9 cm, 3.5 inches), but large plates can be printed up to two-
columns width (18 cm, 7 inches).
Address all questions concerning illustrations to the Editor-
in-Chief of the Journal of Arachnology: Robert B. Suter,
Editor-In-Chief, Biology Department, Vassar College, 124
Raymond Ave,, Poughkeepsie, NY 12604-0731, USA [E-mail:
siiter@vassar.edu]
Legends for illustrations should be placed together on the
same page(s) and also with each illustration. Each plate must
have only one legend, as indicated below:
Figures 1^. A-us x-us, male from Timbuktu. 1, Left leg; 2,
Right chelicera; 3, Dorsal aspect of genitalia; 4, Ventral aspect
of abdomen. Scale = 1.0 mm.
The following alternate Figure numbering is also acceptable:
Figures la-e. A-us x-us, male from Timbuktu, a. Left leg;
b. Right chelicerae; c. Dorsal aspect of genitalia; d. Ventral
aspect of abdomen. Scale = 1.0 mm.
Assemble manuscript. — The manuscript should appear in
separate sections or pages in the following sequence: title page,
abstract, text, tables with legends, figure legends, figures. Send
entire manuscript, including figures, as one Microsoft Word
document. Note: please downsize the figures if the document is
too large to conveniently send by e-mail.
Supplemental materials. — Authors may submit for online
publication materials that importantly augment the contents of a
manuscript. These may be audio files (e.g., .mp3, .m4a, .aif,
.wav), video files (e.g., .mov, .m4v, .flv, .avi), or Word
documents (e.g., .doc, .docx) for large tables of data. Consult
with the Editor in Chief if you are considering submitting other
kinds of files. Audio and video files should be carefully edited
before submission to eliminate leaders, trailers, and other
extraneous content. Individual files may not exceed 10MB; no
more than five files may be included as supplemental materials
for a manuscript. Supplemental materials will be considered by
reviewers and therefore must be submitted at the time of
manuscript submission. Supplemental materials are published
online at the discretion of the editors.
Page charges, proofs and reprints. — Page charges are
voluntary, but non-members of AAS are strongly encouraged
to pay in full or in part for their article ($75 / journal page). The
author will be charged for excessive numbers of changes made in
the proof pages. Hard copy or PDF reprints are available only
from Allen Press and should be ordered when the author receives
the proof pages. Allen Press will not accept reprint orders after the
paper is published. The Journal of Arachnology also is available
through www.bioone.org and www.jstor.org. Therefore, you can
download the PDF version of your article from one of these sites
if you or your institution is a member. PDFs of articles older than
one year will be made freely available from the AAS website.
SHORT COMMUNICATIONS
Short Communications are usually limited to three journal
pages, including tables and figures (1 1 or fewer double-spaced
manuscript pages including Literature Cited; no more than 2
small figures or tables). Internal headings (METHODS,
RESULTS, etc.) are omitted. Short communications must
include an abstract and keywords.
COVER ARTWORK
Authors are encouraged to send high quality color
photographs to the editor-in-chief to be considered for use
on the cover. Images should be at least 300 dpi.
CONTENTS
Journal of Arachnology
Volume 42
SMITHSONIAN LIBRARIES
3 9088 01788 6649
Number 3
Featured Articles
Troglomorphic pseudoscorpions (Arachnida: Pseudoscorpiones) of northern Arizona, with the description of two new
short-range endemic species
by Mark S. Harvey & J. Judson Wynne 205
A new genus and a new species of scorpion (Scorpiones: Buthidae) from southeastern Mexico
by Oscar F. Francke, Rolando Teruel & Carlos Eduardo Santibanez-Lopez 220
Description of Sarax buxtoni (Gravely 1915) (Arachnida: Amblypygi: Charinidae) and a new case of parthenogenesis
in Amblypygi from Singapore
by Michael Seiter & Jonas Wolff 233
The new spider genus Arctenus, an afrotropical representative of the Calocteninae (Araneae: Ctenidae)
by Daniele Polotow & Rudy Jocque 240
Chemical defenses in the opilionid infraorder Insidiatores: divergence in chemical defenses between Triaenonychidae
and Travunioidea and within travunioid harvestmen (Opiliones) from eastern and western North America
by W. A. Shear, T. H. Jones, H. M. Guidry, S. Derkarabetian, C. H. Richart, M. Minor &
J. J. Lewis 248
Species differences and geographic variation in the communal roosting behavior of Prionostemma harvestmen in
Central American rainforests
by Gregory F. Grether, Theresa L.Aller, Nicole K. Grucky, Abrahm Levi, Carmen C. Antaky
& Victor R. Townsend, Jr. 257
From spiderling to senescence: ontogeny of color in the jumping spider, Habronattus pyrrithrix
by Lisa A. Taylor, David L. Clark & Kevin J. McGraw 268
Scavenging throughout the life cycle of the jumping spider, Phidippus audax (Hentz) (Araneae: Salticidae)
by Michael E, Vickers, Marianne W. Robertson, Casey R. Watson & Travis E. Wilcoxen 277
Removal of genital plugs and insemination by males with normal and experimentally modified palps in Leucauge
mariana (Araneae: Tetragnathidae)
by Vivian Mendez & William G. Eberhard 284
Burrow structure and microhabitat characteristics of Nesiergus insulanus (Araneae: Theraphosidae) from Fregate
Island, Seychelles
by Gregory Canning, Brian K. Reilly & Ansie S. Dippenaar-Schoeman 293
Thermal preference ofDysdera crocata C. L. Koch 1838 (Araneae: Dysderidae)
by Rita Sepulveda, Andres Taucare-Rios, Claudio Veloso & Mauricio Canals 299
Natural history of Phoneutria boliviensis (Araneae: Ctenidae): habitats, reproductive behavior, postembryonic
development and prey-wrapping
by Nicolas A. Hazzi 303
Short Communications
The mechanism behind plasticity of web-building behavior in an orb spider facing spatial constraints
by Thomas Hesselberg 311
Development of novel microsatellite markers for the spider genus Loxosceles (Sicariidae) using next-generation
sequencing by Enric Planas, Laia Bernaus & Carles Ribera 315
Pre-ballooning in Ummidia Thorell 1875 (Araneae: Ctenizidae) from the Interior Highlands, USA: second account
from the region and review of mygalomorph ballooning
by J. Ray Fisher, Danielle M. Fisher, Michael J. Skvarla & Ashley P. G. Dowling 318
Instructions to Authors 322
USERNAME: leachH
PASSWORD: nephilal4
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11