Memoirs of Museum Victoria 72:1-4 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
First record of genus Paradota Ludwig & Heding in New Zealand waters and
description of a new species (Echinodermata: Holothuroidea: Synaptida)
NlCOLA DavEY (http://zoobank.org/urn:lsid:zoobank.org:author:EEBE7A67-A2AB-4504-89D5-D70748AF7570)
Coasts and Oceans National Centre, National Institute of Water and Atmosphere Research Ltd (NIWA), RO. Box 893,
Nelson 7040, New Zealand (email: Niki.Davey@niwa.co.nz)
http://zoobank.Org/urn:lsid:zoobank.org:pub:DlC46632-6FD0-4C8B-9A48-5D88C5B49642
Abstract Davey, N. 2014. First record of genus Paradota Ludwig & Heding in New Zealand waters and description of a new species
(Echinodermata: Holothuroidea: Synaptida). Memoirs of Museum Victoria 72: 1-4.
The genus Paradota Ludwig and Heding is recorded in New Zealand waters for the first time; nineteen specimens
were found in the Bay of Plenty region of north-east New Zealand. A new species, Paradota plentyensis sp. nov, is
described and its taxonomic position within the Order Synaptida is considered.
Keywords Echinodermata, Holothuroidea, Paradota, taxonomy, new species.
Introduction
A recent collection from New Zealand’s eastern Bay of Plenty
yielded 19 purple synaptid holothuroid specimens which
lacked any body wall ossicles and did not fit into any known
New Zealand genus. New Zealand currently has 12 known
species in the three families Chiridotidae Ostergren, 1898,
Myriotrochidae Theel, 1877 and Synaptidae (Burmeister,
1837), sensu Ostergren, 1898 within the order Synaptida
Cuenot, 1891 (Mah et ah, 2009). Most synaptid species have a
worm-like appearance that can make identification quite
difficult. Thus, it is likely that many more species exist in the
New Zealand Exclusive Economic Zone (EEZ) which may
have been misidentified in the early collection stage.
Specimens in this order are relatively elusive with many
species living buried in sand, mud or under various hard
substrates, and are not easily seen in dive or photographic
surveys. As exploration of the deep sea environment increases
as part of the National Institute of Water and Atmosphere
Research Ltd’s (NIWA) Oceans 2020 objective to expand the
knowledge of New Zealand’s ocean resources, and other
associated deep sea voyages are undertaken we are starting to
find more new species, often with numerous representatives.
To date only three species have been described for the
genus Paradota Ludwig and Heding, 1935 worldwide: the
type species P. ingolji Ludwig and Heding, 1935, from the
European and American North Atlantic Coasts, P. weddellensis
Gutt, 1990 from Antarctic waters, and P. marionensis Massin,
1992 from Marion Island in the southern Indian Ocean. The
aim of this paper is to provide a first record of the genus
Paradota in New Zealand waters, and to describe a fourth
species in this genus. The diagnostic characters of this new
species are discussed in the context of other species.
Methods
Specimens were collected by epibenthic sled and box corer
from the National Institute of Water and Atmospheric Research
(NIWA) research vessel RV Tangaroa, and after sorting were
immediately preserved in 100% ethanol. Gross external
morphology and basic gross internal morphology were studied
under a stereomicroscope. In order to extract ossicles, the body
tissue sample was dissolved in commercial bleach and initially
studied with light microscopy (Nikon YS2-H). Ossicles were
further examined by scanning electron microscopy (SEM)
using a Hitachi TM3000 table top using the high vacuum mode
at 15kV. Clean ossicles were mounted on a stud, air-dried and
then coated with gold. Photos and length and width
measurements of any ossicle types seen were taken using both
microscope methods. All specimens were registered within the
NIWA Invertebrate Collection using the prefix NIWA.
Abbreviations
NIWA National Institute of Water and Atmospheric Research
Ltd, Wellington, New Zealand. TANXXXX/xx.
Voyage abbreviation and station number for RV
Tangaroa research voyages undertaken by NIWA.
Followed by year of the voyage, trip number and
station number.
2
N. Davey
Systematics
Order Synaptida Cuenot, 1891
Diagnosis. (Smirnov, 2012) As for subclass Synaptacea Cuenot,
1891.
“Usually worm-like Holothuroidea. Tentacles peltato-
digitate, digitate, pinnate, or can be secondarily simplified,
simple or forked. Radial canals absent; tubefeet and anal
papillae absent; canals of tentacles extending from the
ambulacral ring; ampullae of tentacles are not free hanging
into the body cavity. No radial hemal canals. Ring muscles not
interrupted by radial muscle bands. The suborder Synaptina
has organs of balance (5 pairs of statocysts) in places where
radial nerves extend from the neural ring. Topographically, the
primary tentacles are arranged in the way that they were
initially connected with the following now missing radial
canals: two with medioventral, two with the left dorsal, and
one-with the right dorsal. The stone canal is attached to the
body wall and opens externally or terminates in the body wall
or opens into the body cavity. Respiratory trees absent. The
mesentery supporting the posterior loop of the intestine is
attached to the body wall in the right ventral interradius.
Longitudinal muscle bands are undivided. The calcareous ring
is stout. The radial and interradial segments are usually similar
in shape and size. Radial segments of the ring in their upper
(anterior) part have a perforation for a nerve, or sometimes it is
secondarily not closed on the top and is in a shape of notch (in
paedomorphic species, the segments are simple, without an
anterior projection, while the radial segments do not have a
perforation, or a noch for passage of the nerve). Ossicles:
myritrochid or chyridotid wheels, sigmoids, anchors and
anchor plates. There are no tables.”
Remarks. A recent review by Smirnov (2012) into the system of
class Holothuroidea resulted in changes including four new
subclasses and associated orders. The order Synaptida replaces
what was previously known as Apodida Brandt, 1835 and it
contains the two suborders Myriotrochina Smirnov, 1998 and
Synaptina Smirnov, 1998. Paradota belongs in the latter
suborder and the Family Chiridotidae 0stergren, 1898.
Suborder Synaptina Smirnov, 1998
Family Chiridotidae 0stergren, 1898
Diagnosis (Smirnov, 2012). “Synaptina with 10, 12 or 18
peltato_digitate, pinnate, or secondarily simple tentacles with
forked terminations. Ossicles: chiridotid wheels and/or
sigmoids. Chiridotid wheels with six spokes, numerous small
denticles on the inner rim and complex hub. The lower side of
each spoke branches toward lower side of the egg-shaped hub to
form a star-shaped structure in the centre. The tentacles and the
body wall also contain rod-like ossicles with branching ends.”
Genus Paradota Ludwig and Heding, 1935
Diagnosis. (Ludwig and Heding, 1935, translated by M. Reich,
10/2013; emended here). Tentacles 12, palmate in shape.
Calcareous ring consists of regular flat calcareous plates with
radial pieces which are usually perforated and with muscle
insertion areas at the outer side. Polian vesicles numerous;
ciliated funnels small and occurrence sparse. Calcareous
ossicles completely missing in the body wall (except for the
anterior part close to the tentacles), but present in the tentacles
in the form of small rods.
Type species
P. ingolfi Ludwig and Heding, 1935: 150
Remarks. The original diagnosis for Paradota stated that
species have 15 tentacles, yet the genus type P. ingolfi only has
12 tentacles. This anomaly was discussed by Gutt (1990), who
noted that all Paradota species, including type species P.
ingolfi , have 12 tentacles. The new species described here, P.
plentyensis sp. nov. also has only 12 tentacles, altering this
diagnostic character in Ludwig and Heding (1935). The
diagnosis given here has been emended accordingly.
Paradota plentyensis sp. nov.
Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:
7F0984EC-E875-431F-9F58-5CF59A9BD0A2
Figure 1A-D, Table 1.
Material examined. Holotype. New Zealand, Bay of Plenty, White
Island: NIWA 87163, Stn TAN1206/144, 37.53° S, 177.29° E, 1182 m,
28/04/2012. Paratypes. NIWA 83152 (13 specimens); same station
data as holotype.
Other material. New Zealand, Bay of Plenty, Tauranga Canyon:
NIWA 82999 (1 specimen) Stn TAN1206/113, 37.25° S, 176.97° E,
1222 m, 25/04/2012. Bay of Plenty, White Island: NIWA 83167 (1
specimen) Stn TAN1206/145, 37.52° S, 177.30° E, 918-1003 m,
28/04/2012, NIWA 83224 (1 specimen) Stn TAN1206/152, 37.55° S,
177.27° E, 918-1003 m, 28/04/2012. NIWA 87164 (2 specimens) Stn
TAN1206/144, 37.53° S, 177.29° E, 1182 m, 28/04/2012.
Description of holotype. Paradota species 20 mm long, 4 mm
wide, 4 mm high (preserved). Body form long, cylindrical with
slightly bulbous posterior end (possible preservation artefact),
bulbous end skin is thinner than rest of the body. Skin
contracted, covered in small papillae giving a granular texture.
No tube feet. Mouth is terminal, surrounded by a tentacle
crown with 12 equal sized tentacles of peltato-digitate shape
with 4-5 digits per side of each tentacle, which become smaller
nearer the tentacle trunk.
Paratypes follow the general description above with the
following differences: specimens are up to 40 mm long, 4 mm
wide and 4 mm high (preserved). The bulbous end can be
either anteriorly or posteriorly located.
Due to the small size of specimens the paratypes were
extensively dissected. Internally the majority of the coelomic
cavity is occupied by sediment filled intestine. The longitudinal
muscles are large, up to 2 mm high and wide, divided. One
large (1.5 mm) polian vesicle (structure responsible for
maintaining water vascular system pressure) is present with
2-3 smaller thinner ones. Gonads not visible in dissected
specimens but tubule like strands present posteriorly which
may be undeveloped gonad material. Calcareous ring consists
First record of Paradota in New Zealand
3
Table 1. Morphological characters for all species in the Paradota genus.
Location
Tentacle
ossicle
rod shape
Miliary
granule
present
Colour
(preserved)
Polian
vesicle
number
Depth of
occurrence
Number of tentacle
digits (each side)
Tentacle
rod length
Paradota ingolfi
Ludwig and
Heding, 1935
European and
American
North Atlantic
Coast
curved
Not
mentioned
Pale body with
darker tentacles
(no specific
colour given)
>1
1750 m
7-9
200 pm
Paradota
weddellensis
Gutt, 1990
Antarctica
curved
No
Pale red/violet
>1
646-661
m
5-7
60 pm
Paradota
marionensis
Massin, 1992
Southern
Indian Ocean.
‘C’
shaped
No
Purplish-white/
Opaque
1
237-243
m
5-7
50-100
pm
Paradota
plentyensis sp.
nov.
New Zealand
straight
Yes
Dark purple
>1
1182 m
4-5
70 pm
Figure 1. Paradota plentyensis sp. nov. holotype (A-D, NIWA 87163): A, specimen view; B, anterior view including tentacle crown; C, close up
of tentacles showing 10 lobes; D, ossicle rods from tentacles.
4
N. Davey
of 12 large square pieces, radial and interradial pieces evenly
sized, some radial pieces have a perforation in the upper part,
posterior rim undulating.
The only ossicles present are in the tentacles and the
longitudinal muscles. The body wall proper is completely
devoid of ossicles. Ossicles of tentacles— smooth rods to
slightly curved branched rods with varying degrees of
branching distally: up to 70 pm length and 15 p m width.
Ossicles of longitudinal muscles are miliary granules—smooth,
oval, baton to rod-shaped: up 70 p m length and 10 pm width.
Colour. Deep purple (preserved and live)
Etymology. Named for the Bay of Plenty in the North Island of
New Zealand as the type locality and presently the only known
distribution for this species.
Distribution. New Zealand, Bay of Plenty, 918-1222 m.
Remarks. The lack of ossicles in the body wall and associated
number of tentacles immediately indicated that we had
encountered a new genus in New Zealand waters. There are
three known genera within the Chiridotidae that are devoid of
body wall ossicles: Achiridota Clark, 1908 which has 12
tentacles and is completely devoid of any ossicles; Kolostoneura
Becher, 1909 which has 10 tentacles which do contain ossicles;
Paradota with 12 tentacles and tentacle ossicles. Already
known from New Zealand shallow waters is Kolostoneura
novae-zealandiae Dendy and Hindle, 1907 with 10 tentacles.
Our new species clearly falls into the genus Paradota.
Three species have been previously described for this
genus. Our new species differs from them all (Table 1). Firstly
the type species P. ingolfi from European and American North
Atlantic Coast has tentacle rods which are similar in
appearance to P. plentyensis with straight smooth lengths and
branching at the extremities. However the tentacles rods are
much longer (200 pm compared to 100 ^m) in P. ingolfi.
Secondly, P. weddellensis Gutt, 1990 has been described
from Antarctic waters. This species differs from P. plentyensis
as it does not have miliary granules in the longitudinal muscles
and the tentacle ossicles are more curved. P. weddellensis is a
pale red to pale purple colouration compared to the deep even
purple colour (live and preserved) found in P. plentyensis.
Paradota marionensis Massin, 1992 was described from
Marion Island in the Southern Indian Ocean. This species has
similar tentacle arrangement and polian vesicles to P.
plentyensis but is an opaque pale purple. The calcareous ring
is almost identical to our new species. The tentacle ossicles are
distinctly more curved in P. marionensis forming an almost
complete ‘C\
With a combination of the features described above we
have a new species and a first encounter of the Paradota genus
in New Zealand waters.
Acknowledgements
I am grateful to : Kareen Schnabel and Sadie Mills (NIWA for
providing specimens from the NIWA Invertebrate Collection
(NIC) ); Peter Marriot (NIWA, macro specimen photos);
Carina Sim-Smith (NIWA, figure preparation); Daniel Leduc
(NIWA, SEM assistance); Michelle Kelly (NIWA, internal
review). This research was funded by NIWA under Coasts and
Oceans Research Programme 2 (2012/13 SCI). Specimens
were collected by NIWA as part of the 'Impact of resource use
on vulnerable deep-sea communities’ project (C01X0906),
funded by the Ministry of Business, Innovation & Employment.
References
Becher, S. 1909. Die Stammesgeschichte der Seewalzen, Ergebnisse
und Fortschritte aus der Zoologie vol. 1: 403-490.
Brandt, J.F. 1835. Prodromus descriptionis animalium ab H. Mertensio
in orbis terrarum circumnavigatione observatorum, Petropoli
5(1): 1-75.
Burmeister, H. (1837) Handbuch der Naturgeschichte. Zweite Abt.
Zoologie , Berlin: Verlag von Theod. Chr. Friedr. Gnelin, pp. 369-858.
Clark, H.L. 1908. The Apodous Holothurians. A Monograph of the
Synaptidae and Molpadiidae, Smithsonian Contributions to
Knowledge vol. 35: pp. 1-231.
Cuenot, L. 1891. Cuen Etudes morphologiques sur les Echinodermes,
Archives of Biology vol. 11: 313-680.
Dendy, A. and Hindle, E. 1907. Some additions to our knowledge of
the New Zealand holothurians. Journal of the Linnean Society
(Zoology) 30: 95-125, pi. 11-14.
Gutt, J. 1990. New Antarctic holothurians (Echinodermata) —I. Five
new species with four new genera of the order Dendrochirotida.
Zoologica Scripta, 19(1): 119-127.
Ludwig, H. and Heding, S. 1935. Die Holothurien der Deutschen
Tiefsee Expedition. I. FuBlose und dendrochirote Formen, in
Wissenschaftliche Ergebnisse der Deutschen Tiefsee Expedition auf
demDampfer “Valdivia” 1898-1899, vol. 24(2): pp. 123-214.
Mah, C.L., McKnight, D.G., Eagle, M.K., Pawson, D.L., Ameziane, N.,
Vance, D.J., Baker, A.N., Clark, H.E.S., Davey, N. 2009. Phylum
Echinodermata: sea stars, brittle stars, sea urchins, sea cucumbers,
sea lilies. In Gordon, D.P (Eds.), New Zealand Inventory of
Biodiversity, volume 1, Kingdom Animalia: Radiata, Lohotrochozoa,
Deuterostomia. Canterbury University Press. 371-400 pp.
Massin, Cl. 1992. Three new species of Dendrochirotida
(Holothuroidea, Echinodermata) from the Weddell Sea
(Antarctica). Bulletin de ITnstitut Royal des Sciences Naturelles de
Belgique, Biologie, 62: 179-191.
Ostergren Hj. 1898. Das System der Synaptiden, Ofvers. K. Vetensk.
Akad. Forh. Stokh, vol. 55(2): pp. 111-120.
Smirnov, A. 1998. On the Classification of the Apodid Holothurians,
in “Echinoderms: San Francisco”. Proceedings from the Ninth
International Echinoderm Conference, San Francisco, California,
USA, 1996, Mooi, R. and Telford, M., Eds., Rotterdam, Brookfield:
A .A. Balkema, 1998, pp. 517-522.
Smirnov, A. 2012. System of the class Holothuroidea. Paleontological
Journal 46: 793-832.
Memoirs of Museum Victoria 72:5-23 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
New dendrochirotid sea cucumbers from northern Australia (Echinodermata:
Holothuroidea: Dendrochirotida)
P. MARK O’LOUGHLIN 1 ’* (http://zoobank.org/urn:lsid:zoobank.org:author:97B95F20-36CE-4A76-9DlB-26A59FBCCE88),
MELANIE Mackenzie 2 (http://zoobank.org/urn:lsid:zoobank.org:author:5E3E21B9-E3DC-4836-8731-D5FD10D00CBF) AND
DlDIER VanDEnSpIEGEL 3 (http://zoobank.Org/urn:lsid:zoobank.org:author:CE8C3D01-28AD-43F7-9D4F-04802E68CBlA)
1 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmoloughlin@
edmundrice.org)
2 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (mmackenzie@museum.
vic.gov.au)
3 Biological Collection and Data Management Unit, Royal museum for central Africa, B-3080, Tervuren, Belgium
(dvdspiegel@africamuseum.be)
"To whom correspondence and reprint requests should be addressed. E-mail: pmoloughlin@edmundrice.org
http://zoobank.Org/urn:lsid:zoobank.org:pub:DDB03260-10B7-47A5-9F34-41EE360CBA68
Abstract O’Loughlin, P. M., Mackenzie, M. and VandenSpiegel, D. 2014. New dendrochirotid sea cucumbers from northern
Australia (Echinodermata: Holothuroidea: Dendrochirotida). Memoirs of Museum Victoria 72: 5-23.
A new genus in the sub-family Semperiellinae is described: Triasemperia O’Loughlin. Six new species of
dendrochirotids are described with O’Loughlin as author: Actinocucumis solanderi, Cladolabes arafurus, Globosita
elnazae, Massinium bonapartum, Massinium keesingi, Triasemperia stola. Genera Actinocucumis Ludwig, Cladolabes
Brandt, Globosita Cherbonnier and Massinium Samyn and Thandar are discussed. Species listed by Heding and Panning
as synonyms of Actinocucumis typica Ludwig are raised out of synonymy: Actinocucumis cornus (Heding); Actinocucumis
difficilis Bell; Actinocucumis longipedes Clark; Pseudocucumis quinquangularis Sluiter; Actinocucumis simplex (Sluiter).
Actinocucumis donnani Pearson is incertae sedis. We provide a table of some distinguishing morphological characters for
species of Globosita, and a key for distinguishing the species of Massinium.
Keywords Northern Australia, Cladolabidae, Semperiellinae, Thyonidiidae, Actinocucumis, Cladolabes, Globosita, Massinium,
Triasemperia, new genus, new species, synonymies
Introduction
Four recent marine surveys off northern Australia, detailed
below, have collected many sea cucumber specimens. We have
identified these, and specimens sent to us for identification by
Geoscience Australia have been lodged with permission in
Museum Victoria. A selection of specimens sent on loan by
the Western Australian Museum has also been lodged with
permission in Museum Victoria. Additional material from off
northern Australia, held in Museum Victoria, has been studied
in conjunction with these collections. The surveys referred to
above are:
1. Geoscience Australia and the Australian Institute of Marine
Science conducted collaborative Survey SOL4934 on the seabed
environments of the eastern Joseph Bonaparte Gulf off Northern
Australia in August and September 2009 on AIMS RV Solander.
A Post-survey Report has been provided by Heap et al. (2010).
2. The Australian Institute of Marine Science, Geoscience
Australia, the University of Western Australia and the Museum
and Art Gallery of the Northern Territory conducted marine
biodiversity survey SOL5650 on the Oceanic Shoals
Commonwealth Marine Reserve (Timor Sea) in September
and October 2012 from AIMS RV Solander. A Post-survey
Report has been provided by Nichol et al. (2013).
3. The Museum and Art Gallery of the Northern Territory,
in collaboration with Geoscience Australia, the Northern
Territory government, and the Australian Institute of Marine
Science, undertook a biological acquisition program
SS2012t07 during the transit of CSIRO RV Southern Surveyor
between Darwin and Cairns in October 2012. A Post-survey
Report has been provided by Przeslawski et al. (2013).
4. The Commonwealth Scientific and Industrial Research
Organization, in collaboration with the French Total Foundation,
conducted a survey of the biota off the mouth of the King
George River in the Kimberley region of northern Australia in
June 2013 on AIMS RV Solander. The project leader was John
Keesing, CSIRO Senior Principal Research Scientist.
6
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
In this paper one new genus and six new species of
dendrochirotids are described, and additional new species
await description. Tissue samples from all of the recently
collected sea cucumber specimens have been sent to the
University of Florida as part of a continuing project with
Gustav Paulay to obtain global genetic data for sea cucumbers.
Cladolabes Brandt, 1835
Cladolabes Brandt, 1835: 35.—Heding and Panning, 1954: 121.—
Thandar, 1989: 299,-Liao and Clark, 1995: 488-489.
Urodemas Selenka 1867: 352.-H. L. Clark, 1938: 497-499.-
1946: 410.
Pseudocucumis Ludwig, 1875: 90.—H. L. Clark, 1946: 405.
Methods
Scanning electron microscope (SEM) images were taken by
Didier VandenSpiegel after clearing the ossicles of associated
soft tissue in commercial bleach, air-drying, mounting on
aluminium stubs, and coating with gold. Observations were
made using a JEOL JSM-6480LV SEM. Measurements were
made with Smile view software.
Photos of specimens were taken in Museum Victoria by
Melanie Mackenzie, in collaboration with Mark O’Loughlin,
using an SLR Nikon D300S digital camera with 60 mm Nikkor
lens. Photos of live specimens were taken by the on-board
scientists on the King George River expedition.
Abbreviations
AIMS Australian Institute of Marine Science
CSIRO Commonwealth Scientific and Industrial Research
Organization
GA Geoscience Australia
KGR King George River
MAGNT The Museum and Art Gallery of the Northern
Territory
MOLAF Prefix for code number of tissues provided to the
University of Florida for sequencing
NHMUK British Museum of Natural History
NMV Museum Victoria, Australia, with registration
number prefix F
UF University of Florida
WAM Western Australia Museum, with registration
number prefix Z
Diagnosis. Up to large size (150 mm long); 20 tentacles in two
(15+5) or three (10+5+5) circles; tube feet scattered over the
body, or confined to the radii; calcareous ring not composite,
radial and inter-radial plates of ring high, posterior paired
radial prolongations distinct but short, not fragmented; ossicles
either tables with rudimentary disc and tall two-pillared spires
or rudimentary spires, or irregular short thick variably spinous
rods and clubs related to tables; rosettes frequently present.
Type species. Cladolabes limaconotus Brandt, 1835 (by
monotypy) (NW Pacific)
Other species, with distributions. Cladolabes aciculus
(Semper, 1867) (Fiji, tropical Indo-West Pacific); C. arafurus
O’Loughlin, sp. nov. (below) (NE Australia); C. bifurcatus
(Deichmann, 1944) (Natal, South Africa); C. crassus (H. L.
Clark, 1938) (Hong Kong); C. hamatus (Sluiter, 1914) (Indo-
Malayan Archipelago); C. perspicillus (Selenka, 1867) (E
Australia); C. pichoni Cherbonnier, 1988 (Madagascar); C.
roxasi (Domantay, 1934) (Philippines); C. schmeltzii (Ludwig,
1875) (NE Australia to S China).
Remarks. We have emended the earlier diagnoses of Heding
and Panning (1954), Thandar (1989) and Liao and Clark (1995)
to include the presence of rudimentary table spires that are
present in our new species (below). We noted above that the
variety of ossicle form in the species of Cladolabidae suggested
to Smirnov (2012) that the family might be polyphyletic. We
endorse this view for the same reason. For this same reason,
and the added reason of the variation in tube foot distribution,
we judge that Cladolabes might also be polyphyletic.
Cladolabes arafurus O’Loughlin, sp. nov.
Zoobank LSID. http://zoobank.org:act:AB27AA20-F074-4C3B-
BABE-242616AD4A2F
Figures 1, 2.
Order Dendrochirotida Grube, 1840
Family Cladolabidae Heding and Panning, 1954 {sensu
Smirnov 2012)
Remarks. Heding and Panning (1954) initially described the
Cladolabinae as a sub-family within the Phyllophoridae
Ostergren, 1907. Pawson and Fell (1965) transferred the
Cladolabinae to be a sub-family within the Sclerodactylidae
Panning, 1949. Smirnov (2012) raised Cladolabinae to family
status as Cladolabidae, based on the very short segmented or
unsegmented posterior prolongations on the radial plates of the
calcareous ring. The variety of ossicle form in the species of
Cladolabidae suggested to Smirnov (2012) that the family
might be polyphyletic.
Material examined. Holotype. N Australia, Arafura Sea, GA cruise
SS2012t07, stn/site 01BS01, sample 110, 11.23°S 134.73°E, RV
Southern Surveyor, benthic sled, 31 m, B. Alvarez de Glasby et al., 16
Oct 2012, NMV F202989 (UF tissue lot MOLAF1530).
Paratype. NE Australia, Queensland, Yeppoon, dredged off
Middle Island, 23.13°S 150.74°E, 9-37 m, B. J. Smith, 6 Sept 1967,
NMV F204070 (1).
Description. Form sub-spherical, up to 63 mm long (preserved),
slightly convex dorsally, deeply convex ventrally, mouth
anterior dorsal, anus posterior dorsal, slightly developed oral
and anal cones (preserved); dorsal body wall thicker than
ventral wall, creased, covered closely with numerous tube feet,
diameters about 0.5 mm; ventral body wall thin, scattered
cover of tube feet; lacking anal scales; 20 dendritic tentacles,
15 large (variable sizes) in outer circle, 5 smaller (not
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
7
significantly smaller) in inner circle (proximal peri-oral);
calcareous ring not composite, radial and inter-radial plates of
ring high, narrow anteriorly, posterior paired radial
prolongations distinct, short, not fragmented; single polian
vesicle; gonad tubules branched basally; respiratory trees
extending throughout coelom.
Ossicles sparsely scattered in mid-body dorsal and ventral
body wall, small plates, rods and rosettes; plates frequently
regular, oval with 2 large central perforations and single
smaller perforation at each end (judged to be reduced table
discs), short blunt pillar frequently projecting from centre of
plate (judged to be reduced spires), plates 56-90 pm long;
rods related to plates, 1 or 2 perforations, sometimes with
central short pillar, up to 70 pm. Peri-anal body wall ossicles
plates, rods, rosettes and small scales; plates similar to mid¬
body wall (judged to be reduced tables); rods irregular, many
branched, distal ends of rod and branches widened and
perforate, up to 120 pm long; multi-layered anal scale about
320 pm long. Tube feet endplate diameters up to 400 pm, tube
foot and endplate support ossicles elongate perforated curved
plates up to 160 pm long. Tentacles with rod ossicles and
rosettes; rods fine to thick, ends widened with few perforations,
rods up to 400 p m long. Oral disc and introvert with abundant
rosettes, rosette rods and rare plates.
Preserved body colour off-white with fine brown flecking
and spotting, tube feet brown.
Distribution. N Australia, Arafura Sea to Yeppoon, 9-37 m.
Etymology. Named for the Arafura Sea from which the type
specimen was collected.
Remarks. We had considerable difficulty in finding a genus to
which we should refer this new species, but we did not feel
justified in establishing yet another new dendrochirotid genus.
We refer the new species to Cladolabes with major reservations.
We judge that the plates with short central pillars of Cladolabes
arafurus O’Loughlin sp. nov. are related to table discs and
spires, the latter very reduced. This would account for the
unusual ossicle forms. We have emended the diagnosis of
Cladolabes to include this character. But we recognize that the
reduced tables in species currently referred to Cladolabes are
generally characterized by a rod-like spire and reduced disc,
the opposite to Cladolabes arafurus. The forms of the
calcareous ring in species currently referred to Cladolabes are
quite variable but generally the inter-radial plates have posterior
prolongations and are not truncate posteriorly as in Cladolabes
arafurus. We anticipate that emerging genetic data will result
in a major revision of family Cladolabidae and await this
evidence as to where the new species belongs generically. The
form of the ossicles is distinctive, especially what we judge to
be the reduced tables, and distinguishes Cladolabes arafurus
from all other species in the genus.
Globosita Cherbonnier, 1958
Sphaerella Heding and Panning, 1954: 111 (occupied generic name).
Globosita Cherbonnier, 1958: 198 (replacement name).
Diagnosis. Cylindrical to ovoid dendrochirotid species, up to
100 mm long (preserved), sometimes with short oral and anal
cones; mouth anterior dorsal, anus posterior dorsal; lacking
anal teeth; 20 dendritic tentacles, 15 large, 5 inner small; radial
plates of calcareous ring with paired composite posterior
prolongations, each comprising up to about 6 discrete segments;
inter-radial plates truncate or with notch posteriorly, lacking
posterior prolongations; tube feet scattered over whole body,
more numerous dorsally or ventrally; gonad tubules in 2 tufts,
branched.
Body wall ossicles thick plates, irregularly round to oval to
sub-rectangular, up to 90 pm long, perforations very small or
lacking, sometimes finely knobbed on margin and surface,
plates sometimes with 4 larger central perforations, sometimes
with one large central perforation surmounted by a cross;
tables with four pillars sometimes present in body wall, spires
sometimes incomplete; rosettes may be present; tentacles with
rods, perforated distally.
Type species. Globosita argus (Heding and Panning, 1954)
(type locality Java).
Other species, with distributions. Globosita dobsoni (Bell,
1883) (Honduras); G. elnazae O’Loughlin sp. nov. (N Australia);
G. murrea Cherbonnier, 1988 (Madagascar).
Remarks. Cherbonnier (1958) recognized that the genus name
Sphaerella was occupied, and provided the replacement name
Globosita. Cherbonnier (1988) examined the holotype of
Globosita argus and observed ‘pseudo-tables’. Deichmann
(1930) expressed the opinion that the juveniles of Globosita
dobsoni would have tables.
Table 1. Some distinguishing morphological characters of Globosita species.
Globosita species
Type locality
Largest
specimen
Tube foot
distribution
Rosette
ossicles
Plate
perforations
Plate
ossicles
G. argus
Java
92 mm long
sub-spherical
more dense
ventrally
absent
few, minute
to absent
smooth
G. dobsoni
Honduras
80 mm long
ovoid form
more dense
ventrally
present
commonly 4 small centrally
finely
knobbed
G. elnazae
North Australia
100 mm long
sub-spherical
more dense
dorsally
absent
some numerous, some large centrally
finely
knobbed
G. murrea
Madagascar
40 mm long ovoid
form
more dense
ventrally
present
some numerous, not large centrally
knobbed
on margin
8
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
Globosita elnazae O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:4E654BA2-lAC4-41AE-
A52D-B6891E620792
Figures 3,4, table 1.
Material examined. Holotype. NW Australia, Joseph Bonaparte Gulf,
Kimberley region, off King George River, 13.79°S 127.24°E, RV
Solander , 55 m, J. Keesing, 10 Jun 2013, WAM Z27872 (KGR lot
23426; UF tissue lot MOLAF1484).
Paratypes. Off King George River, 13.85°S 127.29°E, RV
Solander , 45 m, J. Keesing, 6 Jun 2013, WAM Z27861 (1) (KGR lot
23322; UF tissue lot MOLAF1459); 13.82°S 127.32°E, 73 m, 12 Jun
2013, WAM Z27853 (1) (KGR lot 29381; UF tissue lot MOLAF1442);
13.90°S 127.33°E, 11 m, 7 Jun 2013, NMV F202999 (2) (KGR lot
23425; UF tissue lots MOLAF1468,1469).
Other material. NE Australia, Queensland, near Cairns, Machans
Beach, 16.85°S 145.73°E, on beach after cyclone, B. Collins, 25 Dec
1996, NMV F203014 (1).
Description. Form sub-spherical, up to 100 mm long
(preserved), slightly convex dorsally, deeply convex ventrally,
mouth anterior dorsal, anus posterior dorsal, slightly developed
oral and anal cones (preserved); lacking anal scales; thin soft
body wall, slightly thicker dorsally; tube feet scattered over
body, closer dorsally, clusters of numerous tube feet around
mouth and anus, diameters about 0.4 mm; 20 dendritic
tentacles, 15 large outer, 5 small inner (proximal peri-oral);
calcareous ring composite, radial plates with paired tapered
posterior prolongations comprising about 3 discrete segments;
inter-radial plates pointed anteriorly, deep notch posteriorly,
lacking posterior prolongations; single polian vesicle;
madreporite multi-lobed, near posterior end of calcareous ring;
gonad tubules short with numerous branches; respiratory trees
extending the length of the coelom.
Ossicles scattered sparsely in dorsal and ventral body wall,
regular to irregular thick oval plates and incomplete tables;
larger regular dorsal plates oval to rounded sub-rectangular in
form, some with large central perforation with cross and 4
truncate pillars (not amongst ossicles illustrated), large and small
surrounding perforations, surface sometimes finely knobbed,
Figure 1. Photos of preserved and collapsed specimens of Cladolabes arafurus O’Loughlin sp. nov. A, dorsal view of holotype (NMV F202989,
50 mm long); B, ventral view of holotype; insert with sketch of the calcareous ring of the holotype; C, dorsal view of paratype (NMV F204070,
63 mm long); D, ventral view of paratype; insert with photo of the calcareous ring of the paratype.
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
9
margin finely spinous, plates up to 90 //m long; smaller irregular
dorsal plates round to irregular in form, frequently with small
perforations, sometimes with 2 large central perforations,
surface variably finely knobbed, margin irregular to finely
spinous, plates 40-70 fim long. Ventral body wall with some
tables, oval discs up to 100 /tm long, spires low, 4 pillars,
sometimes not connected distally, sometimes with connecting
distal bridge with short blunt spines. Tube feet endplate diameters
about 250 jim, tube foot and endplate support ossicles elongate
perforated curved plates up to 160 pim long. Peri-anal body wall
with tables, endplates, tube foot support rod-plates; table discs
irregularly round to rounded square, up to 80 /rm wide, spires
with 4 pillars, short spines distally; endplates about 100 /<m
diameter; tube foot support ossicles short, thick curved, rod-
plates, about 100 }im long. Tentacles with rod ossicles only, rods
smooth, ends widened with few perforations and denticulate
margin, rods up to 120 pim long. Rosette ossicles not observed in
tentacles or peri-anal body wall.
Figure 2. SEM images of ossicles from the holotype of Cladolabes arafurus O’Loughlin sp. nov. (NMV F202989). A, mid-dorsal body wall and
tube feet small plates (reduced table discs), some with central short pillar (reduced spires), rosettes, and tube feet support plates (large, right)
(scale bars 10 /mi); B, ventral mid-body wall reduced tables (scale bars 10 /mi); C, peri-anal body wall small endplate (top left), reduced tables
with central short pillar, rods, and rosettes (scale bars 10 /mi); D, ventral tube foot endplate (top right, scale bar 100 /mi), and tube foot support
plates (scale bars 20 /mi); E, tentacle rods (scale bars 20 /mi).
10
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
Colour live pale yellow to off-white; colour preserved off-
white to pale brown, tube feet mostly with brown rim.
Distribution. N Australia, off King George River, Kimberley
region, north Western Australia, to near Cairns, Queensland,
11-73 m.
Etymology. Named elnazae for Elnaz Tavancheh (Museum
Victoria Volunteer), with appreciation of Elnaz’s generous and
skilled assistance with sea cucumber systematics.
Remarks. The distinguishing characters of Globosita elnazae
O’Loughlin sp. nov. are the more abundant tube feet dorsally
and the presence of a large central perforation surmounted by a
cross in some plate ossicles. We note that for Cherbonnier 1988
fig. 93, illustrating the ossicle for Globosita murrea, fig. “E”
illustrating rosettes should be “H” and fig. “H” illustrating
tables should be “K”. In Globosita elnazae we did not observe
rosettes. Globosita elnazae sp. nov. is distinguished from the
other species in the genus by the combination of morphological
characters summarized in Table 1.
Family Thyonidae Panning, 1949 (sensu Smirnov 2012)
Sub-family Semperiellinae Heding and Panning, 1954
Diagnosis (emended from O’Loughlin et al. (2012) and
Smirnov (2012)). Dendrochirotid species with 20 dendritic
tentacles; calcareous ring composite, comprising a mosaic of
small pieces or discrete segments; radials and inter-radials
prolonged posteriorly, prolongations frequently merge to create
a tubular ring; radials frequently with median division for most
of the length creating 2 narrow posterior prolongations that
sometimes fuse with inter-radials, distal ends sometimes cross-
linked; body wall tables with 2 or 3 or 4 spires.
Remarks. Smirnov (2012) raised the sub-family Thyoninae
Panning, 1949 to family status as Thyonidae, with a diagnostic
emphasis on the mosaic structure of the composite and frequently
tubular calcareous ring. He included the two sub-families
Thyoninae (with 10 tentacles) and Semperiellinae (with 15 or 20
tentacles). O’Loughlin et al. (2012) noted that Rowe and
Figure 3. Photos of live, and preserved and collapsed, holotype specimen of Globosita elnazae O’Loughlin sp. nov. (WAM Z27872). A, ventro¬
lateral view of the live holotype specimen; B, photo of the calcareous ring of the holotype; C, dorsal view of the preserved holotype (100 mm
long); D. ventral view of the preserved holotype; insert with sketch of the calcareous ring of the holotype.
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
11
Richmond (2004) judged that Semperiella Heding and Panning,
1954 (in the then new sub-family Semperiellinae) is a junior
synonym of Thyonidiella Heding and Panning, 1954 (in the then
new sub-family Phyllophorinae). As a consequence genera of the
sub-family Semperiellinae have 20 tentacles. We have emended
the diagnosis of Semperiellinae to include this fact, to include
species with tables that have three pillars in each spire (see new
genus and species below), and to provide a more detailed
description of the calcareous ring. Michonneau and Paulay
(2014) judged that Semperiella and Thyonidiella are junior
synonyms of Phyrella Heding and Panning, 1954, and referred
Phyrella to the Phyllophoridae Ostergren, 1907. They suggested
that a phylogenetic re-assessment of the family Phyllophoridae
remains unresolved. We recognize that molecular genetic data
will be crucial to resolving the many emerging issues.
Massinium Samyn and Thandar, 2003
Massinium Samyn and Thandar, 2003: 136.—Samyn et al., 2010: 2.
Diagnosis. Frequently semi-spherical species with oral and anal
dorsal orientations; 20 dendritic tentacles arranged in two
circles of 10 large outer and 10 small inner (proximal peri-oral);
tube feet distributed all over mid-body; calcareous ring elongate,
tubular, with both radial and inter-radial plates fragmented into
a mosaic of small pieces, and posterior prolongations linked
distally to form inter-radial oval non-calcified spaces beneath
the water vascular ring; polian vesicles from 1 to 4; ossicles
variably include granuliform rods, rosettes, pseudo-buttons and
tables; table spires with 1 or 2 or 3 or reduced pillars.
Type species. Massinium maculosum Samyn and Thandar,
2003 (original designation) (South Africa).
Figure 4. SEM images of ossicles from the holotype of Globosita elnazae O’Loughlin sp. nov. (WAM Z27872). A, dorsal mid-body wall and
tube feet small knobbed plates, tube foot support plate (centre top), and endplate fragment (centre bottom) (scale bars 10 pm); B, ventral mid-body
wall knobbed plates (scale bars 10 pm); C, peri-anal body wall tables, small endplate, and tube foot support rod-plates (scale bars 10 pm); D,
tentacle rod (scale bar 10 pm).
12
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
Other species, with distributions. Massinium albicans Samyn
et al., 2010 (New Caledonia); M. arthroprocessum (Thandar,
1989) (South Africa); M. bonapartum O’Loughlin sp. nov.
(NW Austraila); M. dissimilis (Cherbonnier, 1988)
(Madagascar); M. granulosum Samyn et al., 2010 (NE
Australia); M. keesingi O’Loughlin sp. nov. (NW Australia); M.
magnum (Ludwig, 1882) (Indonesia); M. melanieae O’Loughlin
in O’Loughlin et al., 2012 (S Australia); M. vimsi O’Loughlin
in O’Loughlin et al., 2012 (SE Australia); M. watsonae
O’Loughlin in O’Loughlin et al., 2012 (SE Australia).
Remarks. We have emended the diagnosis of Massinium from that
in Samyn et al. (2010) to reflect our observations in this review.
Key to the species of Massinium
1. Ossicles present in the mid-body wall. 2
— Mid-body wall lacking ossicles. 9
2. Mid-body wall with table ossicles of some form present.3
— Mid-body wall lacking any form of table ossicles.6
3. Mid-body wall ossicles tables only. 4
— Mid-body wall ossicles tables and additional ossicle.
forms.5
4. Peri-oral table spires well developed, typically with long,
splayed, pointed apical spines.
. M. bonapartum sp. nov. (NW Australia)
— Peri-oral table spires frequently absent or reduced, few
short apical spines.
. M. keesingi sp. nov. (NW Australia)
5. Mid-body with rare but developed table ossicles; tentacles
with table ossicles; up to 2 polian vesicles.
. M. dissimilis (Madagascar)
— Mid-body with reduced table ossicles; tentacles with
rosettes only; typically 4 polian vesicles.
. M. magnum (Indonesia)
6. Mid-body wall with rosettes present.7
— Mid-body wall lacking rosettes.8
7. Introvert table discs irregular with predominantly 4
central perforations and single ring of smaller outer
perforations; tentacles with rods and rosettes.
. M. maculosum (South Africa)
— Introvert table discs irregular with predominantly 4
central perforations and up to 3 rings of smaller outer
perforations; tentacles with elongate rod-rosettes.
. M. albicans (New Caledonia)
8. Mid-body ossicles predominantly short, thick, irregular,
rarely perforate, granuliform rods; tentacles with rosette
ossicles only. M. granulosum. (NE Australia)
— Mid-body ossicles predominantly U-shaped, distally
perforate rods; tentacles with rod ossicles only.
. M. arthroprocessum (South Africa)
9. Large and small tube feet uniformly distributed; 4 polian
vesicles; peri-anal body wall with table ossicles.
. Massinium melanieae (Great Australian Bight)
— Tube feet not uniformly distributed; fewer than 4 polian
vesicles; peri-anal body wall lacking table ossicles 10
10. Tube feet scattered dorsally, more prominent ventrally;
peri-oral table discs with up to 20 perforations; tentacles
with rods and rare rosettes.
. Massinium vimsi (Bass Strait, SE Australia)
— Tube feet more concentrated along longitudinal muscles;
peri-oral table discs with up to 40 perforations; tentacles
with rare fine rods, lacking rosettes.
. Massinium watsonae (SE Tasmania, Australia)
Massinium bonapartum O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:C34C417F-9A65-4346-
8145-ED9E350D7E21
Figures 5, 6, key.
Material examined. Holotype. NW Australia, Joseph Bonaparte Gulf,
Kimberley region, off King George River, 13.85°S 129.29°E, RV
Solander, 45 m, J. Keesing, 6 Jun 2013, WAM Z27860 (KGR lot
23323; UF tissue lot MOLAF1457).
Paratype. Joseph Bonaparte Gulf, 11.54°S 129.83°E, RV Solander ,
173 m. Geosciences Australia, 14 Sep 2009, NMV F202985 (1) (GA
lot SOL4934 35BS24; UF tissue lot MOLAF1519).
Description. Form sub-spherical, slightly elongate, up to 43
mm long (preserved), mouth anterior dorsal, anus posterior
dorsal, slightly developed oral and anal cones; firm leathery
body wall; tube feet scattered over body, withdrawn, diameters
about 0.2 mm, sparse dorsally, close cover ventrally and around
mouth and anus; 20 dendritic tentacles, 5 pairs large in an outer
ring, 5 pairs very small in an inner ring (proximal circum-
oral); calcareous ring long, tubular, composite; radial plates
blunt anteriorly with 2 lateral shallow notches and deeper
central notch, radial plates lacking median un-calcified section;
inter-radial plates pointed anteriorly, large oval un-calcified
posterior section closed distally by thin calcified link; 2 polian
vesicles; short branched gonad tubules; respiratory trees
extending the length of the coelom.
Ossicles in mid-body wall tables only, sparse dorsally,
more numerous ventrally; table disc outlines irregularly round,
typically 4 larger central and some small outer perforations,
margin smooth or spinous, discs up to 112 pm wide; spires
with 2 frequently fused pillars, low or residual, few thick blunt
apical spines. Oral disc with abundant tables with discs up to
112 pm long, irregularly oval, many perforations, margins
smooth; spires discrete, up to 70 pm long, 2 partly fused
pillars, rarely single, 1 to 3 median perforations, long apical
spines typically widely splayed. Peri-anal body wall with
abundant tables similar to those in the mid-body wall; some
rods with distal perforations, rods up to 80 pm long; small
multi-layered anal scales about 200 pm long. Tube feet with
endplates, up to 320 pm diameters, margin thick, lacking
support ossicles; body wall type tables. Tentacles with
abundant rods and rosette-like rod ossicles and some tables;
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
13
rods up to 70 pm long with ends widened with few perforations;
rosette-like rods up to 88 pm long with short rod widened
distally with many small perforations created by dendritic
branch fusing; few tables, similar to those in peri-oral disc.
Colour live off-white to pale yellow; colour preserved off-
white to pale brown, tube feet brown; tentacle dendritic
branches black, trunks off-white to grey.
Distribution. NW Australia, Joseph Bonaparte Gulf, Kimberley
region, off King George River, 45-173 m.
Etymology. Named with reference to the Joseph Bonaparte
Gulf from which the type specimens were collected.
Remarks. A distinctive character of Massinium bonapartum
O’Loughlin sp. nov. is the widely splayed long apical spines
frequently present on the tables. We observed the five pairs of
small tentacles to be in an inner ring. Massinium bonapartum
sp. nov. is distinguished from other species in the genus by the
combination of morphological characters shown in the key.
Massinium keesingi O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:BDDF31E0-C687-4932-
9541-A2C40266126C
Figures 7, 8, key.
Material examined. Holotype. NW Australia, Joseph Bonaparte Gulf,
Kimberley region, off King George River, 13.85°S 127.29°E, RV
Solander, large epibenthic sled, 45 m, J. Keesing, 6 Jun 2013, NMV
F203008 (KGR lot 23324; UF tissue lot MOLAF1458).
Description. Form sub-spherical, 40 mm long (preserved),
mouth anterior dorsal, anus posterior dorsal, slightly developed
oral and anal cones (preserved); firm leathery body wall; tube
feet scattered over body, withdrawn, sparse dorsally, more
numerous ventrally, diameters about 0.2 mm; 20 dendritic
tentacles, 5 pairs large in an outer ring, 5 pairs very small in an
inner ring (proximal circum-oral); calcareous ring long,
tubular, composite; radial plates blunt anteriorly with 2 lateral
small notches and deeper central notch, most of radial plates
Figure 5. Photos of live and preserved specimens of Massinium bonapartum O’Loughlin sp. nov. A, dorsal view of live holotype specimen (WAM
Z27860); B, lateral view of preserved paratype (NMV F202985, 43 mm long); insert with photo of the calcareous ring of the paratype; C, dorsal
view of preserved holotype (30 mm long); insert with sketch of the calcareous ring of the holotype; D, ventral view of the preserved holotype.
14
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
with long median un-calcified section; inter-radial plates
pointed anteriorly, small oval un-calcified section posteriorly;
1 polian vesicle; gonad tubules long, branched; respiratory
trees extending the length of the coelom.
Ossicles in mid-body wall tables only, sparse, scattered,
tables abundant in oral disc and peri-anally; table discs oval to
round, variable sizes, up to 90 p m long, margin smooth or
slightly undulating, not spinous, 4 large central perforations,
variable number of smaller outer perforations, some very
small; spires rare or reduced, if present 1 or 2 pillars, spires up
to half disc length long, few short spines apically. Oral disc
with rods as in tentacles and abundant tables with multi-
perforate discs and predominantly single pillar spires, discs
oval to sub-rectangular, 4 large central perforations, numerous
smaller outer perforations, discs up to 96 pm long, spires with
1 or 2 pillars, few short apical spines, length about half disc
length. Tube feet with endplates, diameters about 150 pm,
lacking support ossicles. Tentacles with rod ossicles only, up to
Figure 6. SEM images of ossicles from the holotype of Massinium bonapartum O’Loughlin sp. nov. (WAM Z27860). A, mid-dorsal body wall
tables, spires short with fused pillars (scale bars 20 pm); B, peri-anal body wall scale fragment (bottom right, scale bar 50 pm), and irregular
tables with 2 discrete or fused pillars (scale bars 20 pm); C, mid-ventral body wall tables (scale bars 20 pm), and fragment of endplate with
thickened margin (scale bar 50 pm); D, tentacle rods and rosette-like rod (scale bars 10 pm); E, oral disc tables, table discs irregularly oval with
many perforations, spires with 2 pillars partly fused and with long splayed distal spines (scale bars 20 pm).
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
15
90 pm long, smooth, ends widened with few perforations and
denticulate margin. Rosette ossicles not observed in tentacles
or oral disc or body wall.
Colour preserved off-white; tube feet pale brown.
Distribution. NW Australia, Joseph Bonaparte Gulf, Kimberley
region, off King George River, 45 m.
Etymology. Named keesingi for John Keesing (CSIRO), the
leader of the King George River Expedition, with appreciation
of John’s gracious and helpful collaboration in our work with
the sea cucumber collection.
Remarks. A distinctive character of Massinium keesingi
O’Loughlin sp. nov. is the frequent presence of table spires
with a single pillar. We observed the five pairs of small tentacles
to be in an inner ring. Massinium keesingi sp. nov. is
distinguished from other species in the genus by the
combination of morphological characters as detailed in the key.
Triasemperia O’Loughlin gen. nov.
Zoobank LSID. http://zoobank.org:act:5140E273-FE8D-4F8A-
A66D-F94B74771FE8
Diagnosis. Dendrochirotid species with mouth anterior, anus
posterior, lacking anal teeth; tube feet scattered over body; 20
dendritic tentacles, 15 large, 5 inner small; calcareous ring
composite, comprising small calcareous pieces, radial and
inter-radial composite plates adjoin to create tubular ring,
radial plates elongate with thin posterior distal prolongations
adjoining inter-radial plate elongations, radial plates with
median division for most of the length, inter-radial plates with
deep posterior notch; ossicles throughout the body wall tables,
discs triangular, typically with 6 large marginal knobs and 6
small perforations, spires with three pillars; tentacles with
rods, rosettes, few tables.
Type species. Triasemperia stola O’Loughlin sp. nov.
(monotypic).
Figure 7. Holotype specimen of Massinium keesingi O’Loughlin sp. nov. (NMV F203008). A, dorsal view of preserved holotype (40 mm long);
B, ventral view of preserved holotype; C, sketch of dorso-lateral view of the holotype; insert with sketch of the calcareous ring; D, photo of the
calcareous ring of the holotype.
16
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
Etymology. From the Greek tria (three), referring to the three
pillars of the table spires, with semperia, referring to the sub¬
family Semperiellinae and in turn to the esteemed biologist
Carl Gottfried Semper.
Remarks. The new genus Triasemperia is referred to the sub¬
family Semperiellinae on the bases of the presence of 20
dendritic tentacles and composite tubular calcareous ring. The
new genus is distinguished from the other genera of the
Semperiellinae by the presence of table spires with three pillars.
Triasemperia stola O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:B8F02EEE-7711-4519-
BC96-DE02BD4433F3
Figures 9, 10.
Material examined. Holotype. N Australia, Joseph Bonaparte Gulf,
12.32°S 129.94°E, shell and sand substrate, RV Solander, 46 m, AIMS
& GA, 5 Aug 2010, NMV F174889 (GA specimen 29084, SOL 5117,
013BS010; UF tissue lot MOLAF1541).
Paratypes. NE Australia, Queensland, Yeppoon, dredged off
Middle Island, 23.13°S 150.74°E, 9-37m, B. J. Smith, 6 Sept 1967,
NMV F204083 (1); same data, NMV F204088 (1).
Description. Form cylindrical, elongate, upturned oral and
anal ends, tapered orally, long taper anally, U-shape up to 45
mm wide (preserved); hard, thick, calcareous body wall,
‘prickly’ to touch; mouth anterior, anus posterior, lacking anal
teeth; tube feet scattered over body, withdrawn, inconspicuous
(preserved), diameters about 0.2 mm, paired radial series of
tube feet on withdrawn introvert; 20 dendritic tentacles, 15
large, 5 inner small; calcareous ring composite, comprising
small calcareous pieces, radial and inter-radial composite
plates adjoin to create tubular ring, radial plates elongate with
thin posterior distal prolongations adjoining inter-radial plate
elongations, radial plates with median division for most of the
length, inter-radial plates with deep posterior notch; single
polian vesicle; gonad tubules with numerous branches;
respiratory trees extending throughout the coelom.
Ossicles throughout body wall densely crowded thick tables,
table discs triangular, typically with 6 large marginal knobs and
6 small perforations, discs 80-120 pm wide, spires with 3
pillars and 6 pointed spines distally, disc width and spire height
sub-equal. Introvert and tube feet with tables, rods, endplates;
tables smaller, irregular, some lacking spires, perforations up to
19, discs up to 56-104 pm wide; smooth rods with distal ends
Figure 8. SEM images of ossicles from the holotype of Massinium keesingi O’Loughlin sp. nov. (NMV F203008). A, peri-anal body wall tables
and endplate fragment, discs with smooth margins, spires with 1 or 2 pillars (scale bars 10 //m); B, oral disc tables, table discs with smooth
margin, spires with single or 2 partly fused pillars, apical spines short and blunt (scale bars 10 pm)-, C, tentacle rods (scale bars 10 pm).
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
17
enlarged and perforated, up to 120 pm long; endplates with
diameters about 136 pm, tube foot support ossicles tables only.
Tentacles with rods, rosettes, tables; fine to thick smooth rods
with swollen perforated ends; tables rare, form regular or
irregular, some not knobbed, discs up 96 pm wide.
Live colour red-brown to brown, preserved colour brown
to off-white with residual violet colouration.
Distribution. Northern Australia, from Joseph Bonaparte Gulf
to Yeppoon Queensland, 9-53 m.
Etymology. Named stola with reference to the genus Stolus that
has species with heavily knobbed button-like ossicles that are
similar to the table discs of this species.
Remarks. The distinguishing morphological character of
Triasemperia stola is the presence of table spires with three
pillars. The calcareous ring and ossicles are similar to those of
Stolus crassus Liao and Pawson, 2001, but S. crassus from the
South China Sea is described as having 10 tentacles and only 2
pillars in the table spires.
Family Thyonidiidae Heding and Panning, 1954 {sensu
Smirnov 2012)
Remarks. Heding and Panning (1954) initially described the
Thyonidiinae as a sub-family within the Phyllophoridae
Ostergren, 1907. Based on the absence of posterior segmented
prolongations on the calcareous ring Pawson and Fell (1965)
transferred the Thyonidiinae to a sub-family within the
Cucumariidae Ludwig, 1894. Based on the presence of more
than 10 tentacles and table ossicles Smirnov (2012) raised
Thyonidiinae to family status as Thyonidiidae. The plate
ossicles in Parathyonidium Heding (in Heding and Panning),
1954 and “reduced” ossicles in Athyonidium Deichmann, 1941
and Patallus Selenka, 1868 suggested to Smirnov (2012) that
these genera were probably unrelated to the genera with tables.
Actinocucumis Ludwig, 1875
Actinocucumis Ludwig, 1875: 91.—Theel, 1886: 125.—H. L.
Clark, 1946: 402-403.-Heding and Panning, 1954: 70-72.-A. M.
Clark and Rowe, 1971: 204.
Figure 9. Photos of live and preserved specimens of Triasemperia stola O'Loughlin sp. nov. A, lateral view of live holotype specimen (mouth
right; NMV F174889); B, lateral view of preserved holotype (mouth right, lateral view width 45 mm); C, lateral view of preserved paratype (mouth
right, lateral view width 50 mm, NMV F204088); D, photo of the calcareous ring of the holotype; insert with sketch of the calcareous ring.
18
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
Type species. Actinocucumis typica Ludwig, 1875 (type locality
Queensland, Bowen, 20°S 148°E)
Other species and type localities. Actinocucumis chinensis Liao
and Pawson, 2001 (off Hainan, South China Sea); A. cornus (Heding,
1934) (Hong Kong); A. difficilis Bell, 1884 (Torres Strait, north-east
Australia); A. longipedes Clark, 1938 (Broome, north-west Australia);
A. simplex (Sluiter, 1914) (Indonesia); A. solanderi O’Loughlin sp.
nov. (off King George River, northern Australia) (see below).
Remarks. Heding and Panning (1954) listed numerous
synonymies for Actinocucumis typica, with lengthy discussion.
We have not examined the relevant type specimens but based
on the figures and descriptions in the literature, and on our
sensu stricto diagnosis of A. typica below, we raise all of these
species out of synonymy.
We note that in discussing their synonymies Heding and
Panning (1954) observed in their slide preparations from
Actinocucumis typica and Actinocucumis cornus specimens
small elongate plates with two long mid-plate perforations and
two small distal ones. This form of ossicle was illustrated by
H. L. Clark (1938) for Actinocucumis longipedes. Ludwig
(1875) did not illustrate this form of ossicle and we have never
observed such ossicles in our preparations from specimens of
A. typica from the region of the type locality and across
northern Australia. It appears to us that Heding and Panning
were not examining specimens of A. typica.
Two ossicles are drawn for Actinocucumis typica in Clark
and Rowe (1971; fig. 95 e and e’). We have seen only the left
Figure 10. SEM images of ossicles from the holotype of Triasemperia stola O’Loughin sp. nov. (NMV F174889). A, mid-dorsal body wall tables,
spires with 3 pillars (scale bars 20 //m); B, peri-anal body wall tables (scale bars 20 /on); C, tube foot tables (scale bars 20 //m); D, tentacle rods
(scale bars 20 pm).
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
19
hand side form (e) in the specimens of A. typica that we have
examined, and this is the only form in the original description
by Ludwig (1875). The right hand side form (e’) appears to be
typical of Actinocucumis longipedes and was referred to by
Heding and Panning (1954) above. The two ossicle forms
appear to have been drawn from a specimen of A. longipedes.
We note that the Clark and Rowe (1971) illustration of
ossicles from A. typica (pi. 30 fig. 4) is in fact from a type
specimen of Actinocucumis difficilis Bell that was judged to
be a con-specific with A. typica. The ossicles appear to us to
exemplify A. typica, and that adds weight to the probability of
a synonymy (NHMUK type information confirmed by
Andrew Cabrinovic). There are no small elongate plates with
two long mid-plate perforations and two small distal ones in
this preparation.
The single type specimen from Hong Kong of Phyllophorus
cornus Heding, 1934 has tube feet all over the body, five inner
tentacles and 15 outer, and five anal teeth. Ossicles from the
type of Actinocucumis cornus were used for the illustration in
Heding and Panning (1954, fig. 19) of the ossicles of A. typica.
The original illustration of ossicles for A. cornus (Heding
1934) did not show fenestrated ellipsoids. That in Heding and
Panning (1954) did show fenestrated ellipsoids. Neither
illustrated the small plates with two long and two small distal
perforations that Heding and Panning (1954) indicated were
present. We judge that the status of A. cornus as conspecific
with A. typica remains uncertain, and we raise it out of
synonymy as an Actinocucumis species.
Pseudocucumis quinqangularis Sluiter, 1901 from
Indonesia has posterior prolongations on the radial plates of a
composite calcareous ring, 12 large outer and six small inner
tentacles, and an absence of figure-8 ossicles and fenestrated
ellipsoids. It is not a species of Actinocucumis and we raise the
species out of synonymy in the original combination to await
further study.
The single small type specimen from Ceylon of
Actinocucumis donnani Pearson, 1903 does not have the
tentacles present, has a composite calcareous ring with long
posterior prolongations on the radial plates, and has body wall
ossicles that are not fenestrated ellipsoids or any form of table.
It is not an Actinocucumis species. In the absence of tentacles
it is not possible to re-assign the species that we regard as
incertae sedis.
The illustrations for Phyllophorus simplex Sluiter, 1914
indicate ossicles that do not include fenestrate ellipsoids and
typical figure-8 plates, and the description reports tube feet
covering the body. It is not conspecific with Actinocucumis
typica, and we raise it out of synonymy with reservations as an
Actinocucumis species.
H. L. Clark (1938, 1946) examined numerous specimens
of Actinocucumis from northern Australia and was convinced
of the existence of four species: A. typica, A. difficilis, A.
longipedes, A. quinuangularis. We reject A. quinuangularis
as an Actinocucumis species (above), but accept the judgment
by Clark who recognized the other three species. We raise A.
difficilis and A. longipedes out of synonymy here. In the case
of A. difficilis we defer to the experience of H. L. Clark (1938,
1946) who had an abundance of material to examine, but we
also judge that the morphological characters that he used to
distinguish this species are probably variable characters. We
think that a confirmed synonymy requires more consideration.
The presence in A. longipedes of small elongate plates with
two long mid-plate perforations and two small distal ones is
apparently systematically distinctive.
We note the absence of fenestrated ellipsoids and radial
papillae in Actinocucumis chinensis and continue to refer this
species to Actinocucumis with reservation, as did Liao and
Pawson (2001).
Actinocucumis typica Ludwig, 1875
Actinocucumis typica Ludwig, 1875: 91, fig. 24 a-d.—Lampert,
1885: 177.—Theel, 1886: 84, 125, pi. 12 figs 4, 5.-Ludwig, 1888:
817,-Erwe, 1913: 364-365, pi. 6 fig. 10a, b.
Actinocucumis typicus.—YL. L. Clark, 1921: 170.—Clark, 1938:
479.—Clark, 1946: 403.—Heding and Panning, 1954: 72-74, figs 19,
20 (part).—A. M. Clark and Rowe, 1971: fig. 95 e, pi. 30 fig. 4 (part).—
Liao and Clark, 1995: 481-482, fig. 290, pi. 23 fig. 10 (part).
Material examined. NE Australia, Queensland: Yeppoon, dredged off
Middle Island, 23.13°S 150.74°E, 9-37m, B. J. Smith, 6 Sept 1967,
NMV F204078 (1); Mackay harbour, 21.15°S 149.18°E, Ian Kirwan,
14 Jul 1982, NMV F206362 (1); near Cairns, Machans Beach, 16.85°S
145.73°E, on beach after cyclone, B. Collins, 25 Dec 1996, NMV
F203016 (2); N Australia, Joseph Bonaparte Gulf, 11.55°S 129.82°E,
RV Solander, 48 m, AIMS & GA, 26 Aug 2010, NMV F173265 (1)
(GA lot SOL5117 lot 082BS040; UF tissue lot MOLAF1552); NW
Australia, Dampier Archipelago, 1.3 km E of Eaglehawk I., FRV
Flinders, DA2/73/01, 20.67°S 116.46°E, coarse sand, 13 m, 24 Jul
1999, NMV F209501(l).
Diagnosis (sensu stricto). Dendrochirotid species, uniform
brown colour (NMV F204078), or yellowish brown with some
red patches and fine black flecking (NMV F173265), or pale
brown to cream with fine brown flecking on body and larger
brown patches on tube feet (NMV F206362); body pentagonal
in section with raised radial ridges; five thick oral valves; about
20 dendritic tentacles, variable in arrangement and size, ventral
pair smallest; tube feet confined to radii, small papillae and
tube feet also on radii and encroaching inter-radially; tube feet
in 4-6 rows (80 mm long specimen, Ludwig 1875), or in paired
rows (smaller 35-44 mm long specimens, this work); calcareous
ring not composite, radial plates with vertical sides, radial and
inter-radial plates lacking posterior prolongations.
Body wall ossicles abundant, crowded, small plates and
ellipsoids, and rare, thick large plates; bi-perforate plates
(figure-8 form, “acorn” plates in Ludwig 1875 and Clark 1938,
1946) predominate, up to about 40-50 pm long with one
central and 5 marginal knobs, the apical knob typically
projecting; bi-perforate plates inter-grade with abundant but
less numerous irregularly ovoid fenestrated ellipsoids, up to
about 40-55 pm long; large plates thick, irregular in outline,
perforation sizes irregular, plates frequently more than 150
pm long. Tube feet with endplates and support tables; large
endplate diameters about 240 pm, small endplate diameters
about 120 pm\ table discs elongate, up to 160 pm long, narrow,
widened centrally and distally, spires with 4-pillar base,
pillars frequently joined to form an arch, arches frequently
with single, long, thick, pointed, apical spine. Introvert with
20
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
abundant tables, spires with four-pillar base and pillars fused
with distal narrow arch or long spine or 2 short blunt spines.
Papillae with body wall ossicles, rare tables, and lacking
endplates. Lacking anal scales.
Remarks. Because uncertainty remains about the assignment of
species to this genus we provide a sensu stricto diagnosis of
Actinocucumis typica, based on the morphological characters of
the type species. We examined six northern Australian specimens
of Actinocucumis (listed above). We confidently judge that four of
these specimens are Actinocucumis typica as all of their
morphological characters closely fit the original description and
illustrations by Ludwig (1875). These characters are detailed in the
generic diagnosis above. With less confidence we judge that the
two beach-washed specimens are also A. typica (NMV F203016).
The ossicles of specimens from the Philippines that are
illustrated by Reyes-Leonardo et al. (1985) appear to us to be
close to those illustrated for Actinocucumis longipedes,
although the description refers to the presence of fenestrated
ellipsoids and irregular tables with pointed spires. The
descriptive reference to “wart-like” podia scattered all over
the body” is not characteristic of A. typica.
Actinocucumis solanderi O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:804F4A5E-37B6-441B-
BBC7-BBA118E61036
Figures 11, 12.
Material examined. Holotype. N Australia, Joseph Bonaparte Gulf,
13.82°S 127.32°E, 73 m, 12 Jun 2013, WAM Z27850 (KGR specimen
29384; UF tissue lot MOLAF1438).
Paratype. Joseph Bonaparte Gulf, 11.04°S 129.81°E, RV Solander,
52 m. Geoscience Australia, 9 Jun 2009, NMV F202991 (1) (GA lot
SOL4934 lot 23BS14; UF tissue lot MOLAF1508).
Figure 11. Photos of preserved specimens of Actinocucumis solanderi O’Loughlin sp. nov. A, right lateral view of the preserved holotype
(mouth right, 45 mm long, WAM Z27850); insert with sketch of a transverse section of the new species showing slight radial ridges and large and
small tube feet and papillae; B, right lateral view of the preserved paratype (mouth left, 55 mm long, NMV F202991); C, dorsal view of tentacle
crown with small tentacles ventrally (paratype NMV F202991); D, photo of the calcareous ring of the holotype; insert with sketch of the
calcareous ring.
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
21
Description. Form elongate, sub-cylindrical, slightly
pentagonal with raised radial ridges tending to create 5 oral
and 5 anal valves, mouth anterior, anus posterior, slightly
tapered and up-turned orally and anally, up to 55 mm long
(preserved); hard, thick, calcareous body wall; 20 dendritic
tentacles, about 10 large dorsally, about 10 small ventrally; tube
feet conspicuous, extended, predominantly on radii in irregular
paired series, largest in mid-body on radii, diameters about 1.0
Figure 12. SEM images of ossicles from the holotype of Actinocucumis solanderi O'Loughlin sp. nov. (WAM Z27850). A, oral disc and tentacle
tables, spires with 4 pillars, and tentacle rods and curved perforated rod-plates (scale bars 10 pm); B, mid-dorsal body wall reduced tables with
four pillar spires (scale bar 10 pm); C, mid-ventral body wall tables, and tube foot elongate support tables and endplate fragment (two top left
long scale bars 100 pm, short bars 10 pm; typical box-like table bottom right); D, peri-anal body wall reduced tables (scale bars 10 pm; typical
box-like table bottom right).
22
P.M. O’Loughlin, M. Mackenzie & D. VandenSpiegel
mm, small tube feet (with endplates) and papillae (lacking
endplates) on radii and encroaching on inter-radii, diameters
about 0.3 mm; lacking anal scales; calcareous ring comprising
non-fragmented radial and inter-radial plates, lacking posterior
prolongations, radial plates sub-rectangular with larger anterior
median notch and smaller lateral notches, inter-radial plates
with long anterior taper to blunt point; single polian vesicle;
gonad tubules with multiple branches; respiratory trees
extending throughout the coelom.
Ossicles throughout the dorsal, ventral and peri-anal body
wall are densely crowded small, thick irregular tables and
reduced tables, and large, elongate smooth perforated plates;
tables frequently box-like with round disc about 30-40 pm
wide with single perforation, disc width similar to spire height,
spires about 25-35 p m high with 4 pillars joined mid-spire and
apically, short blunt spines apically, tables often reduced with
incompletely formed and irregular disc and spire; body wall
tables inter-grade in form with elongate tube foot support
tables; perforated plates numerous in body wall, surface and
margin smooth, up to about 240 pm long. Tentacles with tables,
rods and rod-plates, lacking rosettes; table discs irregularly
round to elongate oval, central disc single perforation and few
large or many small outer perforations, disc margin undulating
to denticulate, discs up to about 80 pm long, spires well-
developed with four-pillar base, blunt spines distally and
sometimes along spire, spires up to 50 pm high; curved rods
perforated along rod, margin denticulate; rod-plates thick,
wide, perforate distally, sometimes bifid distally, up to 440 pm
long. Tube feet with endplates about 450 fim in diameter; tube
foot support ossicles elongate tables with narrow curved discs
up to 450 fim long and four pillar spires variably developed.
Introvert with abundant tables as in tentacles.
Colour preserved off-white to grey to pale brown with a
hint of residual crimson dorsally, dark brown to black small
spots spaced all over body; tube feet off-white with brown
disc.
Distribution. N Australia, Joseph Bonaparte Gulf, 52-73 m.
Etymology. Named for the research vessel of the Australian
Institute of Marine Science, the RV Solander, from which the
King George River expedition and cruise SOL 4934 were
conducted and these type specimens collected.
Remarks. The distinguishing morphological character of
Actinocucumis solanderi O’Loughlin sp. nov. is the presence
in the body wall of abundant small, thick, box-like tables and
tables that are reduced to varying degrees.
Acknowledgements
We are grateful to John Keesing (CSIRO), Rachel Przeslawski
(GA), and Mark Salotti (WAM) who graciously made available
the specimens studied here, and provided the collection and
registration data. We are appreciative of the assistance of
Elnaz Tavancheh (NMV Volunteer) with the identification of
specimens, of Gustav Paulay (UF) and Frank Rowe (Research
Associate of the Australian Museum) for sharing their opinions
on systematic issues, of Andrew Cabrinovic (NHMUK) for
type specimen confirmation, and of Ben Boonen for assistance
with figure formatting. This research was supported and
funded in part by the Total Corporate Foundation (Paris) and
CSIRO’s Wealth from Ocean’s National Research Flagship,
and we acknowledge their significant contribution. We are
most grateful to Frank Rowe (Research Associate of the
Australian Museum) for his most helpful review comments.
References
Bell, F. J. 1883. Studies on the Holothurioidea II. Descriptions of new
species. Proceedings of the Zoological Society of London 1883:
58-62, pi. 15.
Bell, F. J. 1884. Echinodermata. Pp. 117-177, pis 8-18 in. Report on
the Zoological Collections made in the Indo-Pacific Ocean
during the Voyage of H.M.S. Alert 1881-2. Taylor and Francis:
London.
Brandt, J. F. 1835. Prodromus descriptionis animalium ab H. Mertensio
in orbis terrarum circumnavigatione observatorum. Petropoli
5(1): 1-75, 1 pi..
Cherbonnier, G. 1958. Sur le genre Globosita n. n. = Sphaerella
Heding et Panning (Holothurie, Dendrochirotes). Bulletin du
Museum National Histoire Naturelle, Paris. 30(2): 198.
Cherbonnier, G. 1988. Echinodermes: Holothurides. Faune de
Madagascar. Publice sous les auspices du Gouvernment de la
Republique Malgache, 70, Editions de l’Orstom, Paris. 292 pp.
Clark, A. M. and Rowe, F. W. E. 1971. Holothurioidea. Pp. 171-210.
In: Monograph of Shallow Water Indo-West Pacific Echinoderms.
Trustees of the British Museum (Natural History), London.
Publication 690. 238 pp., 31 pis.
Clark, H. L. 1921. The Echinoderm fauna of Torres Strait: its
composition and its origin. Carnegie Institution of Washington
Publication 214. 233 pp., 10 pis.
Clark, H. L. 1938. Echinoderms from Australia. An account of
collections made in 1929 and 1932. Memoirs of the Museum of
Comparative Zoology at Harvard College 55: 1-596, 28 pis, 63 figs.
Clark, H. L. 1946. The echinoderm fauna of Australia. Its composition
and its origin. Carnegie Institution of Washington Publication
566: 1-567.
Deichmann, E. 1930. The holothurians of the western part of the
Atlantic Ocean. Bulletin of the Museum of Comparative Zoology
at Harvard College 71(3): 43-226, 24 pis.
Deichmann, E. 1941. The Holothurioidea collected by the Velero III
during the years 1932-1938. Part I. Dendrochirotida. Allan
Hancock Pacific Expeditions 8(3): 61-195, pis 10-30.
Deichmann, E. 1944. Urodemas bifurcatum, a new holothurian from
South Africa, with a revision of the genus Urodemas Selenka. The
Annals and Magazine of Natural History 11(11): 731-737.
Domantay, J. S. 1934. Four additional species of littoral Holothurioidea
of Port Galera Bay and adjacent waters. University of the
Philippines Natural and Applied Science Bulletin 4: 109-115.
Erwe, W. 1913. Holothurioidea. Pp. 349-402. In: Die Fauna Siidwest-
Australiens. Ergebenisse der Hamburger siidwest-australischen
Forschungsreise 1905herausgegebenvonProf. Dr. W. Michaelsen
und Dr. R. Hartmeyer 4(9). Fischer, Jena.
Grube, A. E. 1840. Aktinien, Echinodermen und Wiirmer des
Adriatischen und Mittelmeeres. pp. 33-43, 1 pi. Konigsberg.
Heap, A. D., Przeslawski, R., Radke, L., Trafford, J., Battershill, C.
and Shipboard Party 2010. Seabed Environments of the Eastern
Joseph Bonaparte Gulf Northern Australia. SOL4934 - Post¬
survey Report. Geoscience Australia, Record 2010/09, 78 pp.
(available on-line).
Heding, S. G. 1934. On some holothurians from Hong Kong. The
Hong Kong Naturalist. Supplement 3: 15-25, 5 figs, pi. 9.
New dendrochirotid sea cucumbers from northern Australia (Echinodermata: Holothuroidea: Dendrochirotida)
23
Heding, S. G. and Panning, A. 1954. Phyllophoridae. Eine bearbeitung
der polytentaculaten dendrochiroten holothurien des zoologischen
museums in Kopenhagen. Spolia Zoologica Musei Hauniensis 13:
209 pp.
Lampert, K. 1885. Die Seewalzen, Holothurioidea, eine Systematische
Monographie mit Bestimmungs und Verbreitungs Tabellen. In
Semper, C. (ed.) Reisen im Archipel der Philippinen. Zweiter teil.
Wissenschaftliche Resultate 4(3): 311 pp., 1 pi. C. W. Kreidel's
Verlag, Wiesbaden.
Liao, Y. and Clark, A. M. 1995. The echinoderms of southern China.
614 pp., 23 pis. Science Press, Beijing.
Liao, Y. and Pawson, D. L. 2001. Dendrochirote and dactylochirote
sea cucumbers (Echinodermata: Holothuroidea) of China, with
descriptions of eight new species. Proceedings of the Biological
Society of Washington 114(1): 58-90.
Ludwig, H. 1874 (1875). Beitrage zur Kenntniss der Holothurien.
Arbeiten aus dem Zoologisch-Zootomischen Institut in WUrzburg
2: 77-120, pis 6-7.
Ludwig, H. 1882. List of the holothurians in the collection of the
Leyden Museum. Notes Leyden Museum 4(10): 127-137.
Ludwig, H. 1888. Die von Dr. J. Brock im Indischen Archipel
gesammelten Holothurien. Zoologische Jahrbiicher. Abteilung
fur Systematik, Geographie und Biologie der Tiere 3: 805-820,
pi. 30.
Ludwig, H. 1894. The Holothurioidea. XII. Report on an Exploration
off the west coasts of Mexico, Central and South America, and off
the Galapagos Islands, in charge of Alexander Agassiz, by the US.
Lish Commission Steamer Albatross during 1891, Lt. Z. L. Tanner
USN., Commanding. Memoirs of the Museum of Comparative
Zoology at Harvard College 17(3): 183 pp., 19 pis.
Michonneau, L. and Paulay, G. 2014. Revision of the genus Phyrella
(Holothuroidea: Dendrochirotida) with the description of a new
species from Guam. Zootaxa 3760(2): 101-140.
Nichol, S. L., Howard, L. J. L, Kool, J., Siwabessy, J. and Przeslawski,
R., 2013. Oceanic Shoals Commonwealth Marine Reserve (Timor
Sea) Biodiversity Survey: GA0339/SOL5650 Post-survey Report.
Record 2013/038. Geoscience Australia, Canberra (available
on-line).
O’Loughlin, P. M., Barmos S. and VandenSpiegel D. 2012. The
phyllophoridsea cucumbers of southern Australia(Echinodermata:
Holothuroidea: Dendrochirotida: Phyllophoridae). Memoirs of
Museum Victoria 69: 269-308.
Ostergren H. 1907. Zur Phylogenie und Systematiek der Seewalzen.
Pp. 191-215. In: Sartryck ur Zoologiska studier tillagnade T.
Tullberg pa hans 65-drs dag. Almquist et Wiksell, Uppsala.
Panning, A. 1949. Versuch einer Neuordnung der Lamilie
Cucumariidae (Holothurioidea, Dendrochirota). Zoologische
Jahrbiicher Abteilung fur Systematik, Okologie Geographie Tiere
78: 404-470.
Pawson, D. L. and Pell, H. B. 1965. A revised classification of the
dendrochirote holothurians. Breviora 214: 1-7.
Pearson, J. 1903. Report on the Holothurioidea collected by Professor
Herdman, at Ceylon, in 1902. Ceylon Pearl Fisheries-1903-
Supplementary Reports 5: 181-208, pis 1-3.
Przeslawski, R., Alvarez de Glasby, B., Smit, N., Evans-Illidge, L. and
Dethmers, K. 2013. Benthic Biota of Northern Australia:
SS2012t07 Post-survey Report. Record 2013/07. Geoscience
Australia: Canberra (available on-line).
Reyes-Leonardo, L. D., Monzon, R. B. and Navarro, V. C. 1985. A
taxonomic account of shallow water holothurians of Bolinao,
Pangasinan. Natural and Applied Science Bulletin 37(4): 261-284.
Rowe, P. W. E. and Richmond, M. D. 2004. A preliminary account of
the shallow-water echinoderms of Rodrigues, Mauritius, western
Indian Ocean. Journal of Natural History 38: 3273-3314.
Samyn, Y. and Thandar, A. 2003. Massinium, a new genus in the
family Phyllophoridae (Echinodermata: Holothuroidea:
Dendrochirotida) with description of a new south-west Indian
Ocean species M. maculosum. Belgian Journal of Zoology 133(2):
135-142.
Samyn, Y., Thandar, A. S., and VandenSpiegel, D. 2010. Two new
species in the phyllophorid genus Massinium (Echinodermata:
Holothuroidea) with redescription of Massinium magnum.
Zootaxa 2399: 1-19.
Selenka, E. 1867. Beitrage zur Anatomie und Systematik der
Holothurien. Zeitschrift fiir Wissenschaftliche Zoologie 17(2):
291-374, pis 17-20.
Selenka, E. 1868. Nachtrag zu den Beitragen zur Anatomie und
Systematik der Holothurien. Zeitschrift fiir Wissenschaftliche
Zoologie 18: 109-119, pi. 8.
Semper, C. 1867. Reisen im Archipel der Philippinen. Zweiter Theil.
Wissenschaftliche Resultate. 1, Holothurien. 285 pp., 40 pis.
Wilhelm Engelmann, Leipzig.
Sluiter, C. P. 1901. Siboga -Expedite. Die Holothurien der Siboga-
Expedition 44. 142 pp., 11 pis.
Sluiter, C. P. 1914. Die von Dr. P. N. van Kampen, wahrend seiner
Fahrten mit dem Reglierungsdampfer Gier 1906-1909, im
Indischen Archipel gesammelten Holothurien. Buitensorg
Contribution Faune Indes Neerlandaiises 1(1): 1-28, 1 pi.
Smirnov, A. V. 2012. System of the class Holothuroidea.
Paleontological Journal 46 (8): 793-832.
Thandar, A. S. 1989. The sclerodactylid holothurians of southern
Africa, with the erection of one new subfamily and two new
genera (Echinodermata: Holothuroidea). South Africa Journal of
Zoology 24(4): 290-304.
Theel, H. 1886. Report on the Holothurioidea dredged by H.M.S.
Challenger during the years 1873-1876. Report on the scientific
results of the voyage of H.M.S. Challenger, Zoology 14 (39):
1-290, 16 pis.
Memoirs of Museum Victoria 72:25-30 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
A new genus and species of Calocidae (Trichoptera: Insecta) from south eastern
Australia
M.E. SHACKLETON 1 * (http://zoobank.org/um:lsid:zoobank.org:author:B95DlABB-6728-4F97-B024-D994D8A9B8D2),
J.M. WEBB 2 (http://zoobank.org/urn:lsid:zoobank.org:author:CD6F532E-3630-4DA6-BFEF-0C91CB9F610C),
S.H. LAWLER 3 (http://zoobank.org/urn:lsid:zoobank.org:author:EBlCAD81-EE0D-4E5F-AA8B-277C222E413F) AND
P.J. SUTER 4 (http://zoobank.Org/urn:lsid:zoobank.org:author:EDDC454C-E7F3-4F91-BE63-EAD237059A82)
1 3 A La Trobe University, Department of Environmental Management and Ecology, University Drive, WODONGA,
Victoria, 3690 (m.shackleton@latrobe.edu.au)
2 Rhithron Associates Inc, 33 Fort Missoula Road, Missoula, MT USA 59802
* To whom correspondence and reprint requests should be addressed. Email: m.shackleton@latrobe.edu.au
http://zoobank.Org/urn:lsid:zoobank.org:pub:691C8CCF-5F71-4933-8E20-ClD9B129A8E4
Abstract Shackleton, M.E., Webb, J.M., Lawler, S.H. and Suter, RJ. 2014. A new genus and species of Calocidae (Trichoptera:
Insecta) from south eastern Australia. Memoirs of Museum Victoria 72: 25-30.
Latarima gen. nov. (Trichoptera: Calocidae) is described from southeastern Australia based on the male adult, male
pupa, and larva. Two species are included, L. explicatala sp nov. and L. furcilla (Neboiss, 1984a) comb. nov. Males of
Latarima gen. nov. are distinct from other Calocidae genera in that segment X of the genitalia is widely incised, forming
two elongate sections on the segment. Larvae are distinguished by a reticulate texture of the head capsule and a
frontoclypeus that widens suddenly towards the anterior and possesses many setae in the antero-lateral corners. Larvae
were previously placed in the interim genus Cal/Hel Genus G by Jackson (1998). This work increases the number of
Calocidae genera to 7.
Keywords Latarima gen. nov., explicata sp. nov, Tamasia furcilla , Pupa, Larva.
Introduction
There are currently 6 recognised genera in the family Calocidae
Ross, with 5 occurring in Australia and 1 monotypic genus in
New Zealand. Mosely (1936) described the first genus Tamasia
Mosely, 1936, which contained a single species Tamasia
variegata Mosely, 1936. It was originally placed in the family
Sericostomatidae, Stephens. Mosely and Kimmins (1953) later
described seven new species from three new genera, also
placed in the family Sericostomatidae, that would later be
included in the family Calocidae. These were Caenota plicata
Mosely, in Mosely and Kimmins 1953, Caenota simulans
Mosely, in Mosely and Kimmins 1953, Caloca straminea
Mosely, in Mosely and Kimmins 1953, Caloca tertia Mosely, in
Mosely and Kimmins 1953, Caloca eba Mosely, in Mosely and
Kimmins 1953, and Caloca fallia Mosely, in Mosely and
Kimmins 1953. A further species, Tismana saneva Mosely, in
Mosely and Kimmins 1953, was placed in the Odontoceridae
and later synonymised with Caloca by Neboiss (1977).
The name Calocidae was established by Ross (1967)
presumably to accommodate these seemingly related genera:
Caenota Mosely, 1953, Caloca Mosely, 1953, and Tamasia. In
his publication, Ross (1967) gave no indication of the genera to
be included in the family but stated that the leg spur formula
was 2:2:4 and that Calocidae were similar to ancestor 15
(Neboiss 1977; Jackson 1991; Holzenthal etal. 2007). Johanson
and Malm (2010) indicate that the family name is derived from
Caloca suggesting the inclusion of this genus.
The New Zealand endemic, monotypic genus,
Pycnocentrella Mosely, 1953, was originally described in
Mosely and Kimmins (1953) and placed in the family Baeridae.
Ross (1967) established the family Pycnocentrellidae Ross,
again without indicating which genera it contained. However,
Pycnocentrella can be assumed to be included. Pycnocentrella
was transferred to Calocidae by Neboiss (1977).
Neboiss (1984a) added two new species to the genus
Tamasia, T. acuta Neboiss, 1984a, and T. furcilla Neboiss,
1984a. In the same year two further genera were described in
the Calocidae in Neboiss (1984b). These were Calocoides
Neboiss, 1984b, with a single species and Pliocaloca Neboiss,
1984b, with three species, all from northern Queensland.
The taxonomy of the family is based on characters of the adult
males. Until recently, the larvae of only 5 species from four genera
were known: Caloca saneva, Caenota plicata, Pycnocentrella
eruensis Mosely, 1953, T. variegata, and T. acuta. These were
26
M.E. Shackleton, J.M. Webb, S.H. Lawler & P.J. Suter
illustrated in Jackson (1998), along with a number of larval types
which she considered likely to be distinct genera. Jackson (1998)
gave these the temporary generic names Genus Cal/Hel A - H.
The genus name Cal/Hel reflected her uncertainty as to whether
these taxa belonged to the family Calocidae or Helicophidae.
Neboiss (2002) associated the larva of the monotypic Genus Cal/
Hel A with a newly described species, Heloccabus buccinatus
Neboiss, 2002, that he tentatively placed in the family
Helicophidae. The taxa Genus Cal/Hel B, C, and D have recently
been associated with known and newly described species, each in
separate genera (Cal/Hel B and C, Shackleton, in prep; Cal/Hel D,
Shackleton and Webb, 2014). All genera described to date can
easily be distinguished through examination of larval characters.
The current study provides descriptions of the adult male
and pupa of a new species and genus, Latarima gen. nov.
explicatala sp. nov, which is associated with the larva that
Jackson (1998) referred to as Genus Cal/Hel G. The presence of
male genital characters on a pharate male pupa, along with the
sclerites of the larva, which are exuviated and retained in the
posterior of the pupal case, enables an association between the
life stages of the species (Milne 1938). Similarities in adult male
characters between this species and that of Tamasia jurcilla
suggest a close relationship between the two. Here we suggest
that these two species belong in the new genus, Latarima gen.
nov. This work increases the number of Calocidae genera to 7.
Materials and Methods
Adult, larval and pupal specimens were obtained from the
Museum of Victoria, Melbourne, and the Environmental
Protection Authority, Victoria. All specimens are deposited in
the Museum of Victoria, Melbourne.
Larval sclerites were extracted from pupal cases and
compared with known larvae. Similarities in the genitalia of
pharate male pupae were used to associate the adult with the
pupal form.
Material was examined using a Nikon SMZ1500
microscope. Photographs were taken using a Nikon DS-Fil
camera mounted on a Nikon SMZ1500 microscope. Helicon
Focus 5.3.7 was used to create photographs with a wide depth
of field. Photographs were edited using GIMP 2.6.11.
Terminology of the adult characters follows that of Mosely
(1936), Neboiss (1991, 1992), and Holzenthal et al. (2007).
Terminology of the larval characters follows that of Jackson
(1998). Terminology of pupae follows that of Holzenthal et al.
(2007). Because the modification of the hind wing venation of
this species makes identification of individual veins difficult,
the author’s interpretation of the wing venation is indicated on
the illustrations provided.
Family Calocidae
Latarima Genus nov.
Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:
955AF7F6-958F-4485-AC37-80DD885EE461
Type species: L.furcilla (Neboiss) comb. nov. ( Tamasia furcilla
Neboiss in Neboiss 1984a).
Generic Diagnosis. Adult and larval characters can be used to
distinguish Latarima from all other Calocidae genera. This
genus is the only Calocidae genus known where segment X, in
the adult males, is widely separated at the base of the segment.
The dorsal surface of the head capsule, in the adult male, does
not possess eversible scent organs, as in Caloca and Pliocaloca.
The segments of the maxillary palps are expanded, similar to
Tamasia, Caenota, and Pycnocentrella. However, unlike
Caenota, segments 3 and 4 are not greatly reduced. As with
Tamasia, but no other Calocidae genus, there are only 4
maxillary palpal segments.
In the larva, the frontoclypeus widens suddenly towards
the anterior margin, unlike those of Caloca, Tamasia, and
Calocoides. The posterior and anterior portions of the
frontoclypeus are separated by a constriction and the lateral
margins of the anterior portion are somewhat rounded. This is
dissimilar to Pycnocentrella eruensis where the anterior
portion diverges out from the posterior portion in a straight
line without any constriction between the two. The head and
pronotum is reticulate in texture and does not possess the
dense, short, papillate setae present in Tamasia or Pliocaloca.
The metanotum does not possess a small, sclerotised ridge on
the anterior margin, as in Caenota and Calocoides. The
foretrochantin is fused to the propleuron, unlike that of
Pliocaloca.
Generic description. Adult male: Dark brown to blackish, white
markings on wings. Head: dorsum with single setal wart along
midline; small receptacle on posterior margin dorsally
extending mid-dorsal setal wart, not membranous, without
eversible scent organs; posterior setal warts absent; postocular
setal warts long, narrow. Maxillary palps four segmented,
segments irregular, bulbous, apical segment reflexed
posteriorly; labial palps three segmented; antenna slightly
shorter than fore wing; scape long, with highly setose anterior
projection. Pronotum: one pair lateral setose warts.
Mesoscutellum smooth. Scutellum with one pair, elongate,
setal warts. Legs: tibial spines 2:2:4. Wings: Forewing:
discoidal cell present; thyridial cell present; fork 1 and 2
sessile; fork 3 petiolate; fork 4 absent; fork 5 sessile or slightly
petiolate. Hind wing: venation reduced, with or without
posterior fold; discoidal cell present; thyridial cell absent; base
of M absent; large vein-free area in basal posterior section if no
fold present; Sc and R1 fused; cell formed by Sc and C relatively
large; fork 1 sessile, no other forks present. Genitalia: Segment
X divided into two elongated, widely separated segments.
Larva\ Head: reticulate in texture; frontoclypeus widens
suddenly anteriorly; antennae close to eye. Pronotum: with weak
lateral carina; foretrochantin fused to propleuron. Metanotum:
single sclerite in anterior half. Abdomen: segment 1 lateral hump
with large spiny patch, without sclerites; gills absent.
Etymology. From the Latin lata meaning wide and rirna
meaning gap, and pertaining to the widely incised segment X
and is feminine in gender.
Material examined. Species included: Latarima explicatala sp nov. and
Latarima jurcilla (Neboiss, 1984a) comb. nov.
A new genus and species of Calocidae (Trichoptera: Insecta) from south eastern Australia
27
Figures 1-6. Latarima explicatala , Male: head, lateral (1); forewing (2); hind wing (3); genitalia (4-6), dorsal (4), ventral (5), lateral (6).
28
M.E. Shackleton, J.M. Webb, S.H. Lawler & P.J. Suter
Figures 7-12. Latarima explicatala. Pupa: head, dorsal (7), ventral (8); anterior hook plate (9); posterior hook plate (10); terminal segment, dorsal
(11), ventral (12).
A new genus and species of Calocidae (Trichoptera: Insecta) from south eastern Australia
29
Figures 13-16. Latarima explicatala. Larva: head, dorsal (13); pronotum, dorsal (14) mesonotum and metanotum, dorsal (15); larva and case,
lateral (16).
Comments. Adults of Latarima jurcilla have only been collected
from a single stream on the road to Mt Buller, Victoria.
Preliminary investigations suggest that a larva from the same
site is a likely candidate for being associated with the adults of
this species. However, this association has not yet been
confirmed. The range of L. explicatala is much wider than that
of L. jurcilla. Latarima explicatala has been collected from the
Yarra Ranges, Mount Baw Baw, Taggerty, Mount Buller, and at
the Victorian-New South Wales border near Mt. Kosciuszko.
These sites are all well forested and associated with mountains.
Interestingly, one site where this L. explicatala has been
collected from is less than 1km from the site at which L. jurcilla
is found, on Mt Buller.
Latarima explicatala sp nov.
Zoobank LSID. http://zoobank.Org/urn:lsid:zoobank.org:act:
2717E1DE-373A-45DD-8CCF-646CACB66499
Diagnosis. The adult males of L. explicatala sp nov. are
distinguished from L. jurcilla in that the hind wing does not
possess a fold, abdominal segment X has more than one pair of
spines apically, and the lateral projections on the phallus are
more rounded and with crenulated dorsal margins.
Description. Adult male. Head (fig. 1): dark brown; one pair setal
warts anterior to antennae, raised; antennae as long as body;
antennal scape anterior apex extended, with anterior projection
extending half way through pedicel, bulbous, densely setose on
30
M.E. Shackleton, J.M. Webb, S.H. Lawler & P.J. Suter
posterior half. Pronotum: Fore coxa with pale “Y” shape on
anterior margin, mid coxa with setal wart, “Y” shaped on ventral
surface; hind coxa with long setal wart dorso-ventrally on lateral
margin; hind femur with pale patch 1/3 length from apex. Wings:
Forewing (fig. 2): gold/brown, white areas on apical half; veins
M 3+4 and Cu la join at distal margin of thyridial cell. Hind wing
(fig. 3): A 3 and A 2 terminate before basal quarter of wing; Aj and
Cu 2 almost fused, almost forming a fold. Genitalia (figs 4—6):
Segment X divided into two elongate projections each with a
large spine sub-apically on dorsal surface, a slender spine apically,
and a slender spine sub-apically on ventral surface; preanal
appendages about as long as segment X, slender, expanded shortly
before rounded apex; inferior appendage in ventral view basally
expanded, apices curved inward, broad in lateral view; phallus
enlarged apically with a rounded flange on either side extending
dorsally to near dorsal margin of segment X, flange with dorsal
margin crenulated.
Pupa. Body: pale. Head: both mandibles similar in length,
smooth, 2 setae on basal lateral margin; a seta near lateral margin
anterior to each eye; two pairs of setae on anterior margin of
frons; a pair of setae between antennae. Labrum apex with 3 dark
setae either side on anterolateral margin; many setae on lateral
margin near base. Antennal scape with 2 setae dorsally. Abdomen:
lateral fringe present, thin; abdominal segments 3-6 each with 1
pair of anterior hookplates, hookplates bearing 2 hooks; 1 pair of
posterior hookplates on segment 5, left hookplate with 2 hooks,
right hookplate with 2-3 hooks. Terminal segment: with a row of
6 short setae transversely at around mid-length; ventrally with a
pair of large lobes, around 9 setae between lobes and base of
terminal process; terminal process fairly setose, distal overhang
projecting radially.
Larva (fig. 10). Head (fig. 7): frontoclypeus lateral margins
of anterior half curved outward, anterolateral margins with 7
erect setae; ridge along lateral margin of frontoclypeus extending
to dorsal edge of eye; eye circled by un-pigmented area; antennae
close to eyes. Pronotum (fig. 8): anterior margin with 2 distinct
rows of setae, anterior row thicker, projecting medio-ventrally,
short along medial margin but become longer towards lateral
comer, posterior row hair like projecting upwards. Mesonotum
(fig. 9): anterior margin with many hair like setae, with a band of
setae from anterolateral comers to median approximately 1/3
from posterior margin. Metanotum (fig. 9): sclerite triangular;
setae along anterior margin of sclerite. Abdomen: segment 1 with
a pair of setae ventrally; abdominal prolegs with one accessory
tooth, anal lateral sclerites densely setose. Case (fig. 10):
composed of sand grains arranged into a curved cylinder, narrow
membranous panels present laterally at posterior end.
Holotype. Male, Cement Ck nr Warburton, Victoria, 9 Jan
1657, A. Neboiss (TRI-22774).
Paratypes. 1 male collected with Holotype (TRI-25846).
Other Material Examined. Victoria: 1 male, Chalet Ck, east
branch, Mount Buller, 20 December 1972 (TRI 26647)
(illustrated). 1 male, Charlie Ck EPA site ABV, 20 Oct 2016,
MS704. 1 larva, Talbot Ck, Thompson Valley Rd, 17 April
1985, D. Cartwright. 2 males, Cement Ck nr Warburton, 9 Jan
1657, A. Neboiss (TRI-25850). 1 male pupa, Cameron Ck site 3
surber 3, 13 Dec 1995, J. Barton. 1 male pupa, Whitehouse Ck,
13 Dec 1995, site 6 surber 4.
Etymology. From the Latin explicatus meaning unfolded and
ala meaning wing, and pertaining to the hind wing which does
not possess a fold.
Acknowledgements
The Museum of Victoria provided access to specimens. This
study was conducted as part of the Taxonomic Research and
Information Network (TRIN) and was funded by the
Commonwealth Environment Research Facilities (CERF)
program.
References
Holzenthal, R.W., Blahnik, R.J., Prather, A.L., and Kjer, K.M. 2007.
Order Trichoptera Kirby, 1813 (Insecta), Caddisflies. Zootaxa
1668: 639-698.
Jackson, J. 1991. Systematics of Conoesucidae, Helicophidae,
Calocidae and Antipodoeciidae (Insecta: Trichoptera), with
emphasis on the immature stages. . Hobart, University of Tasmania.
Doctor of Philosophy.
Jackson, J. 1998. Preliminary guide to the identification of late instar
larvae of Australian Calocidae, Helicophidae and Conoesucidae
(Insecta: Trichoptera): Identification guide number 16. Cooperative
Research Center for Freshwater Ecology. Thrugoona, NSW
Johanson, K.A. and Malm, T. 2010. Testing the monophyly of
Calocidae (Insecta: Trichoptera) based on multiple molecular
data. Molecular Phylogenetics and Evolution 54(2): 535-541.
Milne, M.J. 1938. The “metamorphotype method” in Trichoptera.
Journal of the New York Entomological Society 46: 435-436.
Mosely, M.E. 1936. Tasmanian Trichoptera or Caddis-Flies.
Proceedings of the Zoological Society. 1936: 395-423.
Mosely, M.E., and Kimmins, D.E. 1953. The Trichoptera (Caddis-flies)
of Australia and New Zealand. British Museum of Natural History:
London.
Neboiss, A. 1977. A taxonomic and zoogeographic study of Tasmanian
caddis-flies (Insecta: Trichoptera). Memoirs of the National
Museum of Victoria 38: 1-208.
Neboiss, A. 1984a. Four new caddis-fly species from Victoria
(Trichoptera: Insecta). Victorian naturalist, 2: 86-91.
Neboiss, A. 1984b. Calocidae of Northern Queensland (Calocidae:
Trichoptera). Proceedings of the 4th International Symposium on
Trichoptera. J. C. Morse. The Hague, Dr W. Junk: 9.
Neboiss, A. 1991. Trichoptera (Caddis-flies, caddises). In: Naumann,
I.D., Came, P.B., Lawrence, J.F., Nielson, E.S., Spradbery, J.P,
Taylor, R. W. et al. (eds). The Insects of Australia, 2nd edn, vol. 2, pp.
787 - 816, Melbourne University Press, Carlton, Victoria, Australia.
Neboiss, A. 1992. Illustrated keys to the families and genera of
Australian Tichoptera 1. adults , The Australian Society for
Limnology.
Neboiss, A. 2002. A family problem with the placement of Heloccubus
buccinatus gen. & sp. n., an Australian caddisfly (Insecta:
Trichoptera). Proceedings of the 10th International Symposium on
Trichoptera - Nova Supplementa Entomologica. M. Wolfram.
Keltern, Geoke and Evers: 9.
Ross, H.H. 1967. The evolution and past dispersal of the Trichoptera.
Annual Review of Entomology 12: 169-206.
Shackleton, M.E., and Webb, J.M. (2014). Two new species of
Calocoides Neboiss 1984 (Trichoptera: Calocidae) from eastern
Australia, with descriptions of the immature stages. Austral
Entomology. DOI: 10.1111/aen.12091
Memoirs of Museum Victoria 72:31-61 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
Four new species and a new genus of Antarctic sea cucumbers with taxonomic
reviews of Cladodactyla , Pseudocnus , Paracucumidae and Parathyonidium
(Echinodermata: Holothuroidea: Dendrochirotida)
P. MARK O’LOUGHLIN 1 * (http://zoobank.org/urn:lsid:zoobank.org:author:97B95F20-36CE-4A76-9DlB-26A59FBCCE88),
MELANIE Mackenzie 2 (http://zoobank.org/urn:lsid:zoobank.org:author:5E3E21B9-E3DC-4836-8731-D5FD10D00CBF),
GUSTAV PAULAY 3 (http://zoobank.org/urn:lsid:zoobank.org:author:A2F155E4-7958-4E63-B36A-CAB23F190A07) AND
DlDIER VanDEnSpIEGEL 3 (http://zoobank.Org/urn:lsid:zoobank.org:author:CE8C3D01-28AD-43F7-9D4F-04802E68CBlA)
1 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmoloughlin@
edmundrice.org)
2 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (mmackenzie@museum.
vic.gov.au)
3 Florida Museum of Natural History, University of Florida, Gainesville, FL 32611-7800, USA (paulay@flmnh.ufl.edu)
4 Biological Collection and Data Management Unit, Royal museum for central Africa, B-3080, Tervuren, Belgium
(dvdspiegel@africamuseum.be)
To whom correspondence and reprint requests should be addressed. E-mail: pmoloughlin@edmundrice.org
http://zoobank.Org/urn:lsid:zoobank.org:pub:A7DD4099-9D59-44F5-81CB-4CD95CAlAFD5
Abstract O’Loughlin, P. M., Mackenzie M., Paulay, G. and VandenSpiegel, D. 2014. Four new species and a new genus of Antarctic
sea cucumbers withtaxonomic reviews of Cladodactyla, Pseudocnus, Paracucumidae and Parathyonidium (Echinodermata:
Holothuroidea: Dendrochirotida). Memoirs of Museum Victoria 72: 31-61.
Four new species of Antarctic sea cucumbers are described, three with author O’Loughlin: Crucella susannae,
Euthyonidiella huwi, Laevocnus katrinae ; and Laevocnus leachmani with authors Davey and O’Loughlin. Pseudocnus
Panning is reviewed, and Antarctic species separated into new genus Laevocnus O’Loughlin. We raise the three sub¬
species of Pseudocnus dubiosus, viz. dubiosus (Semper), koellikeri (Semper) and leoninus (Semper), to species status. We
refer Cucumaria croceoida Vaney to the synonymy of Cladodactyla crocea (Lesson). We synonymize Dendrelasia
O’Loughlin with Cladodactyla Brandt, and re-describe the reassigned Cladodactyla sicinski (O’Loughlin). This species
broods in a dorsal marsupium. The diagnoses of genus Parathyonidium Heding and species Parathyonidum incertum
Heding are reviewed. The type specimens for Parathyonidium incertum are listed. Parathyonidium incertum Heding is the
only known Antarctic holothuroid that is a coelomic brooder. The Paracucumidae Pawson and Fell is reviewed.
Phylogenetic trees are given for species in the genera Cladodactyla, Heterocucumis, Staurocucumis, Laevocnus, Crucella
and Paracucumis. Tables are provided for the species of Cladodactyla and Pseudocnus. Keys are included for the species
of genus Laevocnus and family Paracucumidae.
Keywords Bransfield Strait; South Shetland Islands; Shag Rock; South Georgia; Cladolabidae; Cucumariidae; Paracucumidae;
Cladodactyla-, Crucella-, Dendrelasia-, Euthyonidiella-, Laevocnus-, Paracucumis-, Pseudocnus-, coelomic brood protection;
new genus; new species; synonym.
Introduction
O’Loughlin et al. (2010) provided a comprehensive overview
of the especially diverse Antarctic sea cucumber species with
a list of 187 (including 51 until then not described). Three
subsequent papers by O’Loughlin and VandenSpiegel (2010)
on apodids, O’Loughlin and Whitfield (2010) on psolids, and
O’Loughlin et al. (2013) on new species from Admiralty Bay
in the South Shetland Islands have furthered our knowledge of
Antarctic sea cucumbers. This fauna is predominantly
endemic to south of the Antarctic Convergence. mtDNA
sequence data are providing insight into additional cryptic
species and synonymies, as evidenced in O’Loughlin et al.
(2010). Recent Antarctic expeditions have continued to collect
specimens of unknown species of sea cucumbers.
The BAS BIOPEARL I expedition in 2006, under the
leadership of Katrin Linse on the RRS James Clark Ross (JR
144) to the Scotia Sea, sampled the shelf (200 and 500 m) and
slope (1000 and 1500 m) of the Falkland Trough, Livingstone
Island, Deception Island, Elephant Island, the South Orkney
Islands, Southern Thule, South Georgia and Shag Rock. The
32
Linse et al. 2008 BIOPEARL II expedition (JR 179) sampled
from 500 to 2500 m in the southern Bellingshausen and
Amundsen Seas. The many sea cucumber specimens were sent
on loan to Museum Victoria and were identified by Mark
O’Loughlin, Melanie Mackenzie and Emily Whitfield. Two
new Antarctic holothuroid species from these collections are
described in this work.
An IPY-CAML expedition was conducted by NIWA from
29 January to 22 March 2008 on RV Tangaroa with
expeditioner Niki Davey able to focus on sea cucumbers as
part of her role. This voyage sampled in the Ross Sea and
associated seamounts and abyssal plains. One of the new
Pseudocnus Panning, 1949 species in this work (with authors
Davey and O’Loughlin) was collected during this voyage and
is included here because of our extensive review of genus
Pseudocnus. A paper on other new sea cucumber species from
this expedition and a comprehensive overview of Ross Sea
holothuroids is in preparation (Davey et al). A sea cucumber
specimen was passed on to us from CEAMARC RSV Aurora
Australis Voyage 3 off Adelie and George V Lands in 2007 /
2008. This single specimen is assigned to the same new
Pseudocnus species found in the Ross Sea.
In March and April 2012 Susanne Lockhart (NOAA’s US
AMLR Program) participated in Expedition ANT-XXVIII/4 on
RV Polarstern in the region of the Antarctic South Shetland
Islands at shelf depths of about 50-500 m in support of the
CCAMLR initiatives to detect Vulnerable Marine Ecosystems.
The quantitative demersal finfish stock assessment survey
provided Susanne with a rare opportunity for a quantitative
assessment of Antarctic invertebrate abundance, distribution and
biomass. Trawl net dimensions were measured in situ using a
ScanMar net monitoring sonar system. A comprehensive
invertebrate analysis from 64 successful trawls yielded 4,120
holothuroid specimens of which 217 lots with many hundreds of
holothuroids were preserved and donated to Museum Victoria
for determination. Up to 1425 sea cucumber specimens were
taken per station indicating a density of up to 87,119 holothuroid
specimens per square nautical mile. The subsequent identification
of all specimens in Museum Victoria by Mark O’Loughlin,
Melanie Mackenzie and Emily Whitfield revealed new species
of which one is described here. Further papers will describe
other new species and quantitative outcomes from this survey.
In O’Loughlin et al. (2013) new genus and species
Dendrelasia sicinski O’Loughlin were described for a single
specimen from Admiralty Bay in the South Shetland Islands.
Amongst the many sea cucumbers collected by Susanne
Lockhart around the South Shetland Islands (see above) there
are many larger specimens that are conspecific with the
smaller type specimen of Dendrelasia sicinski and that are
also morphologically referable to Cladodactyla Brandt, 1835.
We clarify these systematic issues.
O’Loughlin (1994) summarized knowledge on brood-
protecting and fissiparous cucumariids, and O’Loughlin et al.
(2009a) described additional examples. Reference was made
in the recent paper to a species of brood-protecting
Parathyonidium Heding, 1954 (in Heding and Panning, 1954)
that is determined and discussed here as Parathyonidium
incertum Heding, 1954 (in Heding and Panning, 1954).
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
We have reviewed the five relevant genera while describing
new species of Cladodactyla, Crucella Gutt, 1990,
Euthyonidiella Heding and Panning, 1954 and Pseudocnus,
and report brood-protecting by Parathyonidium incertum.
This systematic paper is based primarily on morphological
observations, and shows generally good congruence and
support from emerging genetic data. However, there are some
conflicts between morphological indicators for generic referral
and genetic data. We anticipate further genetic data and future
comprehensive reviews of the relevant generic assignments,
and await additional insight into morphology and genetic
congruence before further generic re-assignments.
Methods
Scanning electron microscope (SEM) images were taken by
Didier VandenSpiegel after clearing the ossicles of associated
soft tissue in commercial bleach, air-drying, mounting on
aluminium stubs, and coating with gold. Observations were
made using a JEOL JSM-6480LV SEM. Measurements were
made with Smile view software. Tissues were sent to Gustav
Paulay (UF) for sequencing and the specimen locations, tissue
codes, catalogue numbers and GenBank Accession numbers are
recorded in Appendix 1. A 655 bp portion of the mitochondrial
gene cytochrome oxidase subunit 1 (COI) was sequenced from
selected specimens using the echinoderm barcoding primers
COIceF (5’-ACTGCCCACGCCCTAGTAATGATATTTTT-
TATGGTNATGCC-3’) and COIceR (5’-TCGTGTGTC-
TACGTCCATTCCTACTGTRAACATRTG-3’) (Hoareau and
Boissin 2010), as described in Michonneau and Paulay 2014.
Note that these echinoderm specific primers amplify positions
242 to 898 in COI compared with positions 74 to 733 amplified
by Folmer primers. Sequences have been submitted to
GenBank (See appendix). COI sequences were aligned by eye
and analyzed using Maximum Likelihood with 100 bootstrap
replicates, implemented in MEGA (Tamura et al. 2013).
Photos of most specimens were taken in Museum Victoria
by Melanie Mackenzie, in collaboration with Mark
O’Loughlin, using a Nikon D300S digital camera with 60 mm
Nikkor macro lens for large specimens, and a Leica DC500
high resolution digital camera system with Auto Montage
software for small specimens. The photo of Laevocnus
leachmani Davey and O’Loughlin sp. nov. was taken by Peter
Marriot (NIWA) using a Nikon DX camera with a 60 mm
macro lens. The photo of a live in situ brood-protecting
specimen of Cladodactyla crocea (Lesson, 1830) in the
Falkland Islands was provided by Paul Brickie (SMSG).
Photos of live specimens of Cladodactyla sicinski (O’Loughlin,
2013) and Crucella susannae O’Loughlin sp. nov. were taken
on the RV Polarstern and provided by Susanne Lockhart
(NOAA’s US AMLR). The photo of a live in situ specimen of
Cladodactyla sicinski in Fildes Bay in the South Shetland
Islands was taken by Dirk Schories (UACh).
Abbreviations
AAD Australian Antarctic Division
AMLR Antarctic Marine Living Resources
Four new species and a new genus of Antarctic sea cucumbers
33
ANARE Australian Antarctic Research Expedition
BAS British Antarctic Survey
BENTART Integrated study of the benthonic biodiversity of
Bellingshausen Sea and Antarctic Peninsula
(Spain)
BIOPEARL Biodiversity dynamics: Phylogeography,
Evolution And Radiation of Life
CCAMLR Commission for the Conservation of Antarctic
Marine Living Resources
CEAMARC Collaborative East Antarctic Marine Census
ICZN The International Commission on Zoological
Nomenclature, or the International Code of
Zoological Nomenclature, as appropriate.
IPY-CAML International Polar Year-Census of Antarctic
Marine Life
MNCN Museo Nacional de Ciencias Naturales (Spain)
MNHN Museum national d’Histoire naturelle (Paris)
MOLAF Prefix code for tissues taken from specimens at
NMV
MOLG Prefix code for tissues taken from NIWA
specimens in the University of Genoa
MOLN Prefix code for tissues taken from NIWA
specimens
Order Dendrochirotida Grube, 1840
Remarks. Smirnov (2012) established suborder Cucumariina
for dendrochirotid families with the calcareous ring lacking
segmented posterior prolongations. These included
Cucumariidae Ludwig, 1894, Paracucumidae Pawson and Fell,
1965, and Thyonidiidae Heding and Panning, 1954 that was
raised to family status by Smirnov (2012). No suborder was
nominated for dendrochirotid families excluded from
Cucumariina. These include Cladolabinae Heding and
Panning, 1954 that was also raised to family status in Smirnov
(2012). We do not nominate suborders of Dendrochirotida in
this work.
Family Cladolabidae Heding and Panning, 1954 sensu
Smirnov 2012
Diagnosis (after Smirnov 2012). Tentacles 15-20 arranged in 2
or 3 circles (10+5, 10+10, 10+5+5); tube feet arranged along
radii or scattered over entire body; calcareous ring segments
usually entire, high, not subdivided into pieces; radial plates
with forked prolongations, medium length or short, usually
entire or sometimes subdivided into a few very short pieces;
sometimes short forked prolongations on inter-radial segments;
ossicles tables with 2 pillars, disc with few perforations and
sometimes reduced making tables rod-like, convex cross-like
spined plates, and rosettes.
Remarks. Smirnov (2012) raised the subfamily Cladolabinae
Heding and Panning, 1954 to family status, and offered his
opinion that “quite possibly the family is polyphyletic”.
MOLSI Prefix code for tissues taken from Smithsonian
Institution specimens
NDMQ Prefix code for tissues taken by Niki Davey from
Macquarie Island specimens
NHMUK British Museum of Natural History (registration
number prefix NHMUK)
NIWA New Zealand National Institute of Water and
Atmospheric Research Ltd. (est. 1992)
NMV Museum Victoria (registration number prefix F)
NOAA United States National Oceanic and Atmospheric
Administration
SMSG Shallow Marine Survey Group (Falkland Islands)
UACh Universidad Austral de Chile
UF Florida Museum of Natural History, University
of Florida
USNM United States National Museum of Natural
History, Smithsonian Institution
ZMUC Natural History Museum of Denmark (Zoology);
Zoological Museum, University of Copenhagen
Numbers in brackets after registrations refer to numbers of
specimens in lots.
Euthyonidiella Heding and Panning, 1954
Diagnosis (after Heding and Panning 1954). Tentacles 15-20;
tube feet in radial or scattered arrangement; calcareous ring
radial plates with paired long undivided posterior prolongations;
ossicles tables with 2 pillars.
Type species. Euthyonidiella kyushuensis Heding and Panning,
1954 (type locality southern Japan) (by original designation)
Assigned species and type localities. Euthyonidiella ambigua
(Heding, 1942) (Tanzania); E. dentata Cherbonnier, 1961
(Brazil); E. destichada (Deichmann, 1930) (Caribbean Sea); E.
dubia Cherbonnier, 1958 (Sierra Leone); E. huwi O’Loughlin
sp. nov. (below; Shag Rock); E. kyushuensis Heding and
Panning, 1954 (Kyushu); E. trita (Sluiter, 1910) (Caribbean
Sea); E. tungshanensis (Yang, 1937) (Fujian Sea); E. zacae
(Deichmann, 1938) (Galapagos).
Remarks. The species assigned to Euthyonidiella are quite
similar morphologically with the exception of Phyllophorus
tungshanensis Yang, 1937 (assigned to Euthyonidiella by Liao
and Clark 1995), and Euthyonidiella dubia Cherbonnier, 1958.
We question these two assignments. A specimen from NW
Australia collected at 184-187 m depth (NMV F149748; UF
tissue sequence code MOL AF 408) morphologically closely
resembles both Euthyonidiella kyushuensis from south Japan
and Euthyonidiella ambigua from east Africa. This specimen
is provisionally determined as Euthyonidiella kyushuensis.
34
Euthyonidiella huwi O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:8DD8AA4E-E46C-4FDE-
8A14-F796CA2B0427
Figure 1
Material examined. Holotype. Western Antarctica, Shag Rock,
53°38'S 40°54'W, 206 m, BAS BIOPEARL I stn SR-EBS-4, 11 Apr
2006, NMV F168650 (UF tissue sequence code MOL AF 816).
Paratypes. Type locality and date, NMV F189889 (3 small
juveniles); NHMUK 2010.137-138 (2).
Other material (not Euthyonidiella huwi). Euthyonidiella
kyushuensis Heding and Panning, 1954. NW Australia, 17°29'S
120°28'E, 184-187 m, RV Southern Surveyor , SS05/2007 stn 91, 20
Jun 2007, NMV F149748 (1) (UF tissue sequence code MOL AF 408).
Description. Body cylindrical, slightly pentagonal in transverse
section, rounded anterior and posterior, up to 7 mm long
(tentacles deeply withdrawn), up to 2 mm diameter; thin
calcareous body wall with surface bristle of table spires; 20
dendritic tentacles, 5 pairs large, 5 pairs very small, latter
probably in slightly inner ring; tube feet in irregular single to
double radial series, some spread inter-radially; calcareous ring
high, not segmented; anterior end of radial plates with deep
division at muscle attachment and with lateral notch, posterior
prolongations short, forked, not segmented (ring of 2 mm long
paratype specimen lacking posterior prolongations); inter-
radial plates with anterior taper, blunt posterior, lacking
posterior prolongations; short stone canal with bean-shaped
madreporite free in coelom; single tubular polian vesicle.
Body wall with abundant irregular tables: discs round to
slightly oval, margins lobed around perforations, 2 large central
perforations, frequently 6 (up to 14) additional perforations,
perforations most numerous in smallest specimens, discs
predominantly 70 pm long, up to 90 pm long; spires with 2
pillars up to 40 pm long, spinous distally, sometimes with
connecting bridges distally, distal bridges sometimes with
spines on mid-bridge. Tentacles with irregular thick elongate
perforated plates, up to 88 pm long. Peri-anal body wall with
abundant tables and internal thick knotted scale-like ossicles.
Colour (preserved). White.
COI DNA barcode of holotype: AATAAT-
GATCGGGGGGTTTGGGAACTGATTAATCCCAC-
TAATGATTGGAGCACCAGACATGGCTTTTCCC-
CGA AT GAA A A A AAT GAGATT CT GACTA AT CCCCCC-
CTCATTTATTTTACTCTTAGCTTCAGCAAGAGTA-
GAAAGAGGGGCAGGAACTGGTTGGACGGTATACC-
CCCCTCTTTCAAGAAAAATAGCTCACGCAGGAG-
GCTCAGTTGACTTAGCAATATTTTCCCTTCAC-
CTAGCGGGAGCCTCATCAATTCTAGCTTC-
TATAAAATTTATAACTACAATAATAAAAATGC-
GAACCCCAGGGGTAAGTTTTGACCGACTATCC-
CTATTTGT GTGGT CAGTATTTATTACAGC-
CTTTCTTCTACTTCTGAGACTCCCAGTATTAGC-
CGGGGCTATAACCATGTTACTAACTGATCGTAAT-
ATTAATACAACGTTTTTTGACCCTGCGG-
GAGGGGGT GATCCCATATTATTT CA ACAT CTATTCT-
GATTCTTTGGTCAT CCAGA AGT GTACATT CTA AT CT-
TACCAGGCTTCGGTATGATTTCCCATGTCATTGCT-
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
CATTATAGAGGAAAGCAAGAACCCTTCGGATATT-
TAGGTAT GGT CTATGCAAT GGTAGCCATAGGTATTT-
TAGGATTTTTAGTTTGAGCCCAC
Distribution. Western Antarctica, Shag Rock, 54°S 41°W, 206 m.
Etymology. Named for Huw Griffiths (British Antarctic
Survey), in appreciation of his role in the BAS BIOPEARL
expeditions, his contribution to collecting the specimens
studied here, and with gratitude for his gracious collaboration
in Antarctic holothuroid research.
Remarks. Euthyonidiella huwi O’Loughlin sp. nov. is
distinguished from the other species of Euthyonidiella by a
combination of: predominantly radial occurrence of tube feet;
table discs that sometimes have more than eight perforations;
relatively short posterior prolongations on the radial plates of
the calcareous ring. The provisionally determined specimen of
Euthyonidiella kyushuensis from NW Australia and
Euthyonidiella huwi from Antarctica are sister taxa among 19
sequenced sclerodactylids sensu lato based on COI sequences,
although they are quite divergent from each other (K2P
pairwise distance = 0.20). We observed that the calcareous ring
of a 2 mm long juvenile of Euthyonidiella huwi lacked posterior
prolongations. We recognize that the relatively short posterior
prolongations in the 7 mm long holotype may represent
ontogenetic change, as may the sometimes more numerous
perforations in the table discs and predominantly ambulacral
occurrence of the tube feet. We acknowledge the unsatisfactory
element in describing a new species from a few small specimens
that may represent developmental stages, but we judge that it is
important to establish the occurrence of genus Euthyonidiella
Heding and Panning in Antarctica.
Family Cucumariidae Ludwig, 1894
Subfamily Cucumariinae Ludwig, 1894 sensu Panning 1949
Diagnosis. Ten dendritic tentacles; calcareous ring lacking
segmented posterior prolongations; ossicles in the body wall
perforated plates, sometimes rods, never cups or tables.
Cladodactyla Brandt, 1835
= Dendrelasia O’Loughlin (in O’Loughlin et al., 2013): 69-70
(new synonymy)
Table 1; figure 2
Diagnosis (sensu stricto - see Remarks). Ten equal tentacles;
calcareous ring calcified and evident in small specimens but
de-calcified and no longer evident in larger specimens; tube
feet restricted to radii; dorso-lateral radial body wall thick,
soft, “spongy”; external dorsal marsupium created by elongate
indentation / invagination between dorso-lateral radii, radial
edges may close over a protective chamber, anterior mid-dorsal
gonoduct opening in marsupium; hermaphroditic; tube feet on
bivium smaller and more numerous than on trivium; respiratory
trees arise from 3-4 basal sources, each with dendritic
branches; mid-body wall ossicles absent in larger specimens;
peri-anal ossicles include prominently spinous, single-layered,
perforated plates.
Four new species and a new genus of Antarctic sea cucumbers
35
Table 1. Species currently assigned to Cladodactyla, occurrence, and contrasting morphological characters.
Species
Occurrence
Dorsal
marsupium
Tentacles
Calcareous ring
Body wall ossicles
C. brunspicula Thandar, 2008
South Africa
Lacking
10 equal;
with rosettes
calcified
plates with small to
filled perforations
C. crocea (Lesson, 1830)
Falkland Islands
Present
10 equal, lacking
rosettes
not calcified in
larger specimens
lacking in larger
specimens
C. monodi Cherbonnier, 1950
Cameroon
Lacking
2 small ventral,
lacking rosettes
calcified
perforated plates
C. senegalensis Panning, 1940
Senegal
Lacking
2 small ventral;
lacking rosettes
calcified
perforated plates
C. sicinski (O’Loughlin, 2013)
South Shetland
Islands
Present
10 equal, lacking
rosettes
not calcified in
larger specimens
lacking in larger
specimens
Figure 1. Holotype of Euthyonidiella huwi O’Loughlin sp. nov. (NMV F168650). a, preserved holotype; b, photo of calcareous ring, single polian
vesicle (lower right), madreporite and stone canal (upper right) (insert: drawing of radial (bottom) and inter-radial (top) plates of the calcareous
ring); c, SEM images of ossicles from the tentacles; d, SEM images of table ossicles from mid-body wall (insert: drawing of one common form of
variable table discs).
36
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
r- SOl rocuoji m i _Pfyd2_Bay_f l A0(_AF_ 12 4B
Sta uroajcijim is_btnu^llft_Bou^et_l I_MQLAF_C S3 9
S1aurDajajrK._fexjviltei_Rass_Sea_MOLN_ir4
S(aurDajcumis_kxjvtlla_Amundsen_Sea_MOLAF_07S7
■ StauroouajfTiia_lioiwllei_Miund3efi_S®a_MOLAF_0783
- S*au rooucuffi isJ icwi I te LAjthj ndsen_Sea3 4 CHLAF_C'7 65
StenrocucumisJ iww#ei_A™ rKlsen_Sea_MOLAF_07f! 1
S(aorocuapniS_SwMteLPrydz_Bay_MOU\F_1249'
- Staurocuaimis_i«wiiis_BowetJ_MOLAF_0537
■ $ 1 aBjr 0 CuaJiTI]£_lKH:J!j'i 8 ei_Piydz_aSy_>frX J 5 '.F _1247
- SteLMoeucufflisjH 5 uu*ei_ficfis_Sea_MOLN_l 72
Stau«)ajoumis_l»Quw»ai_arar*sfiekl_S 1 ra^it_MCILSL[J 35
- S[aufOfljeuiTK_liQijnrtllei_Heafdl_l_M 0 LAF_ 07 CX)
- S»aunxijamts_lkxJviW_Ross_Sea_MC | LH_i73
— SlaurccuainriisJiouvillei_S_Gecfgia_MCiLAF_0541
1 Cladodactyte_cnxea_Falklafds_MOLAF _&504
aa 6 cdactyfe_crccea_Falklsnds_MOUy r _ft 501
Claclo^ctya_crK^_Falklar^53 , 0<^J>S03
Cl 3 dodaclyla_i 3 W^_F 3 lktericte_MOLAF_OS (12
-SteunxkJQ^is_5pedffi_S_Orkrie/g_kKK_AF_0&72
0|- Cte<totted^ai_sk^ki_S_£iiefl3^s_M0lJ 1 iF_i 300
L ci*i«i«^_sjartski_S_Shet^
Sfcau rccuaj rrnsiJpQLwi I iei_ Ross_Sea_MOLN_ 175
S 4 auroojcymisJtotivillei_Falklands_MOLAFjK 4 a
S ta uroaxu n«Jizysztofi_S_Shetia nds_MO LS IJHfl
Sla ufoctoj m is_k rzysztofi_Bra nsfiel^Sfraig h 1 _M OLS l _064
Stau rocxj cun i i 3 _krzyszto S_BranslSeld_Slraight_MOLSI_OS 7
Slaw rocu cum i s_krzys 7 tofi_B ransfel d_Stra igrrt_M OL S l _0 55
r HeteflKuapnisjdefTlk^la_Ro 33 _Sea_MOiG _101
< Heterocuoi me_dentaj |gte_Ross_Se 3 _M 0 L G_ 104
i Heiei7raJCwrTie_ibefiticsjl^a_R()ss_Se3_MOLG_l05
h ei eiocucuiinfejcfentf aii3ia_ R oss_Sea_MOU3_ i03
- Me^ocuajmis_iteiTtiajlala_Ross_Saa_MOLN_l63
den liajlala_Ross_S&a_MOLG_ 102
AfiyBsoajcume_abyssQftjrn_Ross_Sea_MOLN_l43
— AbVss3a7Cums_ail^ssorijm_Rc®_Sea_MOlJ4_l4lt3
^JtifyssoojojnTB_atiysaonni_Ros3_Sea_ , MOLN_1-42
• Abyssoajajrrie_Bbyssofti(Ti_Ross_Sea_MCLN_141a
S la u roou cum i s_ noctu ma _ NW_A uslra I i 3 _MOLA, F_0l 00
-Staiwocwcumis nodtuna MW Agrafe MOLAF
£ r — StauTOJCumis_tu(V^_RoK_Sea_MOLG_Ot55
[■ St5imox^rr«5_1iLBqueti_Rc)S_Se3_MCILN_199
I SiawwixwrTiis_ixirtiueti_Rciss_Sea_f , <kCLN_ 150
— Hel srecutu m*s_5teirierii_Sfaiisfiek!_&lr3ifiit_MCH-Si_0Ki
H etaecucu m &_ste#wi i _£_Oiiifi&ys_ M 0 LAF_0S74
H eterccucu m is_sta nera_B ran slfel d_Stra kjh [_MOl SI _pSfl
Hs(8racucijms_steinen«_Bransfi€id_SlratQrit_MOt-SI_037
HatefDCtioun«_slEiT@^_AmijflflS€ri_Sea_MOLW'_i!7a4
Heterixiiajfriis_steineni_BASEC079-09
- Hete nxirajrnts_starter»_Ross_Se3_M OLG_ 106
H eterccucu rrus_ 5 tetr>erri_BnsnsFtelLj_Straiglrit_MOlSI _026
HelEiwwainii 5 _steirieni_Afiiur*teen_Sea_M(DtAF_ 07 e 5
Hetawixsxrft_steiieni_Ros_Sea_MOLN i _i as
He te focucum i s_st&nefi i_p ry efe_ Bay_ktdAF _ 124 a
i^etefOOXJ^ts^iarier^Ros’i.Sea.MOLr^ 197
HeteftDa»i*riis_sierierti_Ross_Sea_MOLfj_t90
He teraci>ajTi e_slwwvi_Rofis_Ssa_M OLN_t 94
He twocucurri s_sl e*.ne n>_ Ross_&ea_M 0 i_ G_ 1 0 7
Belerocuaj mis_steineni_EifaRE. 1 ie 4 d_Stra»ght_WOLSI _065
Ftetefocuajrnis_slBineni_Bransfiefcl_Slraighit_MOLSI _043
He te nxucu mis_sl erieni_Am uod sen_Sea_MC 4 j a i, F_ 07-$6
-Laevccn usja ewga ti_ra._Hearrl_l_MO LAF _0670
Figure 2. Maximum likelihood tree for Cladodactyla-Heterocucumis-Staurocucumis clade, based on COI sequences, T92+G+I model, 100
bootstrap replicates, Laevocnus laevigatus as outgroup. Filled circles >0.95 bootstrap support; hollow circles >0.70 bootstrap support.
Four new species and a new genus of Antarctic sea cucumbers
Type species. Holothuria crocea Lesson, 1830 (type locality
Falkland Islands (Malvinas)) (by subsequent designation
(Panning 1940: 170))
Remarks. The availability of numerous larger specimens of
“Dendrelasia” sicinski from the South Shetland Islands has
enabled us to judge that Dendrelasia is a junior synonym of
Cladodactyla (see below). We formalize the synonymy here.
We base our sensu stricto diagnosis of Cladodactyla on the
two species that we consider to be Cladodactyla in confidence:
C. crocea and C. sicinski. The differences (Table 1) in the
presence or absence of a dorsal external marsupium, tentacle
arrangement, calcification in the calcareous ring, and ossicle
forms, and the broad geographic distribution of the other
included species, lead us to suspect that Cladodactyla as
currently circumscribed may not be monophyletic.
COI sequence data from several hundred dendrochirotids
(Michonneau et al. in prep.) recovers these two species of
Cladodactyla in a clade with Staurocucumis (including
Abyssocucumis , considered generically distinct by some
(Hansen 1988, O’Loughlin 2002) but not others (Massin &
Hendrickx 2011)) and Heterocucumis, with modest support.
An analysis of this clade (Fig. 2), including samples of the type
species of all four genera: Cladodactyla crocea, Staurocucumis
liouvillei, Abyssocucumis abyssorum, Heterocucumis
steineni, fails to recover these genera as monophyletic, and
includes a subclade with 96% bootstrap support that has
species of Staurocucumis, Heterocucumis, and Cladodactyla
intermixed. Revising the generic limits of this lineage is
beyond the scope of this paper. We note however that
Cladodactyla , as the senior generic name in this assemblage,
is clearly appropriate for C. crocea and C. sicinski.
Cladodactyla crocea (Lesson, 1830)
Figures 2, 3, 4; table 1
Holothuria (Cucumaria) crocea Lesson, 1830: 153-154, pi. fig.
1.
Cladodactyla crocea.— Brandt, 1835: 43.—Wyville Thomson,
1878: 57-61, fig. l.-Panning, 1957: 27-29, figs 10-13.
Cucumaria crocea.— Theel, 1886: 58-61, pi. 3 fig. 5, pi. 12 figs 1,
2 (see Remarks).—Ludwig, 1898: 15-24, pi. 1 figs 6-13.—Vaney,
1908a: 296.-1908b: 23-24.-Ekman, 1925: 75-81, figs 15, 16.
Cucumaria croceoida Vaney, 1908a: 299.—1908b: 31, pi. 5 figs
64-66.
Cucumaria crocea var. croceoides.— Ekman, 1925: 81-85, fig.
17.
Material examined. South-west Atlantic Ocean, Falkland Islands,
Discovery Expedition , RRS William Scoresby, WS stn 231, 50°10'S
58°42'W, 159-167 m, 4 Jul 1928, NHMUK 2013.1 (1); W of Falkland
Is, WS stn 867, 51°10'S 64°16'W, 148-150 m, 30 Mar 1932, NHMUK
2013.2 (1); WS stn 869, 52°16'S 64°14’W, 187 m, 31 Mar 1932,
NHMUK 2013.3 (1); Falkland Is, US AMLR 2004 Icefish stn 17-
OT20, 52°22'S 58°52’W, 78 m, S. Lockhart, 31 May 2004, NMV
F105017 (4) (UF tissue sequence codes MOL AF 501,502); Icefish stn
18-OT14, 52°08’S 58°05'W, 93 m, S. Lockhart, 28 May 2004, NMV
F106967 (3) (UF tissue sequence code MOL AF 504); Icefish stn 21-
OT16, 52°43'S 59°97'W, 120 m, S. Lockhart, 30 May 2004, NMV
F105002 (3) (UF tissue sequence code MOL AF 503); Burdwood
Bank, Icefish stn 5-BT4, 54°47'S 59°18'W, 303 m, S. Lockhart, 21
37
May 2004, NMV F160031 (1) (UF tissue code MOL AF542);
Falkland Is, Challenger stn 315,51°40'S 57°50’W, 9-22 m, 26-28 Jan
1876, USNM E10614 (2); Tierra del Fuego, Cape Penas, Eltanin stn
966, 53°40'S 66°20'W, 81 m, 10 Feb 1964, USNM E33519 (46).
Description. Body cylindrical, rounded orally and anally, up
to 100 mm long 30 mm diameter (live, in Wyville Thompson
1878; 47 mm long preserved, in Ekman 1925); body wall soft,
leathery, dorso-lateral radial body wall thick, soft, “puffy”;
dorsal marsupium created by elongate indentation /
invagination between dorsal radii; 10 equal tentacles; ring not
calcified in larger specimens; tube feet restricted to radii in
paired zig-zag rows, smaller and more numerous in dorso¬
lateral than in ventral radii, outer ventro-lateral rows of tube
feet fewer and more spaced, dorsal tube feet absent in small
specimens, often withdrawn into pits in preserved specimens;
dorso-lateral radial tube feet do not cross inter-radius at
anterior and posterior ends of marsupium; single polian
vesicle; paired, unbranched tufts of hermaphroditic gonad
tubules, genital papilla anterior mid-dorsal in marsupium; 2
respiratory trees, each divided basally into 2 sub-equal or
unequal dendritic branches creating 4 trees, extending about
two-thirds length of coelom.
Mid-body wall ossicles absent from largest specimens; in
smaller specimens ossicles absent from marsupium wall but
mid-lateral body wall with thick rods and spinous plates, rods
frequently with single to numerous distal perforations,
frequently with distal and lateral spines and branches, plates
irregularly oval to round, with two larger central perforations,
surface and margin with sharp spines, rods and plates
intergrade, up to 296 pm long. Dorsal tube foot endplates up to
280 pm diameter, endplate support ossicles curved, distally
perforate, spinous rods up to 136 pm long. Ventral tube feet
endplates with irregular perforations, diameter about 360 pm,
endplate support rods as in body wall but curved, about 168
pm long. Tentacle ossicles irregular thick rods with distal and
sometimes lateral perforated extensions, with marginal
denticulations around perforated parts, up to 272 pm long.
Introvert lacking ossicles. Peri-anal body wall ossicles spinous
rods and plates as in body wall, up to 176 pm long, and some
larger oval plates with spinous margin, plates up to 240 pm
long, no spinous crosses detected.
Colour. Live: body orange yellow, tentacles white. Preserved:
body pale brown to grey to cream to pink with brown spots
variably evident.
Distribution. South-west Atlantic Ocean, Falkland Islands
(Malvinas), Burdwood Bank, Tierra del Fuego, 0-303 m.
Remarks. The synonymy above is selective and does not
include the comprehensive list of early references provided by
Ludwig 1898. Theel (1886) provided good illustrations (pi. 3
fig. 5) of the ossicles of Cladodactyla crocea but reported
them as Cucumaria laevigata, and wrongly reported two
small ventral tentacles for Cladodactyla crocea. Lampert
(1886) was confused in his discussion of Cucumaria crocea
and illustrated ossicles of Pentactella laevigata Verrill, 1876.
Cladodactyla crocea is distinguished from the other
Cladodactyla species by the combination of: presence of a
38
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Figure 3. Cladodactyla crocea (Lesson, 1830). a, in situ photo of lateral view of live specimen with juveniles on the dorsal marsupium (Falkland
Islands; photo by SMSG); b, dorsal view of 35 mm long preserved specimen showing thickened marsupial dorsal radial rims with numerous very small
tube feet (NMV F105017); c, dorsal view of 8 mm long preserved specimen showing invaginated marsupium with enclosed embryos (NMV F160031).
Four new species and a new genus of Antarctic sea cucumbers
39
Figure 4. SEM images of ossicles from specimens of Cladodactyla crocea (Lesson, 1830). Main figure with spinous rods and plates from the
dorso-lateral body wall of a 15 mm long specimen (NMV F105002); top left box with spinous rods from the lateral body wall of a 28 mm long
specimen (NMV F106967).
40
dorsal external marsupium; dorso-lateral radial tube feet
series not continuous anteriorly and posteriorly across the
dorsal inter-radius to create a complete border to the
marsupium; 10 equal tentacles; tentacle ossicles rods not
plates; absence of introvert ossicles; presence of tube feet
support rod ossicles; lack of spinous crosses in the peri-anal
body wall.
Ekman (1925) found variations in body wall ossicle form,
and in the presence or absence of ossicles, in specimens that he
judged to be Cucumaria crocea and Cucumaria croceoida
Vaney, 1908. Ekman could distinguish two groups, but
acknowledged that there was an overlap, and thus relegated
Vaney’s species to a variety of Lesson’s. We observed similar
variations among specimens of Cladodactyla crocea , and thus
judge that the variety croceoides should not have formal status
and refer it to the synonymy of Cladodactyla crocea.
Cladodactyla sicinski (O’Loughlin, in O’Loughlin et al., 2013)
Dendrelasia sicinski O’Loughlin (in O’Loughlin et al), 2013:
70-73, figs 1-3.
Figures 2, 5, 6, 7, 8; table 1
Material examined. Holotype of Dendrelasia sicinski. Western
Antarctica, South Shetland Islands, King George Is, Admiralty Bay,
200-250 m, P. Presler and J. Sicinski, 1 Mar 1980, NMV F189855.
Other material. Western Antarctica, Elephant I., 61.26°S 54.90°W,
158 m, RV Polarstern ANT-XXVIII/4 stn 191, 18 Mar 2012, NMV
F193767 (1); 61.20°S 54.90°W, 63 m, Polarstern ANT-XXVIII/4 stn
190, 18 Mar 2012, NMV F193770 (1); 61.34°S 55.49°W, 155 m, stn
195, 19 Mar 2012, NMV F193768 (1); 60.88°S 55.45°W, 243 m, stn
208,21 Mar 2012, NMV F193769 (1); 60.98°S 55.69°W, 92 m, stn 229,
24 Mar 2012, NMV F193771 (5); 61.14°S 55.69°W, 78 m, stn 230, 24
Mar 2012, NMV F193766 (1) (UF tissue sequence code MOL AF
1298); South Shetland Is, 62.33°S 60.49°W, 119 m, stn 253, 29 Mar
2012, NMV F193772 (3) (UF tissue sequence code MOL AF 1300).
Description (emended). Body fusiform, cylindrical in mid¬
body, tapers roundly at both ends; preserved body up to 70 mm
long, 28 mm diameter; body wall thin to thick, soft, leathery;
10 equal dendritic tentacles; calcareous ring evident and
calcified in small specimens, but becoming decalcified in 15
mm long specimen, and thus no longer evident in larger
specimens; dorso-lateral radial body wall thick, soft; tube feet
on dorso-lateral radii in paired close zig-zag rows on each
radius, series extended across dorsal inter-radius anteriorly and
posteriorly to border an external brood-protecting marsupium,
dorso-lateral radial tube feet smaller and more numerous than
ventral tube feet, tube feet on dorso-lateral radii may be
withdrawn into pits; tube feet on trivium larger and fewer than
on bivium, ventral radial series in paired zig-zag rows, fewer in
outer rows of ventro-lateral series; shallow median groove in
flat longitudinal muscles; single polian vesicle; paired, un¬
branched tufts of hermaphroditic gonad tubules, gonoduct
opens at pore in mid-anterior marsupium; lacking male genital
papilla; respiratory trees arise from 3-4 basal sources, each
with dendritic branches, extending about half length of coelom.
Larger specimens lack mid-dorsal and mid-ventral body
wall ossicles; 15 mm long specimen with prominently spinous
rod, X-shape, Y-shape and branched forms up to 136 pm long.
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Tentacle ossicles predominantly perforated plates, some rods;
plates thin, irregular, with denticulate margins, sometimes
with fine surface spines, and larger central perforations; rods
frequently with distal and lateral perforate developments and
denticulate margin; plates and rods both up to 200 pm long.
Introvert lacking ossicles. Dorsal tube feet endplates up to 480
pm diameter; tube foot support plates oval to sub-rectangular
to pear-shaped to half-moon shaped, 2 large perforations
centrally, margin denticulate to spinous to smooth, some with
fine surface spines, up to 160 pm long. Ventral tube foot
endplates up to 960 pm diameter, outer rim of endplate
comprises fused irregular branched rods, not perforations,
central perforations slightly larger than outer ones, tube foot
support plates oval with surface and marginal spinelets,
surface sometimes smooth, 4 large central perforations, 2
largest perforations adjacent, 2 smaller distal perforations, up
to 208 pm long. Peri-anal body wall with plates, crosses, rods;
single-layered perforated anal plates up to 320 pm wide, plates
irregularly oval with marginal spines or denticulations, with or
lacking surface spines, frequently 4 large central perforations
in cross formation as described above; amongst the body wall
ossicles small clusters of irregular distally spinous crosses of
variable rod thickness, arms frequently bifid, sometimes with
branches joined to create 8 perforations and slightly concave
sub-rectangular plates, crosses up to 112 pm long; rare spinous
or denticulate rods, with or without distal perforations, up to
96 pm long; all three peri-anal ossicle forms inter-grade.
Colour. Live: body and tentacles pale yellow, oral disc red.
Preserved: body variably off-white to pale grey-brown; tentacle
discs with paired brown markings anterior to each tentacle,
sometimes fine brown spotting on the oral disc.
Distribution. Western Antarctica, South Shetland Is, Elephant
I., 63-250 m.
Remarks. The SEM images of peri-anal ossicles in the recent
Susanne Lockhart collection of larger specimens of a species
of Cladodactyla from the South Shetland Islands are distinctive.
They are identical in general shape and form with the peri-anal
ossicles from a smaller specimen from Admiralty Bay in the
South Shetland Islands illustrated in O’Loughlin et al. 2013 for
the new genus and species Dendrelasia sicinski O’Loughlin,
2013. The small specimen from Admiralty Bay is
morphologically conspecific with the larger specimens of the
recent Lockhart collection. Dendrelasia is a junior synonym of
Cladodactyla.
In specimens of Cladodactyla sicinski there is a distinct
dorsal external marsupium. Indentations present in the soft
inter-radial dorsal body wall within the marsupium suggest a
prior presence of embryos or juveniles. Cladodactyla sicinski
is distinguished from the other Cladodactyla species by the
combination of: presence of a dorsal external marsupium;
dorso-lateral radial tube feet series continuous anteriorly and
posteriorly across the dorsal inter-radius to create a complete
border to the marsupium; 10 equal tentacles; tentacle ossicles
predominantly plates; absence of ossicles in the introvert;
presence of tube feet support plate ossicles; presence of
spinous crosses in the peri-anal body wall.
Four new species and a new genus of Antarctic sea cucumbers
41
Figure 5. Cladodactyla sicinski (O’Loughlin, 2013) (preserved specimen, NMV F193767). a, right lateral view; b, tentacles; c, dorsal view
(marsupium surface); d, ventral view; e, photos of two live specimens (South Shetland Islands; NMV F193772; photos by Susanne Lockhart).
42
Pseudocnus Panning, 1949
Figure 9; table 2
Pseudocnus Panning, 1949: 422-425.—Panning, 1951: 73-
80.—Panning, 1962: 57-80.-Thandar, 1987: 288-289.-
Lambert, 1998: 474-476.—O’Loughlin and Alcock, 2000: 4.
Diagnosis (sensu stricto - see Remarks). Ten equal dendritic
tentacles; tube feet in radial series, additional smaller tube feet
scattered in inter-radii; ossicles in body wall of two forms,
knobbed buttons typically regular in form with four perforations
and lacking marginal spines at one end, and single-layered
knobbed plates with spines at one tapered end; tentacles with
perforated plates, rod-like plates and rosettes.
Type species. Cucumaria koellikeri Semper, 1868 (type locality
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Mediterranean Sea) (original designation by Panning 1949).
Panning (1962) proposed an invalid re-designation of
Cucumaria dubiosa Semper, 1868 as type.
Remarks. Panning (1949) designated Cucumaria koellikeri
Semper, 1868 (type locality Mediterranean Sea) as type species
of his new genus Pseudocnus. Subsequently Panning (1962)
came to believe that his re-description (Panning 1949) of
Cucumaria dubiosa Semper, 1868, as another species of
Pseudocnus, was based on a specimen also belonging to C.
koellikeri. This was rectified in Panning (1962) when
synonymies and full descriptions of both P. dubiosus and P.
koellikeri were given and Panning proposed, invalidly, to
change the type of Pseudocnus to Cucumaria dubiosa (type
locality Peru). The diagnostic description in Panning (1949) of
Figure 6. Photo of a live specimen of Cladodactyla sicinski (O’Loughlin, 2013) in situ in Fildes Bay on King George Island in the South Shetland
Islands (photo taken by Dirk Schories (UACh) and used with permission).
Four new species and a new genus of Antarctic sea cucumbers
43
Pseudocnus koellikeri (Semper, 1868) was accurate. A
significant diagnostic difference between these two species is
that Pseudocnus dubiosus has eight large and two small
tentacles, while Pseudocnus koellikeri has 10 equal tentacles.
Our sensu stricto diagnosis of Pseudocnus is based on the
descriptions of the type species Cucumaria koellikeri by
Koehler (1921, 1927) and Panning (1949, 1962).
Panning (1949) described, then revised (1962), Pseudocnus.
In his revision he considered five taxa to be sub-species, all
within his “ dubiosus group”: Pseudocnus dubiosus africanus
(Britten, 1910) (junior synonym of Pseudocnella insolens
(Theel, 1886) by Thandar 1987); Pseudocnus dubiosus
dubiosus (Semper, 1868); Pseudocnus dubiosus jaegeri
(Lampert, 1885) (junior synonym of Pseudocnella sykion
(Lampert, 1885) by Thandar 1987); Pseudocnus dubiosus
koellikeri (Semper, 1868); Pseudocnus dubiosus leoninus
(Semper, 1867). On the basis of significant morphological
differences (see Table 2 and new genus below) we raise three
of these sub-species to species status: P. koellikeri, P. dubiosus
(s.s.), and P. leoninus. As noted above Thandar (1987)
transferred the remaining two to Pseudocnella Thandar, 1987.
Deichmann 1941 stated that Cucumaria salmini Ludwig,
1875 (type locality: Sulawesi, Indonesia) was probably a junior
synonym of Cucumaria leonina Semper, 1867 (assumed type
locality: “Singapore”), because of their similarity and
presumed proximity of occurrence, rejecting Ekman’s 1925
conclusion that the type locality for Cucumaria leonina was in
error. Panning 1962 however, reaffirmed Ekman’s 1925
conclusion, noting that the type was preserved in “rum from
Singapore”, and considered the type locality for C. leonina to
be around the Falkland Islands (Malvinas). Ludwig (1875)
likened the ossicles of his C. salmini to Semper’s 1868 C.
dubiosa, and referred to the illustration of a distally spinous
plate and knobbed button in Semper’s figures. C. leonina also
has this ossicle combination. While we have not restudied the
type of C. salmini we consider it unlikely that this tropical
Pacific species would be conspecific with a sub-antarctic
South American species. We thus raise Pseudocnus salmini
Figure 7. SEM images of ossicles from specimen of Cladodactyla sicinski (O’Loughlin, 2013) (NMV F193767). a, tentacle ossicles; b, ventral
tube foot ossicles with presumed to be residual body wall plate (top) and tube foot support plate (bottom); c, ventral tube foot endplate fragments
with rim of fused outer marginal support rods.
44
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
out of synonymy (by Deichmann 1941) with Pseudocnus
leoninus. We provisionally refer P. leoninus to the new genus
(below) on the bases of supportive genetic data and sub-
Antarctic occurrence. We do not refer P. salmini to the new
genus for three reasons: Ludwig (1875) likened the ossicles to
those of C. dubiosa\ tropical occurrence; absence of any
indicative genetic data.
Panning (1962) created two groups of species assigned to
Pseudocnus Panning, 1949: those with both distally spinous
pine-cone-shaped knobbed plates and knobbed buttons in the
Figure 8. SEM images of peri-anal spinous cross and spinous plate ossicles from specimen of Cladodactyla sicinski (O’Loughlin, 2013)
(NMV F193771).
Four new species and a new genus of Antarctic sea cucumbers
body wall were assigned to the “dubiosus group”; those that
lacked knobbed buttons were assigned to the “ laevigatus
group”. We agree with this distinction between two
morphologically distinct groups. Our limited genetic data
support a “ laevigatus group” clade (Fig. 9), and this clade
shows geographic cohesion; all species live in the sub-antarctic
- Antarctic region. Pseudocnus leoninus, the only sub-
antarctic member of Panning’s “ dubiosus group” (with a
complete cover of tube feet and numerous knobbed buttons in
the body wall), genetically groups with Panning’s “ laevigatus
group” (Fig. 9). We describe a new genus below, Laevocnus
O’Loughlin gen. nov., that includes most species of Panning’s
“laevigatus group”, and provisionally includes P. leoninus.
In contrast, North Pacific species assigned to Pseudocnus
(including P. curatus, P. lubricus, P. californicus ) are closely
related to North Pacific species of Cucumaria (Arndt et al.
1996, Michonneau et al. in prep.), and do not cluster near the
Laevocnus clade. Lambert (1998) judged that sub-species
45
Cucumaria fisheri astigmata Wells, 1924 is conspecific with
Pseudocnus lubricus (H. L. Clark, 1901). Lambert (1998)
further judged that Cucumaria curata Cowles, 1907 should be
retained in Pseudocnus and proposed a third “ curatus group”
for Pseudocnus species. Pseudocnus curatus (Cowles) has
smooth buttons, with a few perforations only, in the body wall.
Thandar (1987) transferred four species from Pseudocnus
to his new genus Pseudocnella Thandar, 1987: Cucumaria
sinorbis Cherbonnier, 1952 (type species), Cucumaria insolens
Theel, 1886 (junior synonym Cucumaria leonina var. ajricana
Britten, 1910), Semperia sykion Lampert, 1885 (junior
synonym Cucumaria jaegeri Lampert, 1885), and Cucumaria
syracusana Grube, 1840.
P. cornutus (Cherbonnier, 1941) (Patagonia) was included
in the “ laevigatus group” by Panning and fits geographically
there also. It differs from Pseudocnus species sensu stricto by
having two smaller ventral tentacles, having tube feet radial
only, and lacking buttons. It groups with species of the new
i— Laevocnus_leortnus_FalklandsJVlOLAF_0510
LaevocnusJeoninus_Falklands_MGLAF_0508
La evocn u sjeon in us_Fa I klands_M 0 LAF_05Q7
LaevQcnusJeoninus_FalklandsJVtOLAF_05O9
Laevocn u s_peiri eri_Falkl and s_MO LAF_0511
Laevocn u s_penie ri_Fal kla n d s_M 0 LAF_0514
Laevocn us_p eme ri_Fa Ikla nd s_MO LAF_0512
-Laevocnus katrinae Falklands MOLAF 0815
Laevocnus leachmani Ross Sea MGLN 182
Laevocnus_serratus_Heard_l_IVlOl-AF_0683
— La evocn us Jaeviga tus_H eard_l_MOLAF_0670
r LaevocnusJaevigatus_Macquarie_NDMG_12
Lae vocnusJa evig atusJVIa cq ua ri e_N DM Q_ 11
Cladodactyla_sidnski_S_Shetlands_MOLAF_1300
Figure 9. Maximum likelihood tree for Laevocnus clade, based on COI sequences, GTR+I model, 100 bootstrap replicates, Cladodactyla sicinski
as outgroup. Filled circles >0.95 bootstrap support.
46
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Table 2. Species remaining assigned to Pseudocnus in this work, most atypical for the genus sensu stricto, with the appropriate exception of P.
koellikeri and the possible exception of P. salmini (see Remarks).
Species of Pseudocnus
Occurrence
Morphological characters
P. alcocki (Koehler and Vaney, 1908)
Andaman Islands
2 smaller ventral tentacles; tube feet radial only; body wall with
small smooth buttons only
P. californicus (Semper, 1868)
California
2 smaller ventral tentacles; tube feet radial only; body wall
lacking knobbed buttons
P. curatus (Cowles, 1907)
California
body wall with thick smooth buttons with few perforations only,
lacking distally spinous plates
P. dubiosus (Semper, 1868)
Peru
2 smaller ventral tentacles
P. echinatus (von Marenzeller, 1881)
Japan
2 smaller ventral tentacles; tube feet radial only; body wall with
knobbed plates with long pointed spire
P. goreensis (Cherbonnier, 1949)
Senegal
2 smaller ventral tentacles; multi-layered plates present in body
wall
P. grubei (von Marenzeller, 1874)
Adriatic Sea
2 smaller ventral tentacles; tube feet radial only; body wall with
curatus- like and multi-layered ossicles
P. koellikeri (Semper, 1868)
Mediterranean Sea
10 equal tentacles and as diagnosed
P. lamperti (Ohshima, 1915)
Aleutian Islands
2 smaller ventral tentacles; tube feet radial only; body wall
lacking knobbed buttons
P. lubricus (H. L. Clark, 1901)
(= C.fisheri astigmata Wells, 1924
(by Lambert 1998))
Puget Sound
tube feet scattered dorsally; body wall with distally spinous plates
and knobbed buttons
P. pawsoni Won and Rho, 1998
Korea
2 smaller ventral tentacles; inter-radial tube feet small, scattered;
body wall with curatus- like and multi-layered ossicles
P. rhopalodiformis (Heding, 1943)
Congo
rhopalodinid body form; 2 smaller ventral tentacles; tube feet
radial only
P. rugosus Cherbonnier, 1957
Sierra Leone
2 smaller ventral tentacles; tube feet radial only; body wall with
multi-layered ossicles
P. salmini (Ludwig, 1875)
Indonesia
as for P. dubiosus
P. sentus O’Loughlin and Alcock, 2000
New Zealand
2 smaller ventral tentacles; body wall with multi-layered distally
spinous ossicles
P. spinosus (Ohshima, 1915)
Japan
2 smaller ventral tentacles; tube feet radial only; body wall
lacking knobbed buttons
P. thandari Moodley, 2008
South Africa
2 smaller ventral tentacles; tube feet radial only
genus (below) by having tube feet confined to the radii and
lacking buttons, but differs by having two smaller tentacles
and having rod-plate ossicles and not plates in the tentacles.
We provisionally refer P. cornutus to Laevocnus (below).
The species that remain assigned to Pseudocnus exhibit a
range of contrasting morphological characters: 10 dendritic
tentacles that may be equal or eight large and two small
ventral; tube feet completely restricted to radii, largely
restricted to radii, or uniformly distributed around body;
macroscopic external anal scales present or absent; ‘calcareous’
ring calcified or not; body wall ossicles in different
combinations with single-layered perforated knobbed plates
with one end tapered and distally spinous (pine cone shape,
pear shape) present or absent, knobbed buttons present or
absent, multi-layered perforated knobbed plates present or
absent, incomplete baskets present or absent, thick smooth
buttons with few perforations only present or absent. We judge
that species with such different combinations of morphological
characters are not congeneric (see Table 2). None occurs in
southern cold temperate to Antarctic waters. A further review
of the species that remain assigned to Pseudocnus is needed.
Laevocnus O’Loughlin gen. nov.
Zoobank LSID. http://zoobank.org:act:6A6572E8-B33F-4200-
80F8-5963E557DE65
Key 1; figure 9
Diagnosis. Ten equal dendritic tentacles; tube feet on radii
only, radial series cross introvert to base of tentacles;
‘calcareous’ ring lacking posterior prolongations; ring
sometimes not calcified in larger specimens; gonad tubules not
branched; body wall ossicles single-layered perforated knobbed
plates with one end tapered and distally spinous; lacking four-
holed knobbed buttons; tentacles ossicles perforated plates,
rarely rods, never rosettes.
Four new species and a new genus of Antarctic sea cucumbers
Type species. Pentactella laevigata Verrill, 1876a, b (type
locality Kerguelen Islands)
Assigned species and occurrence. Laevocnus cornutus
(Cherbonnier, 1941) (Patagonia); L. intermedins (Theel, 1886)
(Heard and Kerguelen Islands); L. katrinae O’Loughlin sp. nov.
(Shag Rock); L. laevigatus (Verrill, 1876a, b) (Kerguelen Is); L.
leachmani Davey and O’Loughlin sp. nov. (Ross Sea); L.
leoninoides (Mortensen, 1925a) (New Zealand sub-antarctic
islands); L. leoninus (Semper, 1867) (Falkland Is); L. marionensis
(Theel, 1886) (Marion I.); L. perrieri (Ekman, 1927) (Falkland
Is, South Georgia); L. serratus (Theel, 1886) (Heard I.).
Etymology. Formed from a combination of “ laev ” from
laevigata (the species name of the type for the new genus), with
the established and related generic name Ocnus (masculine).
Remarks. We judge that having 10 equal tentacles or eight large
and 2 small ventral ones is a significant distinguishing generic
character. Cherbonnier 1941 reported that his species P.
cornutus had two slightly small ventral tentacles. No other
Laevocnus species has other than 10 equal tentacles. Laevocnus
species are distinguished from Pseudocnus species ( sensu
stricto) by: lacking inter-radial tube feet; having ossicles in the
body wall limited to single-layered knobbed plates with spines
at one end; rarely having rods and never rosettes in the tentacles.
As noted above in the previous Remarks Laevocnus
leoninus is an anomalous inclusion in Laevocnus , having: a
uniform cover of tube feet; numerous buttons in the body wall;
and tentacle rods. It does have 10 equal tentacles. Laevocnus
leoninus is sympatric with Laevocnus perrieri as a cold
temperate species of the new genus. Also noted above is the
provisional inclusion of Laevocnus cornutus that has two
smaller tentacles and rod-plates in the tentacles.
Laevocnus marionensis is also a somewhat anomalous
inclusion as it has body wall ossicles with slightly developed
tapered spinous ends inter-grading with knobbed buttons that
usually show some distal development.
O’Loughlin (2009) assigned Cucumaria serrata var.
intermedia Theel, 1886 (Heard and Kerguelen Islands) and
Cucumaria serrata var. marionensis Theel, 1886 (Marion
Island) to Pseudocnus and raised them to species status. We
now reassign these species to Laevocnus.
O’Loughlin (1994) reported that Laevocnus laevigatus
exhibited brood-protection in “two ventral invaginated marsupia
that opened through a common mid-body vestibule”. In some
female specimens (NMV FI65742 (6)) of Laevocnus serratus we
observed two ventral brood pouches invaginated into the coelom,
with one or two ventral inter-radial external openings. There were
up to 40 brood juveniles in one individual, each up to 3 mm long,
sub-equal in size, and with their tentacle crowns developed. Two
ventral openings but no internal pouches were observed (specimen
NMV F84982) for Laevocnus intermedius and it is assumed that
this species also has this brood-protecting adaptation.
COI sequence data from several hundred dendrochirotids
(Michonneau et al. in prep) recovers Laevocnus as a single
clade, albeit poorly supported, that includes L. katrinae sp.
nov., L. laevigatus, L. leachmani sp. nov., L. leoninus, L.
perrieri and L. serratus (Fig. 9).
47
Key (1) to the species of Laevocnus O’Loughlin gen. nov.
1. Tube feet cover the body uniformly.
. Laevocnus leoninus (Falkland Is)
— Tube feet restricted to the radii. 2
2. Tube feet in single well-spaced series in mid-body on all
radii.3
— Close zig-zag or paired series of tube feet on all radii, may
be more scattered on dorso-lateral radii. 5
3. Body up to 40 mm long; tube feet in paired series
anteriorly; body wall ossicles with long, narrow “goose
neck”, ending in a sparsely perforated and spinous taper...
. Laevocnus serratus (Heard I.)
— Body up to 15 mm long; single series of tube feet
anteriorly; body wall ossicles with short tapered spinous
end.4
4. Calcareous ring thin and indistinct; two polian vesicles;
body wall ossicles smaller, up to 208 pm long.
. Vi -. ■... .. • Tij ... Laevocnus katrinae sp. nov.
(western Antarctica, Shag Rock, 206 m)
— Calcareous ring distinct; single polian vesicle; body wall
ossicles larger, up to 280 pm long.
. Laevocnus leachmani sp. nov.
(eastern Antarctica, Ross Sea and off King George V
Land,299-1645 m)
5. Body wall ossicles with spinous end predominantly
rounded or not significantly elongate and tapered; body
wall ossicles small, up to 160 pm long.6
— Body wall ossicles with distal spinous end typically
elongate and tapered; largest body wall ossicles longer
than 180 pm long.7
6. Body wall ossicles irregularly oval, predominantly with
one end rounded and closely spinous, up to 140 pm long;
tentacles ossicles large smooth perforated plates;
preserved specimens smaller, up to 35 mm long.
. Laevocnus leoninoides (New Zealand sub-antarctic Is)
— Body wall ossicles with slightly developed tapered
spinous ends, inter-grading with knobbed buttons usually
showing some distal development, up to 160 pm long;
tentacles ossicles perforated plates with surface spines;
preserved specimens larger, up to 55 mm long.
. Laevocnus marionensis (Marion I.)
7. Two smaller tentacles; rod-plate ossicles in the tentacles ...
. Laevocnus cornutus (Patagonia, Falkland Is)
— Equal tentacles; plate ossicles in the tentacles.8
8. Preserved specimens small, up to 40 mm long; tentacle
plates with some surface spines; lacking ventral coelomic
brood sacs and openings.
. Laevocnus perrieri (Falkland Is, South Georgia)
48
— Largest preserved specimens up to at least 60 mm long;
tentacle plates with knobs or smooth, not with surface
spines; females with ventral coelomic brood sacs and
openings. 9
9. Preserved body up to 115 mm long; body wall ossicles up
to 220 pm long; tentacles ossicles smooth plates.
. Laevocnus laevigatus (Kerguelen Is)
— Preserved body up to 65 mm long; body wall ossicles up
to 185 pm long; tentacle ossicles plates with surface knobs
. Laevocnus intermedius (Heard I.)
Laevocnus katrinae O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:AC9E8725-E167-405E-
BCAA-3904F35161D6
Key 1; figures 9, 10
Material examined. Holotype. Southern Atlantic Ocean, Western
Antarctica, Shag Rock, 53.63°S 40.91°W, 206 m, BAS BIOPEARL 1
stn SR-EBS-4, 11 Apr 2006, NMV F168836 (UF tissue sequence
code MOL AF 815).
Paratypes. Type locality and date, NMV F 189886 (9); type
locality and date, NHMUK 2010.139-142 (4).
Description. Up to 14 mm long, 4 mm diameter (tentacles
deeply withdrawn); body cylindrical, rounded orally and
anally; thin, semi-translucent, calcareous body wall; 10 equal
dendritic tentacles; calcareous ring present, indistinct, thin
sinusoidal cucumariid-like, lacking posterior prolongations;
tube feet extended, rigid, about 0.3 mm diameter, restricted to
single well-paced radial series, up to 7 tube feet per series
externally, plus up to 9 per series on withdrawn introvert; 5
small anal papillae; lacking macroscopic anal scales; 2 polian
vesicles; 2 tufts of un-branched gonad tubules.
Ossicles in body wall similar in smallest (2 mm long) and
largest specimens, elongate to irregularly-oval perforated
plates, with marginal and surface knobs, tapered at one end,
there bearing distal spines, plates up to 208 pm long. Ossicles
in tentacles irregularly rectangular to triangular perforated
plates with denticulate to spinous margins and few small
surface granulations, up to 180 pm long. Ossicles in tube feet
endplates with small irregular perforations; tube feet support
ossicles irregularly-curved, perforated plates, frequently with
distally-spinous mid-plate projection, plates up to about 200
pm long. Peri-anal ossicles distally spinous knobbed plates as
in mid-body wall.
Colour (preserved). Body and tentacles white.
COI DNA barcode of holotype: AATTATGATAGGAG-
GCTTTGGA A ACT GATTA ATACCTTTA AT GATAG -
GAGCCCCCGATATGGCTTTCCCACGAAT-
GAACAATATGAGATTCTGATTAATACCCC-
CTTCTTTTATTTTACTATTGGCTTCTGCTGGAGTA-
GA AGGAGGT GCAGGA ACAGGAT GAACTATTTACC-
CACCTTTATCCAGA A A A ATAG CT CAT G CAG GAG -
GATCTGTAGATTTAGCTATATTTTCCCTACACT-
TAGCAGGTGCCTCCTCAATACTTGCATCTAT-
TAAATTTATTACTACTATTATAAATATGCGAGCAC-
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
CAGGAGTTTCATTT GAT CGTTTACCACTATTTATTT-
GATCAGTTCTAATAACCGCCTTTCTTTTACTTCTAA-
GT CTT CCT GTTTTAGCAGGT GCTATTACAATGTTAT-
TAACAGACCGAAATATAAAAACAACTTTTTTT-
GATCCAT CAGGAGGAGGAGACCCTATAC-
TATTTCA ACACTTATTTT GATTTTTT GGACACCCT-
GAAGTTTATATTTTGATTCTACCAGGATTTGGAAT-
GATATCACACGTAATTACTCATTATAGAGGTA-
GACA AGA ACCATTT GGATATTTAGGA AT GGTTTAT-
GCTATGATAGCTATAGGTATTTTAGGTTTTATCGT-
GTGAGCACAC
Distribution. Southern Atlantic Ocean, Western Antarctica,
Shag Rock, 206 m.
Etymology. Named for Katrin Linse (British Antarctic Survey),
in appreciation of her role in the BAS BIOPEARL expeditions
and the collection of specimens studied here, and with gratitude
for her gracious collaboration in making BAS specimens
available for this study and providing relevant data.
Remarks. Laevocnus katrinae is distinguished from other
species of Laevocnus by the morphological characters detailed
in the key above, as well as by >17% pair-wise K2P divergence
in COI sequence.
Laevocnus leachmani Davey and O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:DD44CDAF-F84B-4D6F-
B979-FCB0EBD60015
Key 1; figures 9, 11
Pseudocnus species (Ross Sea) O’Loughlin etal., 2010: table 1.
Material examined. Holotype. Eastern Antarctica, Ross Sea, 72.08°S
175.55°E, 1620 m, stn TAN0802/139, N. Davey, 22 Feb 2008, NIWA
42203 (UF tissue sequence code MOL N 182).
Paratype. Type locality and date, NIWA 61890 (1).
Other material. Ross Sea, 72.07°S 175.59°E, 1629-1645 m, stn
TAN0802/135, 22 Feb 2008, NIWA 61100 (4 juvenile specimens); off
George V Land, 66.57°S 142.00°E, 299-521 m, CEAMARC RSV
Aurora Australis Voyage 3, stn 9EV117,26 Dec 2007, NMV F189887 (1).
Description. Body up to 15 mm long (preserved, tentacles
withdrawn), 6 mm diameter; body fusiform; body wall thin,
calcareous, with a rugose surface created by a close cover of
projecting spinous ossicle ends; 10 equal dendritic tentacles; 5
oral papillae, 5 anal papillae, lacking anal scales; tube feet
projecting, not withdrawn, about 0.4 mm in diameter, restricted
to a single, well-spaced series in all radii, extending across the
introvert; calcareous ring distinct, calcified, cucumariid-like,
lacking posterior prolongations; single polian vesicle; two tufts
of unbranched gonad tubules; 3 embryos in withdrawn oral
cavity in one specimen.
Body wall ossicles irregularly oval to oblong, single-layered,
perforated, knobbed plates, with one end of plate always sharply
spinous and frequently narrowed into a short distally-spinous
neck, spinous apex frequently upturned, plate perforations
smaller at ends, sometimes with two large perforations centrally
separated by a narrow knobbed bridge, plates up to 280 pm
long; lacking knobbed buttons. Tentacle ossicles perforated
plates of variable form and size, up to 240 pm long, marginally
Four new species and a new genus of Antarctic sea cucumbers
49
Figure 10. Laevocnus katrinae O’Loughlin sp. nov. holotype (NMV F168836). a, preserved holotype; b-f, SEM images of ossicles from the
holotype - b, tentacle plates; c, mid-body wall plates with one end distally spinous; d, tube foot endplate; e, endplate support ossicles with distally
spinous lateral projection; f, peri-anal plates with one end distally spinous.
50
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
spinous, sometimes with surface knobs or spines; no rods or
rosettes. Tube feet endplate support ossicles bent and curved
plates with apically spinous mid-plate projection.
Colour (preserved). White.
COI DNA barcode of holotype: TAACTGATTAATACCTT-
TAATGATTGGAGCCCCTGACATGGCTTTCCCAC-
GA AT GA AC A AT AT GAGATTCT GATTA ATACCCC-
CAT CCTTT CTTTTACTACTAGCTT CTGCTAGT GTA-
GAA AGAGGTGCAGGA ACAGGAT GA ACTATTTACC-
CCCCCTTATCTAGAAAAATAGCCCATGCAGGAG-
GATCTGTAGATCTAGCTATTTTTTCACTTCAC-
CTAGCAGGTGCCTCTTCAATTCTTGCAGC-
TATAAAATTTATAACTACTATAATAAAAATGCGAG-
CACCAGGTATTTATTTTGACCGT CTAT CATTATT-
TATCTGATCCGTCTTTATTACTGCTTTTCTAT-
TACT CTTA AGTCTT CCAGTATTAGCAGGTGCTATTA-
CA AT GTTATTA ACAGATCGA A ACATA A ACACTAC-
CTT CTTT GAT CCAT CAGGT GGAGGAGAT CCTATAT-
TATTCCAACACTTATTCTGATTTTTTGGACACCCA-
GAAGTATATATTCTTATTTTACCAGGATTTGGTAT-
GATATCTCATGTAATTACACATTATAGAGGAA-
GACAAGAACCCTTTGGATATTTAGGTATGGTTTAT-
GCTATGATATCTATAGGTATTTTAGGTTTCCTAG-
TAT GAGCT CACCACAT GTTTACT GTAGGA
Distribution. Eastern Antarctica, Ross Sea and off George V
Land,299-1645 m.
Etymology. Named for Andrew Leachman, skipper of the RV
Tangaroa for 38 years, that included seven marine research
voyages to Antarctica.
Remarks. Laevigatus leachmani is distinguished from other
species of Laevocnus by the morphological characters detailed
in the key above, as well as by >17% pair-wise K2P divergence
in COI sequence. This species is listed as Pseudocnus species
(Ross Sea) by O’Loughlin et al. (2010) (Table 1).
Figure 11. Laevocnus leachmani Davey and O’Loughlin sp. nov. a, preserved holotype (NIWA 42203; photo by Peter Marriot (NIWA)); b-d,
SEM images of ossicles from a paratype (NIWA 61890) - b, tentacle plates; c, mid-body wall plates with one end distally spinous; d, tube foot
endplate support ossicles, one with distally spinous lateral projection.
Four new species and a new genus of Antarctic sea cucumbers
Family Paracucumidae Pawson and Fell, 1965
Key 2; figure 12
Diagnosis. Body cylindrical, posterior taper; body wall thin;
tube feet distributed around body; 10-15 dendritic or sub-
digitiform tentacles, ventral pair usually small; mid-body wall
ossicles perforated plates, some with knobs, some with
secondary layer developments from one or a few layers to
dome-like stacks or spines, sometimes in cross form.
Included genera. Paracucumis Mortensen, 1925b; Crucella
Gutt, 1990
Remarks. Gutt (1990) referred his new genus Crucella to the
Paracucumidae, and O’Loughlin (2002) and O’Loughlin et al.
(2009b) maintained this referral. O’Loughlin et al. (2009b)
discussed Crucella , judged that Caespitugo citriformis Gutt,
1990 is a junior synonym of Thyone scotiae Vaney, 1906 and
referred Thyone scotiae to Crucella. Currently the family has
three recognized species: Paracucumis turricata (Vaney, 1906)
(junior synonym Paracucumis antarctica Mortensen, 1925b by
O’Loughlin 2002), Crucella scotiae (Vaney, 1906), and Crucella
hystrix Gutt, 1990. We add a fourth species Crucella susannae
O’Loughlin sp. nov. Phylogenetic analysis based on COl
sequence data recovers a monophyletic Paracucumidae among
200 species of dendrochirotids sequenced to date, but shows
Crucella , as currently defined, to be paraphyletic (Fig. 12), with
C. scotiae sister to the new species C. susannae and P. turricata
sister to these two species. However P. turricata has what we
judge to be two significant morphological characters (up to 15
tentacles and body wall plates imbricating or contiguous) that are
not shared with C. scotiae and C. susannae. We acknowledge
this anomaly for generic assignment, but on primarily
morphological grounds maintain Thyone scotiae in Crucella
and maintain Paracucumis as a monotypic genus. COl data
indicate further cryptic, geographical divergence within C.
hystrix and C. scotiae as previously indicated by O’Loughlin et.
al. (2010). We note in relation to the 2010 paper and relevant tree
(page 8) that the South Shetland specimen (green) of C. scotiae
is re-identified here as our new species C. susannae.
Key (2) to the species of Paracucumidae (Antarctica)
1. Body form elongate, narrow, vermiform; plates covering
body wall imbricate or contiguous; body cover of high
domes on plates; tube feet around body mostly inconspicuous;
up to 15 dendritic tentacles. Paracucumis turricata
— Body form not elongate, narrow, vermiform; plates in
mid-body wall not imbricate, some contiguous; body with
or lacking domes or fine spines on plates; tube feet around
body conspicuous; 10 tentacles.2
2. Preserved body up to 30 mm long; finely spinous surface
appearance; tentacles sub-digitiform; knobbed perforated
cross ossicles in mid-body wall, some with narrow spires
. Crucella hystrix
— Preserved body up to at least 50 mm long; wide blunt
domes or smooth surface appearance; tentacles dendritic;
mid-body plate ossicles never in cross form.3
51
3. Uniform cover of tube feet; mid-body wall ossicles include
large irregular plates (up to 600 pm long), some with
secondary layering and central elevation forming a low
dome. Crucella scotiae
— Tube feet closer together and larger ventrally than
dorsally; mid-body wall ossicles round to oval single¬
layered perforated plates (up to 170 pm long), never with
secondary layering. Crucella susannae
Crucella Gutt, 1990
Key 2; figure 12
Diagnosis (emended). Body cylindrical, not vermiform, with
narrowed tail; body wall thin; 10 dendritic or sub-digitiform
tentacles, ventral pair small; tube feet distributed around body,
sometimes unevenly; body wall ossicles perforated plates,
some with knobs, some with low secondary layering forming
domes, some with spires; mid-body plates generally spaced
apart, some plates possibly contiguous but not imbricating.
Type species. Crucella hystrix Gutt, 1990 (type locality
Weddell Sea)
Assigned species and type locality. Crucella hystrix Gutt, 1990
(Weddell Sea); C. scotiae (Vaney, 1906) (Antarctic Peninsula);
Crucella susannae O’Loughlin sp. nov. (South Shetland
Islands)
Remarks. Crucella is reviewed above in the Remarks and Key
for Paracucumidae.
Crucella susannae O’Loughlin sp. nov.
Zoobank LSID. http://zoobank.org:act:962A6E3A-4177-4585-
A1BB-A4AC17FD1E90
Key 2; figures 12, 13, 14
Material examined. Holotype. Antarctica, South Shetland Islands, off
King George Island, 61.83°S 58.63°W, 191 m, CCAMLR RV
Polarstern ANT-XXVIII/4 stn 79/264, S. Lockhart, 31 Mar 2012,
NMV F193782.
Paratypes. Off Elephant Island, 60.98°S 55.69°W, 92 m, CCAMLR
RV Polarstern ANT-XXVIII/4 stn 79/229, 24 Mar 2012, NMV
F193784 (17) (UF tissue sequence code MOL AF1293); Bransfield
Strait, 62.45°S 055.27°W, 244 m, CCAMLR RV Polarstern ANT-
XXVIII/4 stn 79/269, 1 Apr 2012, NMV F198491 (1); South Orkney
Islands, 60.59°S 45.15°W, A MLR 2009 stn 78/8, 92-105 m, 11 Feb
2009, NMV F169315 (1).
Description. Up to 52 mm long, 28 mm diameter (strongly
contracted, tentacles deeply withdrawn); body bluntly rounded
and upturned orally, tapered upturned cone-shaped anally;
body wall thin, firm, parchment-like to soft leathery; 8 large, 2
small ventral, dendritic tentacles; solid typical cucumariid
calcareous ring present, lacking any posterior prolongations;
completely covered with small tube feet, close-set and about
0.4 mm diameter ventrally, scattered and about 0.2 mm
diameter dorsally; with numerous small peri-anal papillae;
lacking macroscopic anal scales; 2 tufts of gonad tubules, not
branched; respiratory trees present; 1 polian vesicle.
52
Dorsal body wall with scattered, not imbricating or
contiguous, thick, single-layered, oval to round plates, with up
to 22 perforations, irregular margins sometimes with blunt
denticulations, sometimes with surface knobs, up to 168 pm
long. Ventral body wall ossicles similar to dorsal. Tentacles
with perforated plates and long, narrow, perforated, rod-like
plates, with marginal digitiform and blunt denticulations,
plates smooth or with some surface knobs, up to 560 pm long.
Ventral tube feet with endplates with rounded margin, large
and small perforations irregularly arranged, up to 360 pm
diameter; lacking tube foot support ossicles. Peri-anal ossicles
include plates as in body wall; numerous larger, oval,
perforated plates with low secondary layering, up to 280 pm
long; and pyramidal multi-layered anal scales, about 360 pm
high and wide at base.
Colour. Live: Body pale brown and blue-grey. Preserved: pale
brown to grey to off-white.
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
COIDNA barcode ofparatype: TATTATGATAGGAGGTTTTG-
GTAATTGGTTAATTCCATTAATGATAGGAGCACCAGA-
CATGGCCTTCCCTCGAATGAATAAAATGAGATTCTGAT-
TAATTCCCCCTTCTTTTGTGCTTCTGCTTACCTCCGCAA-
GAATAGAAAATGGGGCTGGTACAGGTTGAACTTTATAC-
CCCCCTCTTTCAAGAAAAATAGCTCACGCAGGAA-
GATCAGTAGATCTTGCTATTTTTTCGCTACATCTAGCAG-
GAGCCTCCTCTATTCTTGCCTCCATAAAATTTATAAC-
TACCATAATAAAAATGCGAACCCCAGGAATTTCATTT-
GACCGTCTACCACTTTTTGTCTGATCCGTTTTTATAACA-
GCCTTCCTATTAGTATTAAGCCTCCCAGTTTTAGCAGGT-
GCTATAACAATGTTATTAACCGACCGAAAAAT-
TAAAACAACCTTCTTTGACCCAGCAGGAGGAGGAGACC-
CCATTTTATTTCAACACTTATTCTGATTCTTTGGACATC-
CAGAAGTTTATATACTTATTTTACCAGGGTTCGGAATGA-
TATCTCACGTTATTGCACACTATAGAGGAAAGCAA-
GAACCATTTGGGTACTTAGGAATGGTTTACGCTATGG-
TAGCAATAGGAGTATTAGGCTTCCTAGTATGAGCTCAC
Pa racu cu m isJu rricata_S_Orkney s_M 0 l_AF__0891
- Paracucumisju rricata_Amund se n_SeaJMOLAF J)791
Paracucu misturricata_Ross_Sea_MOLN_201
. Pa racucum is Ju mca1a_Am u ndse n_Sea_MOLAF_0792
' Paracucumis Jumcata BAS EC 120-09
r- Pa racucumis tu mcata_Ross_Sea_MOLN_200
- Paracucu misJurricataJ*oss_SeaJVtOLN_202
^ I Crucella_susannae_BamsfieidJ_MOLSI_068
L Cruoella_susannae_S = Shetlands_MOLAF-1293
Cmcellascotia e_Ross_Sea_IVIOLG_097
r Cnjcella_scotiae_Ross_Sea_MOLN_192
Cnjcella_5Cotiae_Ross_Sea_MOLG_099
-Crucella scotia e Ross Sea MOLG 098
Crucel I a = hystrix = Amundsen = Sea_MOLAF_D793
Crucella_hystrix_BASEC134-09
[— Crucel fa_hystrix_Ross_Sea_MO LN_170
Cmcella_hystrix_Ross_Sea_MOLN_171
l- Cruoella_hystrix_Ross = Sea_MOLM_169
-Psolidium tenue Antarctica Amundsen Sea NMV MOLAF 070£
002
Figure 12. Maximum likelihood tree for Paracucumidae, based on COI sequences, GTR+G model, 100 bootstrap replicates, Psolidium tenue as
outgroup. Filled circles >0.95 bootstrap support.
Four new species and a new genus of Antarctic sea cucumbers
Figure 13. Crucella susannae O’Loughlin sp. nov. a, photo of live specimen of a paratype (Elephant I.; NMV F193784; photo by Susanne
Lockhart); b-f, holotype (NMV F193782) - b, left lateral view of preserved body of holotype; c, calcareous ring, polian vesicle, gonad tubules;
d, SEM images of tentacle ossicles; e, SEM images of body wall ossicles; f, SEM images of fragments of endplate.
4 & *
54
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Figure 14. SEM images of peri-anal body wall ossicles from holotype of Crucella susannae O’Loughlin sp. nov. (holotype NMV F193782). Top:
typical mid-body wall ossicles in the peri-anal region. Bottom: fragment of peri-anal scale with some secondary layer development, and
perforated plates with secondary layer developments.
Four new species and a new genus of Antarctic sea cucumbers
Distribution. Western Antarctica, South Shetland, Elephant,
South Orkney Islands, 92-244 m.
Etymology. Named for Susanne Lockhart (National Oceanic
and Atmospheric Administration’s US AMLR Program), in
appreciation of her initiative and hard-working role in
quantitatively collecting, preserving, documenting and
donating to Museum Victoria many hundreds of specimens of
sea cucumbers from the 2012 CCAMLR demersal finfish trawl
survey.
Remarks. Crucella susannae is distinguished from other
species in family Paracucumidae in the key. We judge that the
preserved dark brown colour of the holotype (NMV F193782)
is a result of discolouration from trawl contents.
Paracucumis Mortensen, 1925b
Key 2
Diagnosis (emended). Body form cylindrical, elongate, narrow,
vermiform, posterior tapered; body cover of high domed plates;
up to 15 dendritic tentacles, ventral pair and possibly some
others small; tube feet distributed around body, may be
rudimentary and inconspicuous; plates covering body wall
imbricate or contiguous, some multi-layered into a high dome¬
like elevation.
Type species. Thyone turricata Vaney, 1906 (= Paracucumis
antarctica Mortensen, 1925b by O’Loughlin 2002) (type
locality South Orkney Islands) (monotypic)
Remarks. Paracucumis is reviewed above in the Remarks and
Key for Paracucumidae.
Family Thyonidiidae Heding and Panning, 1954
Diagnosis (Smirnov 2012). Tentacles 15-25; plates of
calcareous ring lacking segmented posterior extensions;
ossicles tables with 2,3 or 4 pillars, or plates ( Parathyonidium ),
or reduced ( Patallus and Athyonidium ).
Remarks. Thyonidiinae Heding and Panning, 1954 was raised
to family status by Smirnov (2012) who understandably
suspected that the Thyonidiidae is polyphyletic, those genera
with tables not related to those lacking tables.
Parathyonidium Heding, 1954
Parathyonidium Heding, 1954 in Heding and Panning 1954.
Diagnosis (see Description of Parathyonidium incertum
Heding, 1954 below)
Type species. Parathyonidium incertum Heding, 1954 (type
locality South Georgia) (monotypic)
Remarks. Albert Panning (in Heding and Panning 1954) noted
that his Copenhagen friend and colleague Sven Heding died
before the publication of their anticipated Discovery Report,
where he planned to describe the new genus Parathyonidium
and species Parathyonidium incertum. Albert further noted
that Elizabeth Deichmann had taken over work on the
55
Discovery specimens, but had agreed that Albert would publish
the description as written by Sven. Albert assigned the
authorship of the new taxa to Heding, and the descriptions were
published in Heding and Panning (1954). A Discovery Report
on holothuroids was never published. The Discovery
holothuroid collection is currently in Museum Victoria where
most specimens have now been determined. Mark O’Loughlin
and his colleagues hope to complete a Discovery Report on
holothuroids. Here we have emended the diagnosis of
Parathyonidium Heding, 1954 to more fully describe the
tentacle form and arrangement, calcareous ring, gonad tubule
arrangement, and ossicles.
Parathyonidium incertum Heding, 1954
Figure 15
Parathyonidium incertum Heding, 1954 in Heding and Panning
1954: 37-39, text fig. 3.—O’Loughlin et al., 2009b: 5-6, table
1, fig. ld-f.—O’Loughlin et al., 2010: table 1.
Parathyonidium Heding species.—O’Loughlin et al., 2009a:
217, fig. 2c.
Parathyonidium species.—O’Loughlin et al., 2010: 4, table 1.
Material examined. Holotype. West of Shag Rock, South Georgia,
Discovery Expedition, RRS Discovery II stn 474,199 m, 12 Nov 1930,
no registration found (data from Heding and Panning 1954; specimen
not located).
Paratypes. South Shetland Islands, Clarence Island, Discovery
Expedition, Discovery stn D170,61°26'S 53°46'W, 342 m, 23 Feb 1927,
NHMUK 2011.171-173 (3); ZMUC-HOL-300 (3) (confirmed by Tom
Schioette ZMUC; specimens not seen here); Elephant I., 600 m,
MNHN-IE-2013-2479 (2) (previously EcHh250, confirmed by
Sebastien Soubzmaigne MNHN; specimens not seen here).
Other material. South Atlantic Ocean, South Georgia, US AMLR
2004, Icefish stn 47-BT25, 55.06°S 35.24°W, 116 m, 12 Jun 2004,
NMV F104998 (1); Antarctic Peninsula, Low I.. BENTART-2006,
R/V Hesperides, stn LOW47, 63.47°S, 62.22°W, 115 m, 12 Feb 2006,
MNCN 29.04/126 (1 specimen), body wall ossicles slide NMV
F161525; MNCN 29.04/127 (2 specimens), posterior body ossicles
slide NMV F161526, tentacle ossicles slide NMV F161527; Eastern
Antarctica, off Enderby Land, Nella Dan, ANARE stn HRD010,
65°56'S 50°52'E, 386-400 m, M. Norman, 15 Nov 1985, NMV F84983
(15), NMV FI65585 (1), NMV F189876 (4); stn HRD011, 65°50'S
50°35'E, 540 m, M. Norman, 20 Nov 1985, NMV F189880 (2).
Description (emended from O’Loughlin et al. 2009b).
Specimens up to 35 mm long preserved (tentacles partly
extended, NMV F104998), sub-cylindrical, elongate, widest
diameter 5 mm; soft thick body wall; lacking distinct ventral
sole; oral end sometimes upturned, slightly tapered and
rounded distally when tentacles withdrawn; anal end slightly
tapered and rounded distally; 13 to 16 dendritic tentacles
(holotype with 13; NMV F104998 with 16; one paratype
NHMUK 2011.171-173 with 15), typically in a single circle of
5 single, smaller, radial and 5 pairs of larger, inter-radial
tentacles; long digitiform genital papilla posterior to dorsal
tentacle pair immediately distal to tentacle crown in male
specimen (suggesting internal fertilization and brood
protection); female genital pore posterior to dorsal tentacle
pair; tube feet large, confined to radii, spaced in single series
56
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Figure 15. Parathyonidium incertum Heding, 1954. a-c, paratypes NHMUK 2011.171-173. a, specimen showing large radial tube feet, and
smaller tentacle aligned with radius / ambulacrum (oeophagus everted); b, dorsal inter-radial male genital papilla immediately distal to tentacle
crown; c, view of tentacle crown with smallest tentacles aligned with radii / ambulacra (denoted by red spot; top right small tentacle obscured by
larger tentacle), d-f, specimen NMV FI04998. d, SEM images of ossicles from tentacles; e, SEM images of ossicles from dorsal mid-body wall;
f, SEM images of ossicles from ventral mid-body wall.
Four new species and a new genus of Antarctic sea cucumbers
from base of tentacles to anus; calcareous ring with radial
plates only, sub-rectangular, elongate, wide anteriorly and
posteriorly, narrowed mid-plate, deep posterior notch; 1-2
long, tubular polian vesicles; no respiratory trees; gonad tubules
in two tufts, not in series along gonoduct, one tuft on each side
of dorsal mesentery, tubules not branched; brood-protection of
free juveniles in the coelom.
Body wall ossicles two types of plates: abundant, thin,
lattice-like, smooth to knobbed, single-layered, irregular
plates, with bluntly denticulate margins, and with few to many
perforations, similar dorsally and ventrally; and additional
thin, elongate, plates, with 2 large central perforations, 2 small
distal perforations, with one end extended with few small
perforations, and with short blunt denticulations on surface
and around margin, typically 100 pm long, but up to 160 pm
long; these small plates intergrade with the larger smooth to
knobbed, marginally denticulate plates, that are up to 200 pm
long. Tube foot with large (up to 360 pm diameter) endplates,
few perforated support plates. Tentacle ossicles perforated
round to oval, slightly concave plates, with blunt marginal
denticulations, some with central knob, some fine surface
spines, plates up to 280 pm long; rods absent. Peri-anal body
wall with incipiently multi-layered, thick, round, perforated
plates / scales, 440 fim diameter.
Colour (preserved). Yellow-white, some specimens with a
violet hue; purple internally (Heding 1954), pale grey (this
work).
Distribution. South Atlantic, South Georgia, Shag Rock;
Western Antarctica, Elephant I., South Shetland Is, Antarctic
Peninsula; Eastern Antarctica, Enderby Land; 115-600 m.
Remarks. Heding and Panning (1954) makes clear reference to
a “Type” from Shag Rock, and also refers in the description to
additional specimens. This holotype has not been located in
any of the European or United States museums. There are
paratypes so labelled in the MNHN and ZMUC. Amongst the
Discovery Expedition specimens there are three from Clarence
Island in the South Shetland Islands (NHMUK 2011.171-173)
that are from the same original lot as the labelled paratypes in
Copenhagen (ZMUC-HOL-300 (3)). We have labelled and
listed these NHMUK specimens as paratypes. We have found
numerous specimens from off Enderby Land in Eastern
Antarctica in the collections of Museum Victoria (NMV).
These coelomic brood-protecting specimens were first thought
to represent a new species (see O’Loughlin et al. 2009a, 2010),
but we now judge that they are conspecific with Parathyonidium
incertum. This is the only Antarctic coelomic brood-protecting
species reported to date (see O’Loughlin et al. 2009a).
Acknowledgments
We are most grateful for the valued contribution to our work
by the following: Ben Boonen for the preparation of the
figures; Gary Poore (NMV), Frank Rowe (Research Associate
of the Australian Museum), and Ahmed Thandar (University
of KwaZulu-Natal) for their helpful communications on
systematic issues; David Pawson (Smithsonian Institution),
Tom Schioette (ZMUC), and Sebastien Soubzmaigne
57
(MNHN) for locating and confirming type specimens for us,
and to Carsten Leuter (Berlin Museum fiir Naturkunde) and
Bernhard Ruthensteiner (Zoologische Staatssammlung
Miinchen) for assisting us in this search; Andrew Cabrinovic
(NHMUK) for facilitating the registration of specimens;
Katrin Linse (BAS) for donation of specimens and provision
of collecting data; Susanne Lockhart (NOAA’s US AMLR)
and her colleagues for the collection, documentation,
photographing and donation of specimens; Niki Davey
(NIWA) for agreeing to our inclusion of a new Ross Sea
species in this paper; Peter Marriot (NIWA) for the photograph
of the Ross Sea specimen; Paul Brickie (Falkland Islands
SMSG) for the in situ photo from the Falkland Islands; Dirk
Schories (UACh) for the in situ photo from Fildes Bay. Partial
support from NSF DEB-0529724 is gratefully acknowledged.
We are grateful for the careful review by Ahmed Thandar.
References
Arndt, A., C. Marquez, P. Lambert and Smith M. J. 1996. Molecular
phylogeny of eastern Pacific sea cucumbers (Echinodermata:
Holothuroidea) based on mitochondrial DNA sequence. Molecular
Phylogenetics and Evolution 6: 425-437.
Brandt, J. F. 1835. Prodromus descriptionis animalium ab H. Mertensio
in orbis terrarum. Petropoli.
Britten, M. 1910. Echinodermata: A)Holothuroidea. In Zoologische
und Anthropologische Ergebnisse einer Forschungsreise im
Westlichen und Zentralen Siidafrika Ausgejuhrt in den jahren
1903-1905 4(14): 239-243. Jena.
Cherbonnier, G. 1941. Note sur une nouvelle Holothurie antarctique:
Cucumaria cornuta nov. sp. Bulletin Societe Zoologique France
66:271-270.
Cherbonnier, G. 1949. Note sur une holothurie nouvelle des cotes du
Senegal: Hemioedema goreensis n. sp. Bulletin Museum National
Histoire Naturelle Paris 2 serie 21(5): 585-589.
Cherbonnier, G. 1950. Une nouvelle holothurie dendrochirote des
cotes du Cameroun: Cladodactyla monodi n. sp. Bulletin Museum
National Histoire Naturelle Paris 2 serie 22(3): 375-377.
Cherbonnier, G. 1952. Contribution a la connaisance des holothuries
de l’Afrique du Sud. Transactions of the Royal Society of South
Africa 33: 469-509, 16 pis.
Cherbonnier, G. 1957. Holothuries des cotes de Sierra-Leone. Bulletin
Museum National Histoire Naturelle Paris 2 serie 29(6): 485-492.
Cherbonnier, G. 1958. Holothuries des cotes de Sierra-Leone. (4e
note). Bulletin Museum National Histoire Naturelle Paris 2 serie
30(3): 294-299.
Cherbonnier, G. 1961. Deux nouvelles especes d’holothuries
dendrochirotes des cotes Bresiliennes. Bulletin Museum National
Histoire Naturelle Paris 2 serie 33(6): 611-615.
Clark, H. L. 1901. Echinoderms from Puget Sound: Observations
made on the Echinoderms collected by the parties from Columbia
University, in Puget Sound in 1896 and 1897. Proceedings Boston
Society Natural History 29: 323-337.
Cowles, R. P. 1907. Cucumaria curata sp. nov. Johns Hopkins
University Circular 195: 8-9, pi. 2 figs 2, 3, 5, 6, pi. 4 fig. 7.
Deichmann, E. 1930. The Holothurians of the Western Part of the
Atlantic Ocean. Bulletin of the Museum of Comparative Zoology,
Harvard University 71: 43-236.
Deichmann, E. 1938. Eastern Pacific Expeditions of the New York
Zoological Society. XVI. Holothurians from the western coasts of
Lower California and Central America, and from the Galapagos
Islands. Zoologica, New York 23: 361-387.
58
Deichmann, E. 1941. The Holothurioidea collected by the Velero III
during the years 1932 to 1948. Part I, Dendrochirota. Allan
Hancock Pacific Expeditions 8: 61-153, pis 10-30.
Ekman, S. 1925. Holothurien. Further zoological results of the Swedish
Antarctic Expedition 1901-1903 1(6): 1-194.
Ekman, S. 1927. Elolothurien der deutschen Siidpolar-Expedition
1901-1903 aus der Ostantarktis und von den Kerguelen. Deutsche
Siidpolar-Expedition 19 (Zoology 11): 359-419.
Grube, A. E. 1840. Aktinien, Echinodermen und Warmer des
Adriatischen und Mittelmeeres. pp. 33 -43, 1 pi. Konigsberg.
Gutt, J. 1990. New Antarctic holothurians (Echinodermata). I. Five
new species with four new genera of the order Dendrochirota.
Zoologica Scripta 19: 101-117.
Hansen, B. 1988. The genus Staurocucumis Ekman and its possible
affinity with Echinocucumis Sars (Holothuroidea, Dendrochirota).
In: R. D. Burke, P. V. Mladenov, P. Lambert and R. L. Parsley
(eds.) Echinoderm biology. Proceedings of the Sixth International
Echinoderm Conference, Victoria, 23-28 August 1987. p 301-308.
Heding, S. G. 1942. Uber Cucumella triplex und zwei neue Holothurien
der Deutschen Tiefsee-Expedition. Zoologischer Anzeiger 137:
217-220.
Heding, S. G. 1943. Deux nouvelles holothuries dendrochirotes du
Congo et quelques remarques au sujet de Halodeima coluber
(Semper). Bulletin du Musee royal d’Histoire naturelle de Belgique
19(34): 1-8.
Heding, S. G. and Panning, A. 1954. Phyllophoridae. Eine bearbeitung
der polytentaculaten dendrochiroten holothurien des zoologischen
museums in Kopenhagen. Spolia Zoologica Musei Hauniensis 13:
209 pp.
Hoareau, T. and Boissin, E. 2010. Design of phylum-specific hybrid
primers for DNA barcoding: addressing the need for efficient COI
amplification in the Echinodermata. Molecular Ecology Resources
10: 960-967.
Koehler, R. 1921. Faune de France. 1. Echinodermes. 210 pp., 153 figs.
Le Chevalier: Paris.
Koehler, R. 1927. Les Echinodermes des mers d’Europe. 2. 339 pp.
Librarie Octave, Gaston Doin: Paris.
Koehler, R. and Vaney, C. 1908. Holothuries recuielles par
TInvestigator dans VOcean Indien. 2. Les Holothuries Littorales.
54 pp., 3 pis. Trustees Indian Museum: Calcutta.
Lambert, P. 1998. A taxonomic review of five northeastern Pacific sea
cucumbers (Holothuroidea). Pp. 473-477 in: Mooi, R. and Telford,
T. (eds). Echinoderms: San Francisco. Proceedings of the Ninth
International Echinoderm Conference. Balkema: Rotterdam.
Lampert, K. 1885. Die Seewalzen. Holothurioidea. Eine Systematiche
Monographic. In Semper, C. (ed.) Reisen im Archipel der
Philippinen 4(3): 312 pp., 1 pi., 3 figs. Wiesbaden.
Lampert, K. 1886. Die Holothurien von Siid-Georgien. Jahrbuch der
Hamburgischen WissenschaftlichenAnstalten3\ 10-22, 1 pi.
Lesson, R. P. 1830. Centurie Zoologique on Choix D’animaux Rares,
Nouveaux ou Imparfaitement Connus. Levrault, Paris. 244 pp.,
80 pis.
Liao, Y. and Clark, A. M. 1995. The Echinoderms of Southern China.
614 pp., 338 figs, 23 pis. Science Press: Beijing and New York.
Ludwig, H. 1874 (1875). Beitrage zur Kenntniss der Holothurien.
Arbeiten aus dem Zoologisch-Zootomischen Institut in Wurzburg
2: 77-120, pis 6-7.
Ludwig, H. 1894. Reports on an exploration off the west coasts of
Mexico, Central and South America, and off the Galapagos
Islands, in charge of Alexander Agassiz, by the U.S. Fish
Commission steamer Albatross , during 1891. XII. The
Holothurioidea. Memoirs of the Museum of Comparative Zoology,
Harvard University 17(3): 1-183, pis 1-19.
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Ludwig, H. 1898. Holothurien. In: Ergebnisse der Hamburger
Magalhaensischen Sammelreise 1892/1893. Herausgegeben
Naturhistorischen Museum Hamburg 1. 98 pp., 3 pis.
Marenzellerv. E. 1874. Kritik adriatischer Holothurien. Verhandlungen
zoologisch-botanischen Gesellschaft in Wien 24: 299-320.
Marenzeller v. E. 1881. Neue Holothurien von Japan und China.
Verhandlungen zoologisch-botanischen Gesellschaft in Wien 31:
121-140, pis 4, 5.
Massin, C. and Hendrickx, M. E. 2011. Deep-water Holothuroidea
(Echinodermata) collected during the TALUD cruises off the
Pacific coast of Mexico, with the description of two new species.
Revista Mexicana de Biodiversidad 82: 413-443.
Michonneau, F. and Paulay, G. 2014. Revision of the genus Phyrella
(Holothuroidea: Dendrochirotida) with the description of a new
species from Guam. Zootaxa 3760(2): 101-140.
Moodley, M. N. 2008. A new dendrochirotld sea cucumber from the
west coast of South Africa (Echinodermata: Holothuroidea:
Cucumariidae). African Zoology 43(1): 61-65.
Mortensen, T. 1925a. Echinoderms of New Zealand and the Auckland-
Campbell Islands. III-V. Asteroidea, Holothurioidea, Crinoidea.
Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i
Kobenhavn 79: 261-420, text figs 1-70, pis 12-14.
Mortensen, T. 1925b. On a small collection of Echinoderms from the
Antarctic Sea. Arkiv for Zoologi. 17A 31: 1-12.
Ohshima, H. 1915. Report of the Holothurians collected by the United
States Fisheries Steamer Albatross in the Northwestern Pacific
during the summer of 1906. Proceedings United States National
Museum 48: 213-291, pis. 8-11.
O’Loughlin, P. M. 1994. Brood-protecting and fissiparous cucumariids
(Echinodermata, Holothurioidea). Pp. 539-547, 1 tbl., 6 figs in
David, B., Guille, A., Feral, J-P. and Roux, M. (eds). Echinoderms
through Time. Proceedings of the Eighth International Echinoderm
Conference, Dijon, France, 6-10 September, 1993. Balkema:
Rotterdam.
O’Loughlin, P. M. 2002. Report on selected species of BANZARE
and ANARE Holothuroidea, with reviews of Meseres Ludwig and
Heterocucumis Panning (Echinodermata). Memoirs of Museum
Victoria 59(2): 297-325.
O’Loughlin, P. M. 2009. BANZARE holothuroids (Echinodermata:
Holothuroidea). Zootaxa 2196: 1-18.
O’Loughlin, P. M. and Alcock, N. 2000. The New Zealand
Cucumariidae (Echinodermata: Holothuroidea). Memoirs of the
Museum of Victoria 58(1): 1-24, figs 1-6.
O’Loughlin, P. M., Eichler, J., Altoff, L., Falconer, A., Mackenzie, M.,
Whitfield, E. and Rowley, C. 2009a. Observations of reproductive
strategies for some dendrochirotid holothuroids (Echinodermata:
Holothuroidea: Dendrochirotida). Memoirs of Museum Victoria
66: 215-220.
O’Loughlin, P. M., Manjon-Cabeza, M. E. and Ruiz, F. M. 2009b.
Antarctic holothuroids from the Bellingshausen Sea, with
descriptions of new species (Echinodermata: Holothuroidea).
Zootaxa 2016: 1-16.
O’Loughlin, P. M., Paulay, G., Davey, N. and Michonneau, F. 2010.
The Antarctic region as a marine biodiversity hotspot for
echinoderms: Diversity and diversification of sea cucumbers.
Deep-Sea Research II 58 (2011): 264-275.
O’Loughlin, P. M., St^pien, A., Kuzniak, M., and VandenSpiegel, D.
2013. A new genus and four new species of sea cucumbers
(Echinodermata) from Admiralty Bay, King George Island.
Polish Polar Research 34(1): 67-86.
O’Loughlin, P. M. and VandenSpiegel, D. 2010. A revision of Antarctic
and some Indo-Pacific apodid sea cucumbers (Echinodermata:
Holothuroidea: Apodida). Memoirs of Museum Victoria 67: 61-95.
Four new species and a new genus of Antarctic sea cucumbers
O’Loughlin, P. M. and Whitfield, E. 2010. New species of Psolus Oken
from Antarctica (Echinodermata: Holothuroidea: Psolidae).
Zootaxa 2528: 61-68.
Panning, A. 1940. Dendrochirote Holothurien von Dakar.
Videnskabelige meddelelser fra Dansk naturhistorisk forening 104:
169-178.
Panning, A. 1949. Versuch einer Neuordnung der Familie Cucumariidae
(Holothurioidea, Dendrochirota). Zoologische Jahrbiicher
Abteilung fur Systematik, Okologie Geographie Tiere 78: 404-470.
Panning, A. 1951. liber Pseudocnus leoninus (Semper) und verwandte
Arten. Zoologische Anzeiger 146: 73-80.
Panning, A. 1957. Bemerkungen liber die holothurian familie
Cucumariidae (Ordnung Dendrochirota). 2. Die gattungen
Cladodactyla, Hemioedema und Psolidiella. Mitteilungen aus dem
Hamburgischen Zoologischen Museum und lnstitut 55: 25-38.
Panning, A. 1962. Bemerkungen fiber die holothurian familie
Cucumariidae (Ordnung Dendrochirota). 3. Die gattung
Pseudocnus Panning 1949. Mitteilungen aus dem Hamburgischen
Zoologischen Museum und lnstitut 60: 57-80.
Pawson, D. L. and Fell, H. B. 1965. A revised classification of the
dendrochirote holothurians. Breviora 214: 1-7. Museum
Comparative Zoology: Harvard.
Semper, C. 1868 (1867). Holothurien. Reisen im Archipel der
Philippinen 1: 1-288, pis 1-40.
Sluiter, C. P. 1910. Westindische Holothurien. Zoologische Jahrbiicher
Supplement 11(2): 331-342.
Smirnov, A. V. 2012. System of the class Holothuroidea.
Paleontological Journal 46 (8): 793-832.
Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S.
2013. MEGA6: Molecular Evolutionary Genetics Analysis
Version 6.0. Molecular Biology and Evolution 30: 2725-2729.
Thandar, A. S. 1987. The status of some southern African nominal
species of Cucumaria (s.e.) referable to a new genus and their
ecological isolation. South African Journal of Zoology 22(4):
287-296.
59
Thandar, A. S. 2008. Additions to the holothuroid fauna of the
southern African temperate faunistic provinces, with descriptions
of new species. Zootaxa 1697: 1-57.
Theel, H. 1886. Report on the Holothurioidea dredged by H.M.S.
Challenger during the years 1873-1876. Report on the scientific
results of the voyage of H.M.S. Challenger, Zoology 14 (39): 1-290,
16 pis.
Vaney, C. 1906. Deux nouvelles Holothuries du genre Thyone
provenant des Orcades du Sud. Bulletin du Museum d’Histoire
naturelle, Paris 12(6): 400-402.
Vaney, C. 1908a. Les Holothuries recueillies par l’Expedition
antarctique ecossaise. Zoologischer Anzeiger 33 (10): 290-299.
Vaney, C. 1908b. Les Holothuries de TExpedition Antarctique
National Ecossaise. Transactions of the Royal Society of Edinburg
6(1): 1-37, 5 pis.
Verrill, A. E. 1876a. Annelids and Echinoderms. Holothuroidea.
Pentactella g. n. Pp. 68-69 in Kidder, J. H. (ed.). Contributions to
the Natural History of Kerguelen Island. Harvard University
Herbarium.
Verrill, A. E. 1876b. Annelids and Echinoderms, and Anthozoa in
Contributions to the Natural History of Kerguelen Island. Bulletin
of the United States National Museum 3: 64-77.
Wells, H. 1924. New Species of Cucumaria from Monterey Bay
California. Annals of the Magazine of Natural History 9(14): 113—
121, 1 pi.
Won, J. H. and Rho, B. J. 1998. Two new species and four new records
of Holothuroidea from Korea. Korean Journal Biological Sciences
2: 9-20.
Wyville Thomson, C. 1878. Notice of some peculiarities in the mode
of propagation of certain echinoderms of the Southern Sea.
Journal of the Linnean Society of London (Zoology) 13: 55-79.
Yang, P. F. 1937. Report on the holothurians from the Fukien Coast.
Bulletin Marine Biology, Amoy, China 2: 1-46.
60
P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel
Appendix 1. List of species, tissue sample code numbers, specimen repositories, specimen registration numbers, and GenBank Accession numbers.
Genus
species
Sample number
Voucher
repository
Catalog
number
Location
GenBank
Accession
number
Heterocucumis
steineni
MOLN 195
NIWA
35396
Ross Sea
HM196616.1
Heterocucumis
steineni
MOLAF 0785
NHM
2010.125-130
Amundsen Sea
HM196617.1
Heterocucumis
steineni
MOLSI 043
USNM
1132662
Bransfield Strait
HM196618.1
Heterocucumis
steineni
MOLN 194
NIWA
36744
Ross Sea
HM196619.1
Heterocucumis
steineni
MOLN 196
NIWA
42196
Ross Sea
HM196620.1
Heterocucumis
steineni
MOLN 197
NIWA
35675
Ross Sea
HM196621.1
Heterocucumis
steineni
MOLAF 0786
NHM
2010.125-130
Amundsen Sea
HM196622.1
Heterocucumis
steineni
MOLG 107
NIWA
60846
Ross Sea
HM196623.1
Heterocucumis
steineni
MOLSI 065
USNM
1132677
Bransfield Strait
HM196624.1
Heterocucumis
steineni
MOLG 106
NIWA
60855
Ross Sea
HM196625.1
Heterocucumis
steineni
MOLSI 026
USNM
1132644
Bransfield Strait
HM196626.1
Heterocucumis
steineni
MOLAF 0784
NHM
2010.124
Amundsen Sea
HM196627.1
Heterocucumis
steineni
MOLSI 037
USNM
1132658
Bransfield Strait
HM196628.1
Heterocucumis
steineni
MOLSI 050
USNM
1132668
Bransfield Strait
HM196629.1
Heterocucumis
steineni
MOLSI 038
USNM
1132658
Bransfield Strait
HM196630.1
Staurocucumis
liouvillei
MOLAF 0541
NMV
F104802
South Georgia
HM196658.1
Staurocucumis
liouvillei
MOLN 172
NIWA
36028
Ross Sea
HM196659.1
Staurocucumis
liouvillei
MOLSI 035
USNM
1132656
Bransfield Strait
HM196660.1
Staurocucumis
liouvillei
MOLN 173
NIWA
42158
Ross Sea
HM196661.1
Staurocucumis
liouvillei
MOLAF 0700
NMV
F165748
Heard Island
HM196662.1
Staurocucumis
liouvillei
MOLAF 0537
NMV
F160028
Bouvet Island
HM196663.1
Staurocucumis
liouvillei
MOLAF 0788
NHM
2010.168-173
Amundsen Sea
HM196664.1
Staurocucumis
liouvillei
MOLN 174
NIWA
36562
Ross Sea
HM196665.1
Staurocucumis
liouvillei
MOLAF 0539
NMV
F104986
Bouvet Island
HM196666.1
Staurocucumis
liouvillei
MOLAF 0783
NHM
2010.158-163
Amundsen Sea
HM196667.1
Staurocucumis
liouvillei
MOLAF 0781
NHM
2010.158-163
Amundsen Sea
HM196668.1
Staurocucumis
liouvillei
MOLAF 0787
NHM
2010.168-173
Amundsen Sea
HM196669.1
Staurocucumis
liouvillei
MOLAF 0540
NMV
F104800
Falkland Islands
HM196670.1
Staurocucumis
liouvillei
MOLN 175
NIWA
36904
Ross Sea
HM196671.1
Staurocucumis
krzysztofi
MOLSI 056
USNM
1132671
Bransfield Strait
HM196672.1
Staurocucumis
krzysztofi
MOLSI 057
USNM
1132671
Bransfield Strait
HM196673.1
Staurocucumis
krzysztofi
MOLSI 048
USNM
1132667
South Shetlands
HM196674.1
Crucella
hystrix
MOLAF 0793
NHM
2010.118
Amundsen Sea
HM196710.1
Crucella
hystrix
MOLN 170
NIWA
38641
Ross Sea
HM196711.1
Crucella
hystrix
MOLN 169
NIWA
42202
Ross Sea
HM196712.1
Crucella
hystrix
MOLN 171
NIWA
37784
Ross Sea
HM196713.1
Paracucumis
turricata
MOLAF 0791
NHM
2010.156
Amundsen Sea
HM196714.1
Paracucumis
turricata
MOLN 201
NIWA
36025
Ross Sea
HM196715.1
Paracucumis
turricata
MOLAF 0792
NHM
2010.157
Amundsen Sea
HM196716.1
Paracucumis
turricata
MOLN 200
NIWA
36490
Ross Sea
HM196717.1
Paracucumis
turricata
MOLN 202
NIWA
36007
Ross Sea
HM196718.1
Crucella
susannae
MOLSI 068
USNM
1132679
Bransfield Strait
HM196719.1
Crucella
scotiae
MOLG 098
NIWA
60742
Ross Sea
HM196720.1
Crucella
scotiae
MOLN 192
NIWA
36602
Ross Sea
HM196721.1
Crucella
scotiae
MOLG_097
NIWA
60730
Ross Sea
HM196722.1
Four new species and a new genus of Antarctic sea cucumbers
61
Crucella
scotiae
MOLG 099
NIWA
60732
Ross Sea
HM196723.1
Psolidium
tenue
MOLAF 0709
NHM
2010.151
Amundsen Sea
HM196735.1
Abyssocucumis
abyssorum
MOLN 141a
NIWA
37727
Ross Sea
KP165441
Abyssocucumis
abyssorum
MOLN 141b
NIWA
37727
Ross Sea
KP165442
Abyssocucumis
abyssorum
MOLN 142
NIWA
38038
Ross Sea
KP165443
Abyssocucumis
abyssorum
MOLN 143
NIWA
38033
Ross Sea
KP165444
Cladodactyla
crocea
MOLAF 0501
NMV
F105017
Falkland Islands
KP165445
Cladodactyla
crocea
MOLAF 0502
NMV
F105017
Falkland Islands
KP165446
Cladodactyla
crocea
MOLAF 0503
NMV
F105002
Falkland Islands
KP165447
Cladodactyla
crocea
MOLAF 0504
NMV
F106967
Falkland Islands
KP165448
Cladodactyla
sicinski
MOLAF 1298
NMV
F193766
South Shetlands
KP165449
Cladodactyla
sicinski
MOLAF 1300
NMV
F193772
South Shetlands
KP165450
Crucella
hystrix
BASEC134-09
NHMUK
2010.118
Amundsen Sea
KP165451
Crucella
susannae
MOLAF 1293
NMV
F193784
South Shetlands
KP165452
Heterocucumis
denticulata
MOLG 101
NIWA
60822
Ross Sea
KP165453
Heterocucumis
denticulata
MOLG 102
NIWA
60824
Ross Sea
KP165454
Heterocucumis
denticulata
MOLG 103
NIWA
60794
Ross Sea
KP165455
Heterocucumis
denticulata
MOLG 104
NIWA
60784
Ross Sea
KP165456
Heterocucumis
denticulata
MOLG 105
NIWA
60799
Ross Sea
KP165457
Heterocucumis
denticulata
MOLN 163
NIWA
42174
Ross Sea
KP165458
Heterocucumis
denticulata
MOLN 164
NIWA
35932
Ross Sea
KP165459
Heterocucumis
steineni
BASEC079-09
NHMUK
2010.124
Amundsen Sea
KP165462
Heterocucumis
steineni
MOLAF 0874
NMV
F169300
South Orkneys
KP165461
Heterocucumis
steineni
MOLAF 1243
AADBRC
525
Prydz Bay
KP165460
Laevocnus
katrinae
MOLAF 0815
NMV
F168836
Falkland Islands
KP165463
Laevocnus
laevigatus
MOLAF 0670
NMV
F165738
Heard Island
KP165464
Laevocnus
laevigatus
NDMQ 11
NIWA
40109
Macquarie Seamount
KP165465
Laevocnus
laevigatus
NDMQ 12
NIWA
40205
Macquarie Seamount
KP165466
Laevocnus
leachmani
MOLN 182
NIWA
42203
Ross Sea
KP165467
Laevocnus
leoninus
MOLAF 0507
NMV
F104820
Falkland Islands
KP165468
Laevocnus
leoninus
MOLAF 0508
NMV
F106960
Falkland Islands
KP165469
Laevocnus
leoninus
MOLAF 0509
NMV
F106962
Falkland Islands
KP165470
Laevocnus
leoninus
MOLAF 0510
NMV
F161500
Falkland Islands
KP165471
Laevocnus
perrieri
MOLAF 0511
NMV
F106964
Falkland Islands
KP165472
Laevocnus
perrieri
MOLAF 0512
NMV
F104844
Falkland Islands
KP165473
Laevocnus
perrieri
MOLAF 0514
NMV
F104844
Falkland Islands
KP165474
Laevocnus
serratus
MOLAF 0683
NMV
F165742
Heard Island
KP165475
Paracucumis
turricata
BASEC120-09
NHMUK
2010.157
Amundsen Sea
KP165477
Paracucumis
turricata
MOLAF 0891
NMV
F169314
South Orkneys
KP165476
Staurocucumis
krzysztofi
MOLSI 064
USNM
1132676
Bransfield Strait
KP165478
Staurocucumis
liouvillei
MOLAF 1247
AAD BRC
512
Prydz Bay
KP165479
Staurocucumis
liouvillei
MOLAF 1248
AAD BRC
513
Prydz Bay
KP165480
Staurocucumis
liouvillei
MOLAF 1249
AAD BRC
524
Prydz Bay
KP165481
Staurocucumis
nocturna
MOLAF 0399
NMV
F149749
NW Australia
KP165482
Staurocucumis
nocturna
MOLAF 0400
NMV
F151833
NW Australia
KP165483
Staurocucumis
species
MOLAF 0872
NMV
F169307
South Orkneys
KP165484
Staurocucumis
turqueti
MOLG 055
NIWA
61055
Ross Sea
KP165485
Staurocucumis
turqueti
MOLN 198
NIWA
35782
Ross Sea
KP165486
Staurocucumis
turqueti
MOLN_199
NIWA
42169
Ross Sea
KP165487
Memoirs of Museum Victoria 72:63-72 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from
Victoria, Australia.
Francis C. Holmes
Honorary Associate, Invertebrate Palaeontology, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia;
and 15 Kenbry Road, Heathmont, Victoria 3135, Australia (fholmes@bigpond.net.au).
Abstract Holmes, F.C. 2014. A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from Victoria, Australia.
Memoirs of Museum Victoria 72: 63-72.
An unlabelled group of irregular echinoids, donated to Museum Victoria, are identified as Maretia sp. aff. planulata
(Lamarck, 1816) and their place of origin determined as the late Miocene Tambo River Formation at Swan Reach, East
Gippsland. A comparison with the three extant species of the genus, M. planulata (Lamarck, 1816), M. carinata Bolau,
1873, and M? cordata Mortensen, 1948, show Maretia sp. aff. planulata has a fair degree of similarity with the type
species M. planulata. Because of this, and the lack of detail of certain diagnostic features on the specimens, the description
has been left in open nomenclature. The fossil record of Maretia, currently considered to occur only within the Indo-
Pacific region, is also listed and discussed.
Keywords Echinoidea, Spatangoida, Maretia, late Miocene, Australia.
Introduction
While searching through a large collection of invertebrate
fossils donated to Museum Victoria by F. A. Cudmore between
1924 and 1950, an unlabelled box of irregular echinoids was
noticed amongst material from the Glenelg River area of
Western Victoria. The colour and composition of the attached
matrix on the echinoids, as well as the type of preservation,
immediately raised doubts as to their actual origin.
Examination of the specimens suggested that they belong
to Maretia, a genus not previously recorded in the fossil record
of Australia. Determining their place of origin thus rested on
identification of the attached matrix, which contains small
grains of glauconite. While this mineral is not uncommon in
sediments containing fossil echinoids, its Australian presence
in granular form is recorded from only one area, the Tambo
River Formation in East Gippsland, Victoria.
A further search of the Cudmore Collection revealed a
small assortment of fossils labelled as coming from Swan
Reach, Victoria, the stratotype section for the above Tambo
River Formation (fig.l). The matrix with these fossils, and a
few fragments of associated echinoid tests, clearly matched
the unlabelled specimens. Further support for the origin of the
echinoids was provided by the presence in each group of
fossils of a specimen of the brachiopod Frenulina pumila
(Tate, 1899), the type locality of which is Swan Reach
(Richardson, 1973).
Materials and methods
The specimens are housed in the Invertebrate Palaeontology
Collection, Museum Victoria (NMV). Where meaningful
measurements where possible they were made with a dial
calliper to an accuracy of 0.1 mm. Parameters are expressed as
a percentage of test length (%TL).
Age and stratigraphy
The Tambo River Formation is late Miocene (Mitchellian,
Tortonian-Messinian) in age, lying within International
planktonic foraminiferal zones N16-N17. The section of the
formation at Swan Reach, from which the specimens of
Maretia are believed to have come, consists of six metres of
fine orange-brown fine marly limestone containing
numerous small grains of glauconite, with scattered bivalves
and burrowed horizons occurring between discontinuous
nodular cemented horizons. The presence of abundant
bolivinids and other infaunal elements as well as the marly
nature of the unit suggest a low energy palaeoenvironment,
the coastal areas of the Formation representing transitional
beds between the underlying middle Miocene Bairnsdale
Limestone and the overlying late Miocene-Pliocene Jemmys
Point Formation (Gallager and Holdgate, 1996, and papers
cited therein). Strontium isotope dating of shells near the top
of the Swan Reach road cutting have returned dates of
6.0 Ma (Dickinson, 2002).
64
F.C. Holmes
Associated Fauna
Apart from the specimens of Maretia sp. aff. planulata, the
only echinoids recorded from the Tambo River Formation are
spines of Goniocidaris murrayensis Chapman and Cudmore,
1934, and Phylacanthus clarki clarki (Chapman and Cudmore,
1934); the latter identified by Crespin (1943) as Phylacanthus
duncani Chapman and Cudmore, 1934.
The rarity of echinoids is unusual, considering the
presumed low energy depositional environment of the
formation and the abundance of Clypeaster gippslandicus
M c Coy, 1879, in the underlying Bairnsdale Limestone and of
Fellaster insisa (Tate, 1893) in the overlying Jemmys Point
Formation. However, the lack of any previous record of
echinoids, other than spines, may simply be due to the paucity
of surface exposures.
Systematic palaeontology
Order Spatangoida L. Agassiz, 1840
Family Maretiidae Lambert, 1905
Remarks. According to Smith and Kroh (2011) the family
includes fourteen genera, three of them assigned with question:
Araeolampasl, Eupatagus, Granobrissoides, Gymnopatagus,
Hemimaretia, Homolampas, Maretia, Marianial, Mazettia,
Murraypneustes, Nacospatangus, Pycnolampas, Spatagobrissus
and Tripatagusl
Excluding the reference to Eupatagus, which is now referred
to the family Eupatagidae Lambert, 1905 (Kroh, 2014a),
Maretia differs from other genera in the family by a combination
of four primary features: lack of a peripetalous fasciole, sternal
plates with small tubercules only in the posterior half, four
gonopores, and the absence of a prominent sulcus.
Genus Maretia Gray, 1855
Type species. Spatangus planulata Lamarck, 1816, by original
designation.
Other species (listed by Smith and Kroh, 2011). Maretia carinata
Bolau, 1873, M.? cordata Mortensen, 1948, M.l tuberculata Agassiz
and Clark, 1907, M. sp. of Henderson (1975), M? subrostrata (Clark,
1915), and M.? aequipetala (Gregory, 1891).
Diagnosis. (Modified from Smith and Kroh, 2011). Test
moderate in size, ovate tapering posteriorly, with or without
slight anterior depression, weakly arched to depressed in
profile, oral surface flat except for low posterior keel; ambitus
low and moderately sharp. Apical disk slightly anterior of
centre, ethmolytic with 4 gonopores, genital plate 2 projecting
far to the posterior of posterior oculars. Anterior ambulacrum
narrow and flush adapically, pore-pairs small, isopores simple.
Other ambulacra petaloid and flush. Anterior paired petals
bowed, with adapical pore-pairs in anterior column
rudimentary; remainder large and semi-conjugate. Posterior
petals bowed to lanceolate, converging distally. Periproct on
short steeply undercut truncate face; peristome wider than
long, kidney-shaped, with adoral ambulacra forming a distinct
phyllode. Labral plate narrow and elongate, just contacting
sternal plates adjacent to the posterior half of adjoining third
ambulacral plates; paired sternal plates narrow and triangular
with tuberculation confined to the posterior. Aboral
tuberculation heterogenous, with scattered sunken primary
tubercules on interambulacra 1-4 varying markedly in density
and generally missing in interambulacrum 5. On oral surface
lateral tubercles arranged in distinct rows with slightly sunken
areoles and spiral parapet. Subanal fasciole shield shaped, and
generally well developed.
Remarks. According to Mortensen (1951: 26), in the previous
100 or so years no less than 40 fossil species, ranging in age
from Eocene to Recent, have been assigned to Maretia or
Hemipatagus’, the two at times being considered synonymous.
Most of the confusion in separating the two genera has been
rectified by Kroh (2007) who listed species of Hemipatagus,
Maretia, and presumed related spatangoids, accompanied by
details of synonymy, type species and locality, and occurrence
and age. Based on this information and cladistic analysis of
specimens, the suggested taxonomic placement of these species
was discussed in detail.
However, the seven species of Maretia listed by Smith and
Kroh (2011) include four assigned to the genus with question:
M.l cordata, because of it’s prominent cordate outline and
distinct anterior sulcus; M.l tuberculata, considered a juvenile
specimen possibly assignable to Lovenia’, M.l subrostrata, a
species containing many features in common with
Hemipatagus’, and M.l aequipetala, because the type material
is too poorly preserved for a positive identification. Of the
remaining three species, even the illustrations of M. sp. from
New Zealand suggest it is most likely related to M.l cordata.
Maretia sp. aff. planulata (Lamarck, 1816)
Figures 2A-F, 3A-H, Table 1
Material. Specimens NMV P324331-P324338 from the stratotype
locality of the late Miocene Tambo River Formation (Mitchellian,
Tortonian-Messinian) at Swan Reach, Victoria [NMV locality
PL3110]. A quantity of disarticulated plates together with a sample of
matrix found with these specimens are numbered NMV P322439.
Description. Test ovate to sub-pentagonal tapering to a semi-
truncated posterior margin, slightly flattened adjacent to
anterior depression, and weakly arched adapically with apex
approximately central; margins rounded. Interambulacrum 5
mildly raised on the aboral surface at the interradial suture, and
on the adoral surface swollen to form a posterior keel. Length
of specimens range from 50-55 mm with width varying from
78-88%TL. Apical system showing 4 gonopores partially
preserved on only one specimen (fig.3A); no detail of plate
structure or hydropores can be discerned. Centre of apical disk
40-43.5%TL from anterior ambitus.
Anterior ambulacrum III, narrow and flush aborally,
slightly depressed at ambitus and on adoral surface; no detail
of pores. Anterior paired petals quite indistinct and possibly
rudimentary but, based on ambulacrual plate suture, appear
flush, straight sided, narrow and with maximum width only
3/5 that of posterior pair; detail of pores and tuberculation too
poorly preserved to describe. Posterior paired petals,
A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from Victoria, Australia.
65
Table 1. Comparison of diagnostic features of the late Miocene Maretia sp. aff. planulata (Lamarck, 1816) from Swan Reach, Victoria, with the
extant Maretia planulata (Lamarck, 1815), based on specimens from the Philippines, and M. carinata Bolau, 1873, and M. cordata Mortensen,
1948, based on descriptions in Mortensen (1951) and Schultz (2005 and 2009).
Diagnostic
feature
Maretia planulata
(Lamarck)
Maretia carinata Bolau
Maretia cordata
Mortensen
Maretia sp. aff.
planulata (Lamarck)
Test shape
Ovate, with or without slight
anterior depression, flattened or
low arched adapically. Plaston
and adjacent anbulacra form
distinct keel posteriorly. Margin
rather sharp.
Ovate with mere trace of
anterior depression, high
arched with posterior surface
of interamb. 5 raised to form
prominent keel on aboral
surface. Margin rounded.
Generally smaller, broader
and distinctly cordate.
Anterior depression wider
and deeper. Adapical
surface low arched.
Basically ovate with
moderate anterior
depression, low arched
adapically, both aboral and
adoral surface of interamb.
5 swollen posteriorly.
Margin more rounded.
Width as %
test length
Av. 82.7%TL (based on 3 extant
specimens).
Approx 85%TL (based on
published figures).
Over 90%TL (based on
published figures).
Approx 85%TL (based on 4
specimens).
Apical
system
Approx. 40%TL from anterior
ambitus, ethmolytic, with 4
gonopores and genital plate 2
extending to rear of oculars 4
and 5.
Approx. 38.5% TLfrom
anterior ambitus, otherwise as
forM planulata (generic
feature)
Approx. 43.5% TL from
anterior ambitus,
otherwise as for M.
planulata (generic feature)
Approx. 41.5%TLfrom
anterior ambitus. Only
partially preserved on one
specimen which appears to
shows 4 gonopores.
Anterior
ambulacrum
Narrow, flush, or slightly
depressed at anterior ambitus.
Pore pairs small to rudimentary
in single longitudinal column.
No specific information
Plates longer and fewer
than M. planulata and
sunken towards frontal
depression.
Appears as for M. planulata
based on what little
preservation occurs on
specimens.
Anterior
paired petals
Straight, wide, lanceolate, distal
end nearly closed. Rudimentary
pore-pairs in anterior column
adapically for about 1/3 length.
Well-formed, shorter, with
corresponding reduction in
number of pore-pairs
compared to M. planulata of
similar size.
Distinctly broader,
pore-pairs fewer
compared to M. planulata
of similar size. In anterior
column only 4 plates have
rudimentary or no
pore-pairs proximally.
Preservation very poor in all
specimens, however they
appear fairly rudimentary,
much narrower, straight
sided and more obtuse than
M. planulata.
Posterior
paired petals
Longer and broader than anterior
pair, straight or slightly
S-shaped,
Well-formed, shorter and
broader than M. planulata.
More like M. carinata
than M.. planulata..
Marginally shorter and not
as broad as M. planulata
Petals
generally
Inter pore zone wide, slightly
raised and covered with varying
sized tubercles. Pairs not strictly
conjugate.
Similar to M. planulata.
Inter pore zone not raised
and sculpture between
pore-pairs more elaborate
than in M. planulata.
Pore zones contain more
miliary granules; otherwise
similar to M. planulata.
Periproct
Longer than wide with both ends
distinctly pointed, situated in
mildly concave, short, steeply
undercut face.
Posterior face only mildly
undercut and slightly
concave. More like M.
cordata than M. planulata..
About as long as wide and
nearly round. Posterior
margin rounded not
undercut.
Not well preserved on any
specimen but appears to be
similar to M. planulata.
Peristome
Reniform, wider than long and
sunken, but only in relation to
raised projecting labrum.
Groups of small tubercules
occur around the peristome at
junction of interambs 1-4.
Published illustrations
suggest projection of labrum
not as prominent.
Not strictly reniform,
more rounded pentagonal
in shape, no projection of
labrum.
Preservation poor but raised
projecting labrum suggests
similarity to M. planulata.
Small tubercules at junction
of interanb’s and peristome
also visible on most
specimens.
Phyllodes
Reasonably well developed,
lateral 8-10, anterior 6.
Less developed than M.
planulata
Longer and broader than
M. planulata.
Poorly preserved - most
plates missing or weathered.
66
F.C. Holmes
Diagnostic
feature
Maretia planulata
(Lamarck)
Maretia carinata Bolau
Maretia cordata
Mortensen
Maretia sp. aff.
planulata (Lamarck)
Labrum
Narrow, very elongated,
contacting sternal plates near
posterior end of adjacent 3rd
ambulacral plates. Anterior edge
forms prominent lip above
peristome.
Relatively broad, extending
just posterior to centre of
adjoining 3rd ambulacral
plates. Anterior edge slightly
curved at junction with
peristome.
Narrower, marginally
broader mid length. No
projection at junction with
peristome; otherwise
similar to M. planulata.
Similar to M. planulata..
Sternal
plates
Paired, long, narrow and
triangular. Posterior 35-45%
covered with small tubercles.
Paired but broader and
conspicuously raised
compared with M. planulata.
Paired, shorter & wider
than M. planulata.
Similar to M. planulata.
Episternal
plates
Tuberculated and sharply
undercut by marked increase in
width of plate 6 of adjoining
ambulacra.
As M. planulata (familial
feature)
As M. planulata (familial
feature)
Assumed similar, but not
clearly defined due to
cracking across plates.
Subanal
fasciole
Outline reniform, continuous
below periproct, rising adorally
over ambulacral plates 6-9 and
across epistemals.
Details of subanal fasciole do
not appear to have been
recorded.
Generally well developed
but recorded as sometimes
rather indistinct, posterior
side straight, not
re-entrant.
Extent indeterminate due to
poor preservation of test.
Only two specimens show a
small section of fasciole,
one of which is re-entrant.
Primary
tubercules
Perforate, crenulate, areoles
moderately sunken,
heterogeneous on aboral surface
except on interamb. 5 which has
only a few small tubercles.
Margin, including plates
adjacent periproct, covered with
closely spaced small tubercules
increasing in size adorally in
interambs 1 & 4 to form
radiating rows of very closely
spaced primaries with ear
shaped areoles.
Primary aboral tubercules
somewhat less numerous than
in M. planulata specimens of
similar size .Tubercules on
aboral surface of
interambulacrum 5 fairly
large but not considered
primary.
Primary aboral tubercules
similar in density to M.
planulata specimens of
similar size but in larger
specimens interamb. 5
contains a number of large
tubercles.
Generally as for M.
planulata but with primary
aboral tubercules on
interambs 1 & 4 somewhat
less numerous (as in M.
carinata ) and with some
large tubercles in interamb.
5 of size similar to those in
interambs 1-4. Adoral
primary tubercles
considerably more widely
spaced.
lanceolate, closing distally, wider and longer than anterior
pair, pores eye shaped, outer and inner appear to be similar in
size, not strictly conjugate but each side of plate sutures
between pairs angularly sunken. Interporiferous zone covered
with randomly placed small tubercles and numerous miliary
granules, the latter extending across the pore zones (fig. 2F).
Periproct longer than wide situated on steep undercut
truncate face, exact shape indistinct. Peristome also poorly
preserved in all specimens but clearly wider than long with
convex anterior lip of labrum overhanging posterior side.
Phyllodes and groups of small tubercules at termination of
interambulacra with peristome partially visible on some
specimens (fig. 3B).
Labrum narrow and very elongate, just contacting sternal
plates adjacent posterior end of adjoining third ambulacral
plates, and with a number of small tubercles on anterior lip,
similar to those at end of adoral interambulcra (fig. 3D,E).
Sternal plates paired, long, narrow and triangular, extending
to posterior end of adjoining fifth ambulacral plates. The
posterior ends of the plates are covered with small tubercles
for 40-45% of their length and possess a ventral apex at the
centre just anterior of the posterior sutures (fig. 2E). Episternal
plates, covered with small tubercles, are probably triangular
and undercut by re-entrant sixth ambulacral plates; junction
with sub-anal plates indeterminate. Due to extensive posterior
damage, the subanal fasciole is partially visible on only two
specimens; a small indistinct section crossing the episternal
plates (fig. 3G), and a re-entrant section adjoining the periproct
(fig. 3H).
Heterogeneous, moderately spaced, perforate and
crenulate, primary tubercles with sunken areoles as well as
occasional small tubercles occur on the aboral surface of
interambulacra 1-4 (fig. 3C). Several small tubercles and a few
primaries, the latter generally towards the posterior ambitus,
occur on interambulacrum 5. Small closely spaced tubercules
immediately below the ambitus in ambulacra 1-4 increase in
A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from Victoria, Australia.
67
Figure 1. A, B, general location maps; C, map of East Gippsland, Victoria, from Bairnsdale to Lakes Entrance, showing locality NMV PL3110
at Swan Reach.
size but reduce in quantity adorally to form distinct radiating
rows of primary tubercles. Plates surrounding the periproct
are also covered with small tubercles.
Remarks. All specimens are to some degree deformed, often
incomplete, with some of the plates cracked and their sutures
opened up. Nevertheless it is possible to compare individual
features of the specimens with those of the three extant species of
Maretia: M. planulata, M. carinata, and M.l cordata (Table 1).
Apart from primary generic characteristics present in all
four species compared in the table, approximately 70 percent of
the listed diagnostic features are common to both M. sp. aff.
planulata and the type species M. planulata. Comparison with
M. carinata is more difficult to summarise as two important
diagnostic features that distinguish it from M. planulata , the
number of pore pairs in paired petals and the development of
the phyllodes, are not preserved in the fossil specimens.
Excluding the generic characteristics and these latter features,
M. sp. aff. planulata has only about 30 percent of its diagnostic
characteristics in common with M. carinata. Similarity
between M. sp. aff. planulata and M.l cordata is quite minimal.
In descriptions of Maretia species, the density of tubercles
on parts of the test has been used as a diagnostic feature;
particularly the density of primary tubercles on aboral
interambulacra 1-4. However, based on the extant specimen
from the Philippines (fig. 2G) and numerous published
photographs of M. planulata (e.g. Mortensen, 1951; Fisher,
1966; Schultz, 2005; Kroh, 2007; Smith and Kroh, 2011), there
appears to be considerable variation in density and arrangement
of these tubercles, making comparison of this feature between
species of the genus, somewhat tenuous.
Fossil record of Maretia
Extant species of Maretia, principally M. planulata, are
currently considered to occur in two distinct Indo-Pacific
marine zones:
1. East Africa, from Mozambique north to Egypt and Saudi
Arabia on the Red Sea; and the western Indian Ocean Islands,
particularly Madagascar, Mauritius and the Seychelles.
2. From southern India and Sri Lanka, eastwards across the
Indo-Malayan Archipelago, Indonesia, the Philippines, Papua
New Guinea, north and east Australia, and the western Pacific
Islands from Japan in the north to Fiji and New Caledonia in
the south, and as far east as Hawaii.
The fossil record of species, currently assigned to the genus, is
consistent with the present-day distribution of extant forms,
with one exception, but is restricted to less than a dozen
specific localities (fig.4).
East Africa. M. ovata (Leske, 1778) from three localities
in the Pliocene Zanzibar Series, Zanzibar (Unguja) Island,
F.C. Holmes
Figure 2. Maretia sp. aff. planulata (Lamarck, 1816): A-C, adapical, adoral, left lateral and posterior views of NMV P324333; D, E, adapical and
adoral views, and F, aboral ambulacrum V detail of NMV P324332, both specimens from the late Miocene, Tambo River Formation, Swan
Reach, Victoria. G-I, adapical, adoral, left lateral and posterior views of extant specimen of Maretia planulata from the Philippines. Scale bar
10 mm unless otherwise stated.
A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from Victoria, Australia.
69
Figure 3. Maretia sp. aff. planulata (Lamarck, 1816): A, adapical view of NMV P324337 recording presence of four gonopores; B, partial adoral
view of NMV P324338 showing phyllodes and small tubercules at termination of interambulacra with peristome; C, partial adapical view of
NMV P324332 showing interambulacra 1 and ambulacrun I and II; D, E, adoral view and labrum detail of NMV P324336; F, adapical view of
NMV P324331; G, partial adoral view of NMV P324332 showing an indistinct section of subanal fasciole crossing episternal plates; H, partial
posterior view of NMV P324333 with re-entrant section of subanal fasciole adjoining the periproct. Specimens from the late Miocene, Tambo
River Formation, Swan Reach, Victoria. Scale bar 10 mm unless otherwise stated.
Tanzania (Stockley, 1927: 117). However, Eames and Kent
(1955: 342) revised the age of these Pliocene deposits to early
Miocene, and in a footnote state “Comparison, in the British
Museum Natural History, of the Zanzibar Lower Miocene
Clypeaster, Maretia and temnopleurids with recent material
indicates that they are not attributable to the species to which
they have been assigned.” The Tanzanian fossil specimens of
Maretia assigned to the taxon M. ovata (Leske) by Stockley, is
almost certainly the result of Spatangus planulatus Lamarck,
1816, being synonymised with Spatangus ovatus Leske, 1778
(H.L.Clark 1917: 248 and 1925: 226). Mortensen (1951: 37)
recounts in considerable detail the history of this synonymy,
clearly stating that there is no real foundation for any change;
the figures and description of Spatangus ovatus being poor
and of unknown affinity. The taxon is now cited in the World
Register of Marine Species (Kroh, 2014b) as Maretia ovata
H.L.Clark, 1917; a subjective junior synonym of M. planulata
(Lamark, 1816).
Red Sea. M. ovata (Leske) from four localities in the
Pliocene basal beds of the Marly Limestone Series, Farsan
Islands, Saudi Arabia (Brighton, 1931: 332). In referring to the
specimens as M. ovata (Leske), Brighton appears to have
followed the synonymy in Stockley (1927) without question.
Red Sea. M. planulata abbassi, Ali, 1985: 294, a new sub¬
species from the lower Pliocene of Wadi Abu Abraiki, Egypt,
based primarily on differences in the aboral ambulacra.
However, no reference was made to the sternal plates having a
distinct contact with adjoining ambulacral plates 6a and 6b, as
70
F.C. Holmes
shown on the oral view of the holotype. This feature is unusual,
as contact of these latter plates is normally with the episternals.
As only the holotype is recorded, it is not possible to determine
if this feature is simply an anomaly.
India. M. ranjitpurensis Jain, 2002: 130, a questionable
species from the Raj Formation (? Burdigalian), Kathiawar,
Gajarat, western India. Described from eight specimens, it
differs from M planulata only in the far smaller number of
aboral primary tubercles and the wider angle of the anterior
paired ambulacra. It appears to be the first record of the genus,
either fossil or extant, from the area that separates the two
distinct marine zones referred to above; the State of Gajarat
bordering Pakistan.
Indonesia. Spatangus praelongus Herklots, 1854: 11, a
species from the Miocene of Tjidamar, western Java.
Subsequent authors considered this species synonymous with
M. planulata and of Pliocene age (Mortensen 1951: 37).
Papua New Guinea. M. planulata (Lamarck, 1816), a partial
test from the lower Pliocene Kairuku Formation, Yule Island,
Central Province (Lindley, 2003: 160). Also recorded were two
specimens of M. cordata from the same general location.
South Sea Islands. M. planulata (Lamarck, 1816), a single
internal mould from the Pleistocene Younger Angaur
Limestone of Angaur Island, Palao Island Group, Micronesia
(Nisiyama, 1968: 205).
New Zealand. Maretia sp. of Henderson (1975: 33). Two
partially preserved specimens from the upper Miocene
(Kapitean) of Tawhiti Hill, north Tokomaru Bay, east coast of
North Island.
United Kingdom. Agassizia aequipetala Gregory, 1891:
39, from the Pliocene Coralline Crag, Aldborough, Suffolk.
Although this has been tentatively assigned to Maretia
(Sullivan, 2007), it’s origin, and the information on which this
identification was made are considered inadequate for it to be
included in the currently accepted distribution of both fossil
and extant species of Maretia.
The earliest occurrence of Maretia, considered to be in the
Pliocene (Kroh, 2007: 173), needs to be revised to take account
of the late Miocene record of M. sp. aff. planulata from the
Tambo River Formation. However, the early to middle Miocene
age given for the Indian specimens from the Raj Formation and
the revision of the age of the Zanzibar Series specimens from
Pliocene to early Miocene, if correct, would extend the known
range of the genus further back in time by several million years.
Because of poor preservation and general lack of detail in
many of the above fossils, and the possibility that there may be
A late Miocene record of the echinoid Maretia (Echinoidea, Spatangoida) from Victoria, Australia.
71
differences in both fossil and extant populations of M. planulata
between the two distinct marine zones in the Indo-Pacific region,
description of the specimens from the Tambo River Formation
has been left in open nomenclature. Features common to both M.
planulata and M. carinata (Table 1) are those most likely to be
preserved in older fossil specimens, often making specific
identification problematical. Currently, extant specimens of both
of these species are found from the Indo-Malayan Archipelago
to the western Pacific Islands, and include the north Queensland
coast of Australia (Cannon et al., 1987).
Acknowledgements
I am indebted to David Holloway (Invertebrate Palaeontology,
Museum Victoria) for valuable advice and support during the
preparation of this manuscript. Museum Victoria Library staff
and Rich Mooi (California Academy of Sciences) for assisting
with references, and Stuart Mills (Mineralogy and Petrology,
Museum Victoria) for identification of the glauconite granules.
I also thank Ashley Miskelly (Kurrajong, N.S.W.) for providing
extant specimens for comparative purposes.
References
Agassiz, L. 1840. Catalogus systematicus Ectyporum
Echinodermatum fossilium Musei Neocomiensis, secundum
ordinem zoologicum dispositus; adjectis synonymis recentioribus,
nec non stratis et locis in quibus reperiuntur. Sequuntur
characteres diagnostici generum novorum vel minus cognitorum.
Petitpierre: Neuchatel. 20 pp.
Agassiz, A. and Clark, H.L. 1907. Preliminary report on the Echini
collected 1906, from May to December among the Aleutian
islands, in Bering Sea, and along the coasts of Kamchatka,
Sakhalin, Korea, and Japan, by U. S. Fish Commission steamer
Albatross, in charge of Lieutenant-Commander L. M. Garrett, U.
S. N. commanding. Bulletin of the Museum of Comparative
Zoology at Harvard College 51(3): 107-39.
Ali, M.S.M., 1985. On some Pliocene echinoids from the area north of
Mersa Alam, Red Sea coast, Egypt. Palaontologische Zeitschrift
59: 277-300.
Bolau, H. 1873. Die Spatangiden des Hamburger Museums
Naturwissenschaftlicher Verein Hamburg, Abhandlungen aus
dem Gebiete der Naturwissenschaften 5(4): 1-23, 1 pi.
Brighton, A.B. 1931. The geology of the Farsan Islands, Gizan and
Kamaran Island, Red Sea. Part 3. Echinoidea. Geological
Magazine 68: 323-333.
Cannon, L.R.G., Goeden, G.B. and Campbell, P. 1987. Community
patterns revealed by trawling in the inter-reef regions of the Great
Barrier Reef. Memoirs of the Queensland Museum 25(1): 45-70.
Chapman, F. and Cudmore, F.A. 1934. The Cainozoic Cidaridae of
Australia. Memoirs of the National Museum of Melbourne 8:
126-149, pis 12-15.
Clark, W.B. 1915. Eocene Echinodermata, Family Spatangidae. Pp.
150-156 in: The Mesozoic and Cenozoic Echinodermata of the
United States. Monograph of the United State Geological Survey
54: 1-341.
Clark, H.L. 1917. Hawaiian and other Pacific Echini, Echinoneidae,
Nucleolitidae, Urechinidae, Echinocorythidae, Calymnidae,
Pourtalesiidae, Palaestomatidae, Aeropsidae, Palaeopneustidae,
Hemiasteridae, and Spatangidae. Memoirs of the Museum of
Comparitive Zoology at Harvard College 46(2): 81-283, pis
144-161.
Clark, H.L. 1925. A Catalogue of the Recent Sea-Urchins (Echinoidea)
in the Collection of the British Museum (Natural History). Oxford
University Press: London, 250 pp.
Crespin, I. 1943. The stratigraphy of the Tertiary marine rocks in
Gippsland, Victoria. Commonwealth of Australia, Department of
Supply and Shipping Mineral Resources Survey, Palaeontological
Bulletin 4: 1-101 + forward, 8 figs, 5 tables.
Dickinson, J.A. 2002. Neogene tectonism and phosphogenesis across
the SE Australian margin. Unpublished Ph.D Thesis, University
of Melbourne: Melbourne. 229 pp.
Eames, F.E. and Kent, P.E. 1955. Miocene beds of the East African
Coast. Geological Magazine 92(4): 338-344.
Fisher, A.G. 1966. Spatangoids. Pp. U543-U628 in: Moore R.C. (ed),
Treatise on Invertebrate Paleontology, Part U Echinodermata 3(2).
Geological Society of America and University of Kansas Press.
Gallager, S. and Holdgate, G. 1996. Sequence stratigraphy and
biostratigraphy of the onshore Gippsland Basin, S. E. Australia.
Australian Sedimentologists Group Field Guide Series 11: viii +
70 pp. Geological Society of Australia Inc.: Sydney.
Gray, J. E. 1855. Catalogue of the Recent Echinida or Sea Eggs, in the
Collection of the British Museum. Part 1. Echinida Irregularia.
Woodfall & Kinder: London. 69 pp.
Gregory, J.W. 1891. A revision of the British Fossil Cainozoic
Echinoidea. Proceedings of the Geologists’ Association 12(1):
16-60, pis 1-2.
Henderson, R.A. 1975. Cenozoic spatangoid echinoids from New
Zealand. New Zealand Geological Survey Paleontological
Bulletin 46: 1-128.
Herklots, J.A. 1854. Fossiles de Java. Descriptions des restes fossiles
d’animaux des terrains Tertiares de L’lle de Java, recueillis sur
les lieux par M.F. Junghuhn, Pt IV. Echinodermes. E.J.Brill:
Leiden. 24 pp, 5 pis.
Jain, R.L. 2002. Echinoids from the Gaj Formation (early and middle
Miocene) of Kathiawar, Gujarat, India. Journal of the
Palaeontological Society of India 47: 107-135.
Kroh, A. 2007. Hemipatagus, a misinterpreted loveniid
(Echinodermata, Echinoidea). Journal of Systematic
Palaeontology 5(2): 163-192.
Kroh, A. 2014a. Eupatagidae Lambert,1905, in: Kroh, A and Mooi, R.
(2014), World Echinoidea Database. Accessed through: World
Register of Marine Species at http://www.marinespecies.org/
echinoidea: on 2014-08-15
Kroh, A. 2014b. Maretia ovata H.L.Clark, 1917, in: Kroh, A and
Mooi, R. (2014), World Echinoidea Database. Accessed through:
World Register of Marine Species at http://www.marinespecies.
org/echinoidea: on 2014-08-15.
Lamarck, J.B.P.M.d. 1816. Histoire naturelle des Animaux sans
Vertebres presentant les caracteres generaux et particuliers de
ces animaux, leur distribution, leur classes, leurs families, leurs
genres, et la citation des principals especes qui s’y rapportent;
precedee d’une Introduction offrant ;a Determination des
caracteres essentielles de Vanima;, sa distinction du vegetal et
des autres corps naturels, enfon, VExposition des Principes
fondamentaux de la Zoologie. Tome Troisieme. Verdiere: Paris.
586 pp.
Lambert, J. 1905. Notes sur quelques Echinides Eoceniques de PAude
et de l’Herault, Pp. 129-184, pi. 6 in: L. Doncieux (ed.). Catalogue
descripitif des Fossiles nummulitiques de l’Aude et de l’Herault.
Annales de TUniversite de Lyon, Nouvelle Serie, 1, Sciences,
Medecine 17: 1-184.
Leske, N.G. 1778. Addimenta ad Iacobi Theodori Klein naturalem
dispositionem Echinodermatum et lucubratiunculam de aculeis
echinorum marinorum. Officina Gleditschiana: Leipsig. xx +
214pp, 18 pis.
72
F.C. Holmes
Lindley, I.D. 2003. Echinoids of the Kairuka Formation (Lower
Pliocene), Yule Island, Papua New Guinea: Spatangoida.
Proceedings of the Linnean Society of New South Wales 124:
153-162.
M c Coy, F. 1879. Tertiary Echinodermata. Pp. 33-42, pis 59-60 in:
Prodromus of the palaeontology of Victoria; or, figures and
descriptions of the Victorian organic remains, Decade 6.
Geological Survey of Victoria: Melbourne.
Mortensen, T. 1948. Contributions to the biology of the Philippine
Archipelago and adjacent regions. Report on the Echinoidea
collected by the United States Fisheries Steamer Albatross during
the Philippine Expedition, 1907-1910. Part 3: The Echinoneidae,
Echinolampidae, Clypeastridae, Arachnidae, Laganidae,
Fibulariidae, Urechinidae, Echinocorythidae, Palaeostomatidae,
Micrasteridae, Palaepneustidae, Hemiasteridae, and Spatangidae.
Bulletin of the Smithsonian Institution, United States National
Museum 100(14/3): 93-140.
Mortensen, T. 1951. A monograph of the Echinoidea 5(2). Spatangoida
2. Amphisternata 2. Spatangidae. Loveniidae, Pericosmidae,
Schizasteridae, Brissidae. C. A. Reitzel: Copenhagen. 593 pp. +
separate atlas 30 pp., 64 pis.
Nisiyama, S. 1968. The echinoid fauna from Japan and adjacent
regions. Part 2. Palaeontological Society of Japan Special Papers
13: 1-495, pis. 19-30.
Richardson, J.R. 1973. Studies of Australian Cainozoic Brachiopods
2. The Family Laqueidae (Terebratellidae). Proceeding of the
Royal Society of Victoria 86(2): 117-126, pis 5-6.
Schultz, H. 2005. Sea Urchin, a guide to worldwide shallow water
species. Multicopy Digital: Augsburg, Germany, xii + 1-484.
Schultz, H. 2009. Sea Urchins II, worldwide irregular deep water
species. Multicopy Digital: Augsburg, Germany, x + 501-849.
Smith, A.B. and Kroh, A. (editors) 2011. The Echinoid Directory.
Accessed through: World Wide Web electronic publication, http://
www.nhm.ac.uk/research-curation/projects/echinoid-directory:
on 2014-07-06.
Stockley, G.M. 1927. Neogene Echinoidea from Zanzibar Protectorate.
Pp. 103-117, pis 20-21 in: Report on the palaeontology of the
Zanzibar Protectorate, based mainly on the Collection made by
G.M. Stockley, Government Geologist, 1925-1926. Zanzibar
Government Report. His Majesty's Stationery Office: London.
180 pp, 23pls.
Sullivan, J. 2007. Maretial aequipetala (Gregory, 1891) in: Smith,
A.B. and Kroh, A. (editors) 2011. The Echinoid Directory.
Accessed through: World Wide Web electronic publication, http://
www.nhm.ac.uk/research-curation/projects/echinoid-directory:
on 2014-07-06.
Tate, R. 1893. Unrecorded genera of the older Tertiary fauna of
Australia. Journal and Proceedings of the Royal Society of New
South Wales IT. 167-197, pis 10-13.
Tate, R. 1899. A revision of the older Tertiary Mollusca of Australia
Part 1. Transactions of the Royal Society of South Australia 23:
249-277, pi. 8.
Memoirs of Museum Victoria 72:73-120 (2014) Published XX-XX-2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
G. Theischinger 1 and I. Endersby 2
1 NSW Department of Planning and Environment, Office of Environment and Heritage, PO Box 29, Lidcombe NSW 1825
Australia; gunther.theischinger@environment.nsw.gov.au
2 56 Looker Road, Montmorency, Vic. 3094
Abstract Theischinger, G. and Endersby, I. 2014. Australian Dragonfly (Odonata) Larvae: Descriptive history and identification.
Memoirs of the Museum of Victoria XX: 73-120.
To improve the reliability of identification for Australian larval Odonata, morphological and geographic information
is summarised for all species. All known references that contain information on characters useful for identification of
larvae are presented in an annotated checklist. For polytypic genera information is provided to clarify whether each
species can already, or cannot yet, be distinguished on morphological characters, and whether and under which conditions
geographic locality is sufficient to make a diagnosis. For each species the year of original description and of first description
of the larva, level of confidence in current identifications, and supportive information, are included in tabular form. Habitus
illustrations of generally final instar larvae or exuviae for more than 70% of the Australian dragonfly genera are presented.
Keywords Odonata, Australia, larvae, descriptive history, identification
Introduction
The size, colour, tremendous flight abilities and unusual
reproductive behaviours of dragonflies make them one of the
most attractive and conspicuous orders of insects. Larval
dragonflies are aquatic and usually associated with clean water
making them useful biological indicators of water quality. Thus
information on the presence, abundance, diversity and
reproductive ability are in high demand for assessments and
modelling connected with river health, biodiversity, conservation,
climate change and other environmental issues. Although flying
adults are generally more likely to be encountered specific habitat
data from larvae, which are confined to freshwater environments,
provides extremely valuable and inclusive information on the
health of aquatic ecosystems. For at least 20 years numerous
nation- and state-wide, as well as regional monitoring programs
have incorporated dragonfly larvae, amongst other
macroinvertebrates, in their aquatic sampling protocols.
Unfortunately, while adult dragonflies can usually be
reliably identified from a number of national and regional field
guides and keys (e.g. Watson et al. (1993), Theischinger &
Hawking (2006), Theischinger & Endersby (2009)), the
situation is quite different for larvae. Although a wealth of
information useful for identification of Australian odonate
larvae is available, it is currently scattered throughout the
literature, often in rather obscure journals. The descriptive
literature on dragonfly larvae ranges from brief descriptions or
line drawings of single structures in single species to
comprehensive revisions (including colour photos and keys) of
large taxonomic groups. The most comprehensive treatments
come from Tillyard (1916a, 1926), Watson (1962), Theischinger
(1982, 1998d, 2000b, 2001a, 2002, 2007a), Theischinger &
Watson (1984), Hawking (1986,1993), Hawking & Theischinger
(1999) and Theischinger and Endersby (2009). However,
morphological characters of larvae are more variable within
single species and therefore less diagnostic than those of adults.
They can also change significantly with development from
early to late instars, and sometimes with habitat conditions. In
addition, keys are usually constructed only for final instars and
require more or less perfect and complete specimens, and some
characters included in descriptions and keys have proved less
consistent than originally envisaged. In monitoring programs
early instar larvae are much more frequently collected than
final instars. As well, the fragile larvae of zygopteran species
often lose body parts during the collection process. Reliable
specific identifications are rarely possible when diagnostic
morphological characters are not available or when sympatric
congeneric species have undescribed larvae. And even for parts
of a geographic range where a species is supposedly the only
member of its genus or species group, there is always a chance
that we have underestimated the geographical range of other
closely related species.
74
G. Theischinger & I. Endersby
We have more than forty years of experience with the
identification of Australian dragonfly larvae (including
checking identifications in many voucher collections) and must
emphasize the importance of considering the above variables
when making identifications. Therefore we feel it is necessary
to complement the basic descriptive information on known
Australian dragonfly larvae by providing a realistic view of
achieving accurate species identifications. It must be stressed
here that it is the final instar (larva or exuvia) that is referred to
in the literature, and that distribution-based identifications
need to be treated with some caution. However the known
geographical ranges of species should not be neglected when
making identifications because greater reliability in
identification is possible by finding larval exuviae in association
with adults and by having the best possible knowledge of the
regional fauna where the specimens are found.
Map 1. The regions of Australia referred to in text and table (from Watson et al. (1991). SWA = south-western Australia; SES = south-eastern
South Australia; VIC = Victoria; TAS = Tasmania; SEN = south-eastern New South Wales; NEN = north-eastern New South Wales; SEQ =
south-eastern Queensland; NEQ = north-eastern Queensland; CY = Cape York Peninsula; NNT = top end of Northern Territory; KIM =
Kimberley region; NWA = north-western Australia; IN = inland New South Wales; SIQ = southern inland Queensland; NIQ = northern inland
Queensland; IA = inland Australia.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
75
Methods
All known species of Australian dragonflies are listed following
the family order of the World Systematic Consensus of Dijkstra
et al. (2013) (with the additions of Kalkman & Theischinger
(2013)), and all references that include descriptive details and/
or illustrations/photos of larvae are given in chronological
order, not in the order of usefulness for identifications. The
reliability/difficulty of generic identifications is indicated under
the family headings. Following the species of each polytypic
genus/subgenus (marked with an asterisk *) a brief summary is
presented of the potential for reliable specific identification.
Line drawings (Figs 1-81) and colour photographs (Figs 82-94)
of at least one species per family are presented followed by a
table giving references for descriptive information, the basis for
reliable identification of each species, the present state of
knowledge and the level of confidence for species identification.
We construct and present a graph that shows the chronological
growth of specific descriptive information on Australian
dragonfly larvae, and a summary of all information included in
the paper is given. Maps 1 and 2 are taken from Watson et al.
(1991) and Watson & Theischinger (1984), and distributional
details are based on the dot maps in Theischinger & Endersby
(2009) and additional unpublished information.
Acknowledgements
We wish to thank Dr Dan Bickel (Australian Museum, Sydney),
Stephen Richards (Kuranda) and Dr Peter Scanes (Office of
Environment and Heritage, Sydney) for reading the manuscript
or parts of it and giving helpful suggestions. John Hawking is
thanked for providing colour photographs.
Descriptive literature on the larvae of Australian dragonfly
species, with remarks on species identification within
polytypic genera
Order Odonata
Two suborders, clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Suborder Zygoptera
Eight families, clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Family Hemiphlebiidae
Monotypic family, distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Hemiphlebia mirabilis Selys, 1869
Fig. 1
Tillyard (1928); Hawking (1995); Williams (1980); Theischinger
& Hawking (2003, 2006); Theischinger & Endersby (2009);
Map 2. Map of eastern Australia showing relevant localities (from
Watson & Theischinger (1984). NSW = New South Wales; NT =
Northern Territory; QLD = Queensland; SA = South Australia; VIC =
Victoria; 1 = Paluma Range; 2 = Eungella; 3 = Carnarvon Gorge; 4 =
Barrington Tops; 5 = Blue Mountains; 6 = Canberra. The Paluma-
Eungella gap (marked with +, ca. 19°S) spans between 1 and 2.
Hawking et al. (2013). Genus monotypic.
Family Synlestidae
Three genera clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Chorismagrion risi Morton, 1914
Fraser (1956); Theischinger et al. (1993); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking et
al. (2013). Genus monotypic.
76
G. Theischinger & I. Endersby
Figs 1-12. Final instar larvae of Australian Zygoptera: (1) Hemiphlebia mirabilis (Hemiphlebiidae); (2) Synlestes weyersii (Synlestidae); (3)
Austrolestes annulosus (Lestidae); (4) Diphlebia euphoeoides (Lestoideidae); (5-8) Argiolestidae: (5) Archiargiolestes parvulus\ (6)
Austroargiolestes icteromelas', (7) Griseargiolestes griseus; (8) Miniargiolestes minimus', (9) Austrosticta soror (Isostictidae); (10) Nososticta
pilbara (Platycnemididae); (11, 12) Coenagrionidae: (11) Caliagrion billinghursti', (12) Ischnura heterosticta.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
77
Episynlestes albicauda (Tillyard, 1913)
Theischinger et al. (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
Episynlestes cristatus Watson & Moulds, 1977
Fraser (1956), as Synlestes tropicus ; Theischinger et al. (1993);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Episynlestes intermedius Theischinger & Watson, 1985
Theischinger et al. (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
*Genus Episynlestes Kennedy, 1920
Specific identifications based on morphology need
confirmation by distributions (Theischinger et al. 1993). North
of Paluma-Eungella gap: E.cristatus\ Eungella area: E.
intermedius-, south of Paluma-Eungella gap: E. albicauda.
Synlestes selysi Tillyard, 1917
Theischinger et al. (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Synlestes tropicus Tillyard, 1917
Theischinger et al. (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); The description of S.
tropicus by Fraser (1956) refers to Episynlestes cristatus.
Synlestes weyersii Selys, 1869
Figs 2, 82
Tillyard (1914,1917a, 1917b, 1926); O’Farrell (1970); Williams
(1980), as S. tillyardi-, Nuttall (1982); Hawking (1986, 1995);
Watson & O’Farrell (1991); Watson et al. (1991); Theischinger
et al. (1993); Hawking & Theischinger (1999); Gooderham &
Tsyrlin (2002); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Synlestes Selys, 1869
At present specific identifications based on morphology need
confirmation by distributions (Theischinger et al. 1993). North
of Paluma-Eungella gap: S. tropicus-, from Eungella area south
to approximately 36°S: S. selysi/weyersii; south of
approximately 36°S: Synlestes weyersii.
Family Lestidae
Three genera clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Austrolestes aleison Watson & Moulds, 1979
Watson (1962), as A. psyche-, Watson et al. (1991); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Austrolestes analis (Rambur, 1842)
Tillyard (1906, 1917b, 1932); Ris (1910), as larva B; Lieftinck
(1960); Watson (1962); O’Farrell (1970); Allbrook (1979);
Williams (1980); Nuttall (1982); Hawking (1986); Watson &
O’Farrell (1991); Hawking & Theischinger (1999); Gooderham
& Tsyrlin (2002); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Austrolestes annulosus (Selys, 1862)
Fig. 3
Ris (1910), as larva A; Lieftinck (1960); Watson (1962);
O’Farrell (1970); Allbrook (1979); Nuttall (1982); Hawking
(1986); Watson & O’Farrell (1991, 1994); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009).
Austrolestes aridus (Tillyard, 1908)
Lieftinck (1960); Watson (1962); Nuttall (1982); Hawking
(1986); Hawking & Theischinger (1999); Theischinger &
Hawking (2003, 2006); Theischinger & Endersby (2009).
Austrolestes cingulatus (Burmeister, 1839)
Tillyard (1906, 1914, 1917a, 1917b, 1926); Allbrook (1979);
Nuttall (1982); Hawking (1986,1995); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009).
Austrolestes insularis Tillyard, 1913
Larva not yet recognized.
Austrolestes io (Selys, 1862)
Lieftinck (1960); Watson (1962); Allbrook (1979); Nuttall
(1982); Hawking (1986); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009).
Austrolestes leda (Selys, 1862)
Tillyard (1906, 1917a); Watson (1962); Allbrook (1979);
Hawking (1986, 1995); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009).
Austrolestes minjerriba Watson, 1979
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
78
G. Theischinger & I. Endersby
Austrolestes psyche (Hagen, 1862)
Tillyard (1917a, 1717b); Lieftinck (1960); Allbrook (1979);
Nuttall (1982); Hawking (1986,1995); Hawking & Theischinger
(1999); Gooderham & Tsyrlin (2002); Theischinger &
Hawking (2003, 2006); Theischinger & Endersby (2009).
Watson (1962) has to be referred to Austrolestes aleison.
*Genus Austrolestes Tillyard, 1913
Morphology based identifications need geographical
confirmation for two species: South-western Australia: A.
aleisorr, south-eastern Australia: A. psyche. A. insularis (larva
still undescribed) should be the only species across most of
northern Australia (Theischinger & Endersby 2009).
Indolestes alleni (Tillyard, 1913)
Larva not yet recognized.
Indolestes obiri Watson, 1979
Larva not yet recognized.
Indolestes tenuissimus (Tillyard, 1906)
Lieftinck (1960); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Indolestes Fraser, 1922
Morphology based identifications of Indolestes from north¬
eastern Queensland may include both I. tenuissimus and I.
alleni, those from the north of Northern Territory I. alleni and
I. obiri (Theischinger & Endersby 2009).
Lestes concinnus Hagen, 1862
Lieftinck (1960); Hawking (1993); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013), as Lestes. Sole species of the genus in Australia.
Family Lestoideidae
Two genera clearly distinguishable on morphology and size
(Theischinger & Hawking 2006, Theischinger & Endersby
2009, both under Diphlebiidae and Lestoideidae; Hawking et
al. 2013).
Lestoidea barbarae Watson, 1967
Larva probably not available
Lestoidea brevicauda Theischinger, 1996
Larva not identifiable at the present.
Lestoidea conjuncta Tillyard, 1913
Fraser (1956); Hawking (1995); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013). Larva not identifiable at present.
Lestoidea lewisiana Theischinger, 1996
Larva not yet recognized.
*Genus Lestoidea Tillyard, 1913
The available descriptions by Fraser (1956); Theischinger &
Hawking (2006) and Theischinger & Endersby (2009) enable
firm identification of Lestoidea sp. only. L. lewisiana may be
endemic to, and the only Lestoidea species in, the Mt Lewis area.
Diphlebia coerulescens Tillyard, 1913
Stewart (1980); Hawking & Theischinger (1999); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Diphlebia euphoeoides Tillyard, 1907
Fig. 4
Stewart (1980); Watson & O’Farrell (1991); Watson et al.
(1991); Hawking (1995); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Diphlebia hybridoides Tillyard, 1912
Stewart (1980); Theischinger & Hawking (2006); Theischinger
& Endersby (2009).
Diphlebia lestoides (Selys, 1853)
Tillyard (1909b, 1912, 1915a, 1917b, 1926); Stewart (1980);
Williams (1980); Hawking (1986); Hawking & Smith (1997);
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009); Hawking et
al. (2013).
Diphlebia nymphoides Tillyard, 1912
Tillyard (1912); Stewart (1980); Hawking (1986); Hawking &
Theischinger (1999); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
*Genus Diphlebia Selys, 1869
On the basis of the available information on morphology
(Stewart 1980) confident identifications were hitherto found
impossible. D. euphoeoides and D. hybridoides are known
only from north of the Paluma-Eungella gap; D. coerulescens
from the Eungella area south to approximately 30°S, whereas
both D. lestoides and D. nymphoides seem to inhabit only
eastern Australia south of 24°S, but with only D. nymphoides
inhabiting Carnarvon N.P. (Theischinger & Endersby 2009).
Family Argiolestidae
Five genera clearly distinguishable on morphology
(Theischinger & Hawking 2006, Theischinger & Endersby
2009, both under Megapodagrionidae; Hawking et al. 2013).
Archiargiolestes parvulus (Watson, 1977)
Fig. 5
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
79
Theischinger (1998b). Hawking etal. (2013), as Archiargiolestes.
Larva not identifiable at present.
Archiargiolestes pusillissimus Kennedy, 1925
Theischinger (1998b).
Larva not identifiable at present.
Archiargiolestes pusillus (Tillyard, 1908)
Watson (1962). Theischinger (1998b).
Larva not identifiable at present.
*Genus Archiargiolestes Kennedy, 1925
Even though larval details of all three species are available
specific identifications are not possible at the present
(Theischinger & Endersby 2009).
Austroargiolestes alpinus (Tillyard, 1913)
Larva not yet recognized.
Austroargiolestes amabilis (Forster, 1899)
Larva not yet recognized.
Austroargiolestes aureus (Tillyard, 1906)
Larva not identifiable at present.
Austroargiolestes brookhousei Theischinger & O’Farrell,
1986
Larva not yet recognized.
Austroargiolestes calcaris (Fraser, 1958)
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009); Hawking et
al. (2013). Larva not identifiable at present.
Austroargiolestes Christine Theischinger & O’Farrell, 1986
Larva not yet recognized.
Austroargiolestes chrysoides (Tillyard, 1913)
Larva not identifiable at present.
Austroargiolestes elke Theischinger & O’Farrell, 1986
Larva not yet recognized.
Austroargiolestes icteromelas (Selys, 1862)
Fig. 6
Tillyard (1917a, 1917b, 1926, 1932); O’Farrell (1970), all as
Argiolestes icteromelas; Lieftinck (1976), Nuttall (1982), as
Austroargiolestes sp. 1; Hawking (1986, 1995); Watson &
O’Farrell (1991,1994); Watson etal. (1991); Hawking & Smith
(1997); Theischinger (1998b); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009).
Larva not identifiable at present.
Austroargiolestes isabellae Theischinger & O’Farrell, 1986
Murray (1995); Hawking & Theischinger (1999); Theischinger
& Hawking (2003, 2006); Theischinger & Endersby (2009).
Larva not identifiable at present.
*Genus Austroargiolestes Kennedy, 1925
With A. icteromelas potentially coexisting with any other of
its extremely similar congeners, generally the only confident
identification appears to b e Austroargiolestes sp. (Theischinger
& Endersby 2009) even though most of the usually collected
larvae belong to A. icteromelas.
Griseargiolestes albescens (Tillyard, 1913)
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Griseargiolestes bucki Theischinger, 1998
Theischinger (1998c); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Griseargiolestes eboracus (Tillyard, 1913)
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009).
Griseargiolestes fontanus (Tillyard, 1913)
Larva not yet recognized.
Griseargiolestes griseus (Hagen, 1862)
Fig. 7
Tillyard (1914, 1917a), Hawking (1986), both as Argiolestes
griseus ; (Theischinger 1998b); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
Griseargiolestes intermedius (Tillyard, 1913)
Fig. 83
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009); Hawking et
al. (2013).
Griseargiolestes metallicus (Sjostedt, 1917)
Larva not yet recognized.
80
G. Theischinger & I. Endersby
*Genus Griseargiolestes Theischinger, 1998
It should be easy to identify the larva of G. metallicus once it is
found as it is the only Griseargiolestes species known from
north of the Paluma-Eungella gap. The larva of G.fontanus is
expected to be found most likely near springs of subtropical
rainforest streams. Distributions may be needed to establish/
confirm the identification of G. griseus and G. intermedins with
only G. intermedins present in the alpine region and G. griseus
mostly north and east of it (Theischinger & Endersby 2009).
Miniargiolestes minimus (Tillyard, 1908)
Fig. 8
Watson (1962), Hawking (1995), both as Argiolestes minimus ;
Theischinger (1998b); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Genus monotypic.
Podopteryx selysi (Forster, 1899)
Watson & Dyce (1978); Hawking (1995); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013). Sole species of the genus in Australia.
Family Isostictidae
Eight genera clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Austrosticta fieldi Tillyard, 1908
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Austrosticta frater Theischinger, 1997
Larva not yet recognized.
Austrosticta soror Sjostedt, 1917
Fig. 9
Watson & O’Farrell (1991); Watson et al. (1991).
*Genus Austrosticta Tillyard, 1908
Because of the possible sympatric existence of the three species,
larvae of this genus without associated imago can only be
identified as Austrosticta sp. (Theischinger & Endersby 2009).
Eurysticta coolawanyah Watson, 1969
Watson (1969); Watson et al. (1991); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Eurysticta coomalie Watson, 1991
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Eurysticta kununurra Watson, 1991
Hawking (1993, 1995); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Eurysticta reevesi Theischinger, 2001
Larva not yet recognized.
*Genus Eurysticta Watson, 1969
It appears that the known larvae of this genus can be identified
to species in spite of the possible sympatric existence of E.
coomalie and E. kununurra (Theischinger & Endersby 2009).
Labidiosticta vallisi (Fraser, 1955)
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009); Hawking et
al. (2013). Genus monotypic.
Lithosticta macra Watson, 1991
Hawking (1993, 1995); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Genus monotypic.
Neosticta canescens Tillyard, 1913
Tillyard (1914,1917a, 1917b); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009); Hawking et al. (2013).
Neosticta fraseri Watson, 1991
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Neosticta silvarum (Sjostedt, 1917)
Larva not yet recognized.
*Genus Neosticta Tillyard, 1913
Based on distributions, larvae from south-eastern Australia
can be identified as N. canescens, whereas Neosticta larvae
from north of the Paluma-Eungella gap may be the common N.
fraseri or the more local and uncommon N. silvarum
(Theischinger & Endersby (2009).
Oristicta filicicola Tillyard, 1913
Fraser (1956); Williams (1980); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013). Genus monotypic.
Rhadinosticta banksi (Tillyard, 1913)
Hawking (1993), as Rhadinosticta handschini; Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Rhadinosticta simplex (Martin, 1901)
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
81
Tillyard (1914, 1917a, 1917b, 1926); Hawking (1986), all as
Isosticta simplex ; Hawking (1995); Hawking & Smith (1997);
Hawking & Theischinger (1999); Gooderham & Tsyrlin
(2002); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
*Genus Rhadinosticta Watson, 1991
A good generic character is the presence of 6 dark spots on the
otherwise pale labium. The two species are identifiable based
on morphology. Larvae from south-eastern Australia can be
confirmed by distribution as R. simplex (Theischinger &
Endersby (2009).
Selysioneura sp.
Theischinger (2009). Sole species of the genus in Australia. It
appears that only one and as yet undescribed Selysioneura
species exists in tropical Queensland.
Family Platycnemididae
A single genus clearly distinguishable on morphology
(Theischinger & Hawking 2006, under Protoneuridae;
Theischinger & Endersby 2009; Hawking et al. 2013).
Nososticta baroalba Watson & Theischinger, 1984
Larva not yet recognized.
Nososticta coelestina (Tillyard, 1906)
Larva not yet recognized.
Nososticta fraterna (Lieftinck, 1933)
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Nososticta kalumburu Watson & Theischinger, 1984
Larva not yet recognized.
Nososticta koolpinyah Watson & Theischinger, 1984
Larva not yet recognized.
Nososticta koongarra Watson & Theischinger, 1984
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Nososticta liveringa Watson & Theischinger, 1984
Larva not yet recognized.
Nososticta mouldsi Theischinger, 2000
Larva not yet recognized.
Nososticta pilbara Watson, 1969
Fig. 10
Watson (1969), as Nososticta solida pilbara; Watson &
O’Farrell (1991); Watson et al. (1991); Theischinger &
Hawking (2006); Theischinger & Endersby (2009).
Nososticta solida (Hagen, 1860)
Nuttall (1982), as Protoneuridae sp.; Hawking (1986, 1995);
Hawking & Theischinger (1999); Gooderham & Tsyrlin
(2002); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009); Hawking et al. (2013).
Nososticta solitaria (Tillyard, 1906)
Larva not yet recognized.
Nososticta taracumbi Watson & Theischinger, 1984
Larva not yet recognized.
*Genus Nososticta Hagen in Selys, 1860
Because of the sympatric existence of two or more species
across much of northern Australia and rather weak characters,
Nososticta larvae cannot be identified to the species at present
except for larvae from New South Wales and Victoria that can
be referred to N. solida, the sole Nososticta species occurring
there (Theischinger & Endersby (2009).
Family Coenagrionidae
13 genera distinguishable on morphology, two of them,
Austroagrion and Xanthagrion, difficult (see there), larva of
Archibasis unknown (Theischinger & Hawking 2006;
Theischinger & Endersby 2009; Hawking et al. 2013).
Aciagrion fragile (Tillyard, 1906)
Hawking (1993); Theischinger (2000a); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013). Sole species of the genus in Australia.
Agriocnemis argentea Tillyard, 1906
Larva not yet recognized.
Agriocnemis dobsoni Fraser, 1954
Larva not yet recognized.
Agriocnemis femina (Brauer, 1868)
Lieftinck (1962).
Agriocnemis kunjina Watson, 1969
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Agriocnemis pygmaea (Rambur, 1842)
Allbroook (1979); Nuttall (1982); Hawking (1993); Hawking &
Theischinger (1999); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
82
G. Theischinger & I. Endersby
Agriocnemis rubricauda Tillyard, 1913
Larva not yet recognized.
*Genus Agriocnemis Selys, 1877
With the larvae of most species still undescribed, and the
available larvae having few diagnostic characters, the only
reliable specific identifications possible at present are A.
femina with its range in Australia restricted to Cape York and
A. pygmaea if collected in New South Wales (Theischinger &
Endersby 2009).
Archibasis mimetes (Tillyard, 1913)
Larva not yet recognized. Sole species of the genus in
Australia.
Argiocnemis rubescens Selys, 1877
Tillyard (1917a, 1917b), Hawking (1993); Hawking &
Theischinger (1999); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013). Sole
species of the genus in Australia.
Austroagrion cyane (Selys, 1876)
Watson (1962), as Austroagrion coeruleum; Hawking (1986).
The reference to A. cyane by Allbrook (1979) refers to A. watsoni.
Austroagrion exclamationis Campion, 1915
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Austroagrion pindrina Watson, 1969
Larva not yet recognized.
Austroagrion watsoni Lieftinck, 1982
Tillyard (1917a), Allbrook (1979), Nuttall (1982), all as
Austroagrion cyane-. Hawking (1986, 1993); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Austroagrion Tillyard, 1913
The larva of A. exclamationis can confidently be identified.
Based on morphology larvae from south-western Australia
and South Australia can confidently be referred to A. cyane,
larvae from south-eastern Australia to A. watsoni, and larvae
from the Pilbara area in north-western Australia to A. pindrina
(Theischinger & Endersby 2009). However, there is an overlap
of A. cyane and A. watsoni in the extreme west of Victoria
(Richter 2014). The diagnostic characters of Austroagrion
(from Xanthagrion erythroneurum ) of the median caudal gill
seem to work only for final instar larvae. More distinctly
ringed antennae and a narrower labium usually distinguish
younger Austroagrion larvae from Xanthagrion.
Austrocnemis maccullochi (Tillyard, 1926)
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Austrocnemis obscura Theischinger & Watson, 1991
Larva not yet recognized.
Austrocnemis splendida (Martin, 1901)
Tillyard (1917a); Hawking & Theischinger (1999); Theischinger
& Hawking (2003, 2006); Theischinger & Endersby (2009);
Hawking et al. (2013).
*Genus Austrocnemis Tillyard, 1913
The larvae of A. maccullochi can confidently be identified based
on morphology, of the remaining larvae those from eastern
Australia can confidently be referred to A. splendida, those from
the Kimberley to A. obscura (Theischinger & Endersby 2009).
Austrocoenagrion lyelli (Tillyard, 1913)
Allbrook (1979), where it appears that the caudal gill is described
upside down; Nuttall (1982); Theischinger & Hawking (2003,
2006); Theischinger & Endersby (2009); Hawking et al. (2013);
all under Coenagrion lyelli. Genus monotypic.
Caliagrion billinghursti (Martin, 1901)
Fig. 11
Tillyard (1914,1917a, 1917b, 1926); O’Farrell (1970); Williams
(1980); Nuttall (1982), Hawking (1986, 1995); Watson &
O’Farrell (1991); Watson et al. (1991); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009). Genus monotypic.
Ceriagrion aeruginosum (Brauer, 1869)
Lieftinck (1936); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013). Sole
species of the genus in Australia.
Ischnura aurora (Brauer, 1865)
Tillyard (1917b); Lieftinck (1962); Watson (1962); Allbrook
(1979); Nuttall (1982); Hawking (1986, 1993, 1995); Hawking
& Smith (1997); Hawking & Theischinger (1999); Theischinger
& Hawking (2003, 2006); Theischinger & Endersby (2009).
Ischnura heterosticta (Burmeister, 1839) (Fig. 12)
Tillyard (1917a, 1917b), Watson (1962); O’Farrell (1970);
Allbrook (1979); Nuttall (1982); Hawking (1986, 1993, 1995);
Watson & O’Farrell (1991), Ingram et al. (1997); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Ischnura pruinescens (Tillyard, 1906)
Hawking (1993); Hawking & Theischinger (1999); Thei schinger
& Hawking (2006); Theischinger & Endersby (2009).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
83
*Genus Ischnura Charpentier, 1840
Distributions do not confirm any identification based on
morphology of the often sympatric species but size and
morphology of final instars should be sufficient for reasonably
confident identifications (Theischinger & Endersby 2009).
Pseudagrion aureofrons Tillyard, 1906
Hawking (1986, 1993, 1995); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
Pseudagrion cingillum (Brauer, 1869)
Larva not yet recognized.
Pseudagrion ignifer Tillyard, 1906
Theischinger (2000a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009). Reference to this species by
Hawking & Theischinger (1999) probably refers to P.
microcephalum.
Pseudagrion jedda Watson & Theischinger, 1991
Larva not yet recognized.
Pseudagrion lucifer Theischinger, 1997
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Pseudagrion microcephalum (Rambur, 1842)
Lieftinck (1962); Watson et al. (1991); Hawking (1993);
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
*Genus Pseudagrion Selys, 1876:
The known larvae of the Australian Pseudagrion species can
be confidently distinguished from each other by the
combination of morphological characters and distributions.
However, only P. aureofrons, P. microcephalum and P. ignifer
from eastern Australia south of about latitude Rockhampton
can be confidently identified because P. cingillum and P. jedda
coexist in the same areas as P. aureofrons, P. ignifer, P.
microcephalum and P. lucifer in northern Australia
(Theischinger & Endersby 2009) and their as yet undescribed
larvae may be indistinguishable from one or two of them.
Teinobasis rufithorax (Selys, 1877)
Larva not yet recognized. Sole species of the genus in
Australia.
Xanthagrion erythroneurum (Selys, 1876)
Fig. 84
Watson (1962); Allbrook (1979); Nuttall (1982); Hawking
(1986,1993); Hawking & Theischinger (1999); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013). Sole species of the genus in Australia. The
diagnostic characters (from Austroagrion) of the median
caudal gill seem to work only for final instar larvae. Less
distinctly ringed antennae and a wider labium usually
distinguish younger X. erythroneurum larvae from
Austroagrion.
Suborder Anisoptera
Eight families + one group of genera incertae sedis, clearly
distinguishable on morphology (Theischinger & Hawking
2006, under Epiproctophora; Theischinger & Endersby 2009,
under Epiprocta; Hawking et al. 2013).
Family Austropetaliidae
Two genera clearly distinguishable on morphology
(Theischinger & Hawking 2006, under Archipetaliidae and
Austropetaliidae; Theischinger & Endersby 2009; Hawking et
al. 2013).
Archipetalia auriculata Tillyard, 1917
Fig. 13
Albrook (1979); Gooderham & Tsyrlin (2002); Theischinger
(2002); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013). Genus monotypic.
Austropetalia annaliese Theischinger, 2013
Larva not yet recognized.
Austropetalia patricia (Tillyard, 1910)
Fig. 14
Tillyard (1910a, 1916a,1917b, 1926); Hawking (1986, 1995),
has to be referred to A. tonyana-, Theischinger (2002);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009); Theischinger & Tang (2012).
Austropetalia tonyana Theischinger, 1995
Hawking (1986, 1995), as A. patricia; Hawking & Smith
(1997); Hawking & Theischinger (1999); Theischinger (2002);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Theischinger & Tang (2012); Hawking et al.
(2013).
*Genus Austropetalia Tillyard, 1916
The easiest specific identification for Austropetalia larvae is
by the probably exclusive distributions. North of the Hunter
River: A. annaliese (larva as yet not available); south of the
Hunter River to approximately 35°S: A. patricia-, south of
approximately 35°S: A. tonyana (Theischinger 2002;
Theischinger & Endersby 2009; Theischinger & Tang 2013).
84
G. Theischinger & I. Endersby
Figs 13-24. Final instar larvae/exuviae of Australian Anisoptera: (13, 14) Austropetaliidae: (13) Arcliipetalia auriculata; (14) Austropetalia
patricicr, (15-23) Aeshnidae: (15) Adversaeschna brevistylcr, (16) Anax gibbosulus\ (17) Austro gynacantha heterogena\ (18) Dendroaeschna
consperscr, (19) Acanthaeschna victoria ; (20) Austroaeschna (Pulchaeschna) muellerv, (21) Austrophlebia costalis\ (22) Spinaeschna tripunctata ;
(23) Telephlebia brevicauda; 24) Petalura hesperia (Petaluridae).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
85
Family Aeshnidae
13 genera and several subgenera clearly distinguishable on
morphology (Theischinger & Hawking 2006, under Aeshnidae
and Telephlebiidae; Theischinger & Endersby 2009, under
Aeshnidae, Brachytronidae and Telephlebiidae; Theischinger
2012 ).
Adversaeschna brevistyla (Rambur, 1842)
Fig. 15
Ris (1910), as larva D, Tillyard (1910a, 1914, 1916a, 1916b,
1917b, 1926), Watson (1962), O’Farrell (1970), Allbrook
(1979), Williams (1980), Hawking (1986), Watson & O’Farrell
(1991, 1994), Hawking & Theischinger (1999), Theischinger &
Hawking (2003), all as Aeshna brevistyla-, Theischinger &
Hawking (2003, 2006); Theischinger & Endersby (2009);
Hawking et al. (2013). Sole species of the genus in Australia.
Agyrtacantha dirupta (Karsch, 1889)
Larva not yet recognized. Sole species of the genus in
Australia.
Anaciaeschna jaspidea (Burmeister, 1839)
Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013). Sole
species of the genus in Australia.
Anax georgius Selys, 1872
Watson & Theischinger (1987); Theischinger (2002);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Anax gibbosulus Rambur, 1842
Fig. 16
Watson & Theischinger (1987); Theischinger (2002);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
Anax guttatus (Burmeister, 1839)
Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Anaxpapuensis (Burmeister, 1839)
Fig. 85
Tillyard (1916a, 1916b, 1917b, 1932); Calvert (1934); Watson
(1962, 1968); Allbrook (1979); Hawking (1986, 1993, 1995),
Hawking & Smith (1997); Ingram et al. (1997); Hawking &
Theischinger (1999); Gooderham & Tsyrlin (2002), as Aeshna
brevistyla-, Theischinger (2002); Theischinger & Hawking (2003,
2006); Theischinger & Endersby (2009); Hawking et al. (2013).
Up to 2006 most generally referred to as Hemianax papuensis.
Genus Anax Leach, 1815
Morphological characters are insufficient to distinguish
among species. Identifications of larvae from southern, inland
and central Australia can be confirmed by distribution as A.
papuensis. In northern Australia the other three species may
coexist with each other (A. georgius most restricted and
morphologically distinct) and A. papuensis (Theischinger
2002; Theischinger & Endersby 2009).
Austrogynacantha heterogena Tillyard, 1908
Fig. 17
Hawking (1993); Hawking & Theischinger (1999); Theischinger
(2002); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013). Genus monotypic.
Gynacantha dobsoni Fraser, 1951
Tillyard (1916a, 1917b), as G. rosenbergi-, Hawking (1993);
Theischinger (2007b); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Gynacantha kirbyi Kruger, 1898
Larva not yet recognized.
Gynacantha mocsaryi Forster, 1898
Fraser (1963), somewhat incorrect; Theischinger (2001c,
2002); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
Gynacantha nourlangie Theischinger & Watson, 1991
Hawking (1993); Theischinger (2002); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013).
Gynacantha rosenbergi Kaup, 1867
Theischinger (2007b); Theischinger & Endersby (2009).
Tillyard (1916a), as G. rosenbergi described the larva of G.
dobsoni.
*Genus Gynacantha Rambur, 1842
Distributions cannot be used to confirm identifications based
on morphology. G. kirbyi and G. mocsaryi appear to be
restricted to north-eastern Queensland, but the other more
widely distributed species occur there as well (Theischinger &
Endersby 2009).
Dendroaeschna conspersa (Tillyard, 1907)
Fig. 18
Tillyard (1914,1916a, 1916b, 1917b); Hawking (1991); Hawking
& Theischinger (1999); Theischinger (2002); Theischinger &
Hawking (2006); Peters & Theischinger (2007); Theischinger
& Endersby (2009); Hawking et al. (2013). Genus monotypic.
86
G. Theischinger & I. Endersby
Acanthaeschna victoria Martin, 1901
Fig. 19
Theischinger (2000a, 2000c, 2002, 2008a); Theischinger &
Hawking (2006); Peters & Theischinger (2007); Theischinger
& Endersby (2009); Theischinger & Jacobs (2012); Hawking
et al. (2013). Genus monotypic.
Antipodophlebia asthenes (Tillyard, 1916)
Watson & Theischinger (1980); Hawking & Theischinger
(1999); Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Genus monotypic.
Austroaeschna (Austroaeschna) Christine Theischinger, 1993
Theischinger (1993, 2002); Theischinger & Hawking (2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009).
Austroaeschna (Austroaeschna) ingrid Theischinger, 2008
Theischinger (2008b); Theischinger & Endersby (2009).
Austroaeschna (Austroaeschna) multipunctata (Martin, 1901)
Theischinger (1982, 2002), Hawking (1986), Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009). The description of A. multipunctata by Tillyard
(1916a) refers to A. obscura.
Austroaeschna (Austroaeschna) obscura Theischinger, 1982
Tillyard (1916a, 1916b, 1917b), as A. multipunctata ; Hawking
& Theischinger (1999); Theischinger (1982, 2002, 2012);
Theischinger & Hawking (2006); Peters & Theischinger
(2007); Theischinger & Endersby (2009).
Austroaeschna (Austroaeschna) parvistigma (Selys, 1883)
Tillyard (1916a), from notes only; Allbrook (1979);
Theischinger (1993, 2002); Hawking (1986); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009).
Austroaeschna (Austroaeschna) sigma Theischinger, 1982
Theischinger (1982, 1993, 2002); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
*Genus Austroaeschna, Subgenus Austroaeschna Selys, 1883
Only A. obscura can be distinguished from congeners on the
basis of morphology. Four more species can confidently be
identified by their distributions. Eungella area: A. Christine ;
south-eastern Queensland and New South Wales N of latitude
Sydney: A. sigma ; south-eastern New South Wales south of
approximately 35°30’S and Victoria except for the Grampians:
A. multipunctata ; Grampians: A. ingrid. A. parvistigma is the
only species in Tasmania. On the mainland it may, however,
coexist in places with with A. sigma, A. multipunctata and A.
ingrid. But, whereas the larvae of these three species inhabit
running water often with rocky substrate, the larva of A.
parvistigma is usually found only in swampy and boggy
situations (Theischinger 2002,2012; Theischinger & Endersby
2009).
Austroaeschna (Glaciaeschna) flavomaculata Tillyard, 1916
Theischinger (1982, 2002, 2012); Hawking (1986); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009). Subgenus monotypic.
Austroaeschna (Montiaeschna) atrata Martin, 1901
Theischinger (1982, 2002, 2012); Hawking (1986, 1995);
Hawking & Watson (1990); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Peters & Theischinger
(2007); Theischinger & Endersby (2009); Hawking et al.
(2013). The description of A. atrata by Tillyard (1916a) refers
to the larva of A. subapicalis.
Austroaeschna (Montiaeschna) hardyi Tillyard, 1917
Allbrook (1979); Theischinger (1982, 2002); Theischinger &
Hawking (2006); Peters & Theischinger (2007); Theischinger
& Endersby (2009).
Austroaeschna (Montiaeschna) subapicalis Theischinger,
1982
Tillyard (1916a), as A. atrata ; Theischinger (1982, 2002,
2012); Theischinger & Hawking (2003, 2006); Peters &
Theischinger (2007); Theischinger & Endersby (2009).
Austroaeschna (Montiaeschna) tasmanica Tillyard, 1916
Allbrook (1979); Theischinger (1982, 2002); Theischinger &
Hawking (2006); Theischinger & Endersby (2009).
*Genus Austroaeschna, Subgenus Montiaeschna
Theischinger, 2012
Of the two very similar mainland species, A. atrata seems to be
restricted to the alpine region, whereas A. subapicalis may reach
north into Queensland and in the south certainly reaches west to
the Grampians. The two Tasmanian species can be identified
based on morphology only (Theischinger 2002, 2012).
Austroaeschna (Occidaeschna) anacantha Tillyard, 1908
Ris (1910), as larva C; Tillyard (1916a), as Acanthaeschna
anacantha-, Watson (1962); Theischinger (1982, 2002, 2012);
Watson et al. (1991); Theischinger & Hawking (2006);
Theischinger & Endersby (2009). Subgenus monotypic.
Morphology based identification can be confirmed by
distribution: only south-western Australia.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
87
Austroaeschna (Petersaeschna) cooloola Theischinger, 1991
Hawking & Theischinger (1999), as A. unicornis cooloola-,
Theischinger (2002, 2012); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Austroaeschna (Petersaeschna) inermis Martin, 1901
Theischinger (1975, 1982, 2002, 2012); Hawking (1986);
Hawking & Smith (1997); Theischinger & Hawking (2003,
2006); Theischinger & Endersby (2009).
Austroaeschna (Petersaeschna) pinheyi Theischinger, 2001
Theischinger (1982), Hawking & Theischinger (1999), both
partly as A. unicornis speciosa-, Theischinger (2001b, 2002),
Theischinger & Hawking (2006), all as Austroaeschna
unicornis pinheyi-, Peters & Theischinger (2007); Theischinger
& Endersby (2009).
Austroaeschna (Petersaeschna) speciosa Sjostedt, 1917
Theischinger (1982, 2002); Theischinger & Hawking (2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009). Hawking & Theischinger (1999), as A. unicornis
speciosa should be referred to A. pinheyi and A. unicornis.
Austroaeschna (Petersaeschna) unicornis (Martin, 1901)
Tillyard (1916a), Albrook (1979), both as A. longissima;
Theischinger (1982, 2002, 2012); Hawking (1986); Hawking &
Theischinger (1999); Gooderham & Tsyrlin (2002);
Theischinger & Hawking (2003, 2006); Peters & Theischinger
(2007); Theischinger & Endersby (2009).
*Genus Austroaeschna, Subgenus Petersaeschna
Theischinger, 2012
Distributions can at least in part support identification of four of
the five species. Tropical Queensland north of Paluma-Eungella
gap: A. speciosa-, inland Queensland: A. pinheyi, Cooloola
region, Stradbroke Island and Fraser Island: A. cooloola; most
of eastern Queensland south of Paluma-Eungella gap, eastern
New South Wales, Victoria, Tasmania, South Australia: A.
unicornis. There is no need for confirming identification of A.
inermis on geography (Theischinger 2002, 2012).
Austroaeschna (Pulchaeschna) eungella Theischinger, 1993
Theischinger (1993, 2002); Theischinger & Hawking (2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009).
Austroaeschna (Pulchaeschna) muelleri Theischinger, 1982
Fig. 20
Theischinger (1982, 1993, 2002); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Austroaeschna (Pulchaeschna) pulchra Tillyard, 1909
Tillyard (1916a) as A. unicornis-, Fraser (1959) as A. unicornis
pulchra-, Theischinger (1982, 1993, 2002, 2012); Hawking
(1986); Hawking & Theischinger (1999); Theischinger &
Hawking (2003, 2006); Theischinger & Endersby (2009).
*Genus Austroaeschna, Subgenus Pulchaeschna Peters &
Theischinger, 2007
Identification of all species can be confirmed by distributions.
Eungella region and Clarke Range: A. eungella-, Carnarvon
Range in southern inland Queensland: A. muelleri, most of
eastern Australia south of Eungella area: A. pulchra
(Theischinger 2002, 2012).
*Genus Austroaeschna Selys, 1883
The five subgenera Austroaeschna, Glaciaeschna,
Montiaeschna, Occidaeschna, Petersaeschna and
Pulchaeschna are clearly separable on morphological
differences (Theischinger 2012).
Austrophlebia costalis (Tillyard, 1907)
Fig. 21
Tillyard (1916a); Theischinger (1982, 1996, 2002, 2012);
Hawking & Theischinger 1999); Theischinger & Hawking
(2006); Peters & Theischinger (2007); Theischinger &
Endersby (2009); Hawking et al. (2013).
Austrophlebia subcostalis Theischinger, 1996
Theischinger (1996, 2002); Theischinger & Hawking (2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009).
*Genus Austrophlebia Tillyard, 1916
Identification can be confirmed by specific distributions.
North of Eungella-Paluma gap: A. subcostalis-, south of
Eungella-Paluma gap: A. costalis (Theischinger 2002).
However, the adults of both these species fly very well, and
overlap in distribution of the two species cannot completely be
excluded.
Dromaeschna forcipata (Tillyard, 1907)
Theischinger (1982, 2002), Theischinger & Hawking (2006),
all as Austroaeschna forcipata-, Theischinger & Endersby
(2009); Theischinger (2012).
Dromaeschna weiskei (Forster, 1908)
Theischinger (1982, 2002); Theischinger & Hawking (2006),
all as Austroaeschna weiskei, Theischinger & Endersby
(2009); Theischinger (2012).
*Genus Dromaeschna Forster, 1908
Reliable identification of the two often coexisting species can
be achieved based on morphology (Theischinger 1982;
Theischinger & Endersby 2009).
G. Theischinger & I. Endersby
Notoaeschna geminata Theischinger, 1982
Tillyard (1916a), as N. sagittata; Theischinger (1982, 2002);
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Notoaeschna sagittata (Martin, 1901)
Fig. 86
O’Farrell (1970); Theischinger (1982, 2002); Hawking (1986);
Watson & O’Farrell (1991); Watson et al. (1991); Hawking &
Smith (1997); Hawking & Theischinger (1999); Gooderham &
Tsyrlin (2002); Theischinger & Hawking (2003, 2006); Peters
& Theischinger (2007); Theischinger & Endersby (2009);
Hawking et al. (2013).
*Genus Notoaeschna Tillyard, 1916
At present confident identification of the two species is possible
only by their specific distributions. North of the Hunter River:
N. geminata-, south of the Hunter River: N. sagittata
(Theischinger 2002).
Spinaeschna tripunctata (Martin, 1901)
Fig. 22
Theischinger (1975, 1982, 2002); Hawking (1986, 1995);
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Peters & Theischinger (2007); Theischinger &
Endersby (2009); Hawking et al. (2013).
Spinaeschna watsoni Theischinger, 1982
Theischinger (1982, 2002); Theischinger & Hawking (2006);
Peters & Theischinger (2007); Theischinger & Endersby
(2009).
*Genus Spinaeschna Theischinger, 1982
Identification can be confirmed by specific distributions.
North of Eungella-Paluma gap: S. watsoni; New South Wales
and Victoria: S. tripunctata (Theischinger 2002).
Telephlebia brevicauda Tillyard, 1916
Fig. 23
O’Farrell (1970); Watson & O’Farrell (1991); Hawking (1986);
Hawking & Theischinger (1999); Theischinger (2002);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
Telephlebia cyclops Tillyard, 1916
Hawking & Theischinger (1999); Theischinger (2002);
Theischinger & Hawking (2003, 2006); Peters & Theischinger
(2007); Theischinger & Endersby (2009).
Telephlebia godeffroyi Selys, 1883
Tillyard (1916a); Watson & Theischinger (1980); Hawking &
Theischinger (1999); Theischinger (2002); Theischinger &
Hawking (2003, 2006); Peters & Theischinger (2007);
Theischinger & Endersby (2009).
Telephlebia tillyardi Campion, 1916
Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Telephlebia tryoni Tillyard, 1917
Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Telephlebia undia Theischinger, 1985
Larva not yet recognized.
*Genus Telephlebia Selys, 1883
Two ‘species groups’ can be distinguished based on the shape
of the paraprocts of male final instar larvae. Geography helps
specific identification (Theischinger 2002). Group A: North of
Paluma-Eungella gap: A. tillyardi ; Carnarvon N. P: T. undia
(but larva still undescribed); coastal south-eastern Queensland:
T. tryoni. Group B: Coastal south-eastern Queensland: T.
cyclops; south-eastern NSW south to approximately 35°S: T.
godeffroyi; NSW south of 35°S and Victoria: T. brevicauda.
Telephlebia larvae from north-eastern New South Wales may
belong to either T. cyclops or T. godeffroyi.
Family Petaluridae
A single genus clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Petalura gigantea Leach, 1815
Tillyard (1909a, 1910a, 1911a, 1917b, 1926), Schmidt (1941);
Watson (1958), incorrect; Williams (1980); Hawking &
Theischinger (1999); Gooderham & Tsyrlin (2002);
Theischinger (2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Petalura hesperia Watson, 1958
Fig. 24
Watson (1958, 1962); Williams (1980); Watson & O’Farrell
(1991); Watson et al. (1991); Theischinger (2002); Theischinger
& Hawking (2003, 2006); Theischinger & Endersby (2009).
Petalura ingentissima Tillyard, 1908
Andress (1998); Theischinger (2002); Theischinger &
Hawking (2006); Theischinger & Endersby (2009).
Petalura litorea Theischinger, 1999
Theischinger (2000a, 2002); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
89
Petalura pulcherrima Tillyard, 1913
Status doubtful (Ware et al. 2014).
*Genus Petalura Leach, 1815
Distributions support identifications based on morphology
(Theischinger 2002). Cape York and north-eastern Queensland
north of Paluma- Eungella gap: P. ingentissima/?pulcherrima;
coastal south-eastern Queensland and coastal north-eastern
New South Wales: P. litorea\ montane south-eastern
Queensland and most of eastern New South Wales: P. gigantea;
south-western Australia: P. hesperia.
Family Gomphidae
Two subfamilies, seven genera and several subgenera clearly
distinguishable on morphology (Theischinger & Hawking
2006, Theischinger & Endersby 2009, both under Gomphidae
and Lindeniidae; Hawking et al. 2013).
Ictinogomphus australis (Selys, 1873)
Figs 25, 87
Tillyard (1917b); Hawking (1993); Hawking & Smith (1997);
Theischinger (1998d, 2000b); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
Ictinogomphus dobsoni (Watson, 1969)
Theischinger (1998d, 2000b); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
Ictinogomphus paulini Watson, 1991
Larva not yet recognized.
* Gen us Ictinogomphus Cowley, 1934
Distributions largely support identifications based on
morphology (Theischinger 2000b; Theischinger & Endersby
(2009). Most of eastern and northern Australia: I. australis ;
Pilbara area and further west in Western Australia: I. dobsoni.
Ictinogomphus larvae from the tip of Cape York may belong to
either I. australis or I. paulini.
Antipodogomphus acolythus (Martin, 1901)
Figs 26, 88
Tillyard (1917b), as Austrogomphus manifestus\ Fraser (1959),
most probably as A. proselythus\ Theischinger (1998d, 2000b);
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009).
Antipodogomphus dentosus Watson, 1991
Hawking (1993); Theischinger (1998d, 2000b); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Antipodogomphus edentulus Watson, 1991
Larva not yet recognized.
Antipodogomphus hodgkini Watson, 1969
Theischinger (1998d, 2000b); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Antipodogomphus neophytus Fraser, 1958
Hawking (1993); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Antipodogomphus proselythus (Martin, 1901)
Theischinger (2007a); Theischinger & Endersby (2009). Fraser
(1959) most probably has to be referred to A. acolythus.
*Genus Antipodogomphus Fraser, 1951
Confident identifications based on morphology are not possible
at present. Only A. hodgkini has an exclusive range (Western
Australia: Pilbara area), and A. acolythus seems to be the only
species of the genus in New South Wales and Victoria
(Theischinger 2000b; Theischinger & Endersby 2009).
Armagomphus armiger (Tillyard, 1913)
Fig. 27
Watson (1962,1991), as Hemigomphus armiger, Theischinger
(1998d, 2000b); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Genus monotypic.
Austroepigomphus ( Austroepigomphus ) praeruptus (Selys,
1857)
Fig. 28
Theischinger (1998d, 2000b), Hawking & Theischinger
(1999), Theischinger (2004), all as Austrogomphus melaleucae;
Theischinger & Hawking (2006); Theischinger & Endersby
(2009). Subgenus monotypic.
Austroepigomphus ( Xerogomphus) gordoni (Watson, 1962)
Watson (1962), as Austrogomphus gordoni ; Theischinger
(1998d, 2000b);Theischinger & Hawking (2006); Theischinger
& Endersby (2009).
Austroepigomphus (Xerogomphus) turneri (Martin, 1901)
Fig. 89
Hawking (1993); Theischinger (1998d, 2000b; 2004);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
90
G. Theischinger & I. Endersby
Figs 25-36. Final instar larvae of Australian Gomphidae: (25) Ictinogomphus australis ; (26) Antipodogomphus acolythus\ (27) Armagomphus
armiger, (28) Austroepigomphus paeruptus\ (29) Austrogomphus (A.) australis ; (30) A. (A.) cornutus\ (31) A. (A.) mjobergi ; (32) A. (A.)
ochraceus\ (33) Austrogomphus (Pleiogomphus) amphiclitus\ (34) Hemigomphus heteroclytus\ (35) Odontogomphus donnellyv, (36)
Zephyrogomphus lateralis.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
91
* Gen us Austroepigomphus , Subgenus Xerogomphus Watson,
1991
Distributions confirm identifications (on the basis of
morphology) of the two species (Theischinger 2000b, 2004).
Central and Western Australia: A. gordoni; north-eastern and
northern Australia: A. turneri.
*Genus Austroepigomphus Fraser, 1951
South-eastern, rarely north-eastern, Australia: subgenus
Austroepigomphus ; north-eastern, central and western
Australia: subgenus Xerogomphus (Theischinger 2000b,
2004).
Austrogomphus (Austrogomphus) angelorum Tillyard, 1913
Larva not yet recognized.
Austrogomphus (Austrogomphus) arbustorum Tillyard, 1906
Theischinger (1998d, 2000b); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Austrogomphus (Austrogomphus) australis Dale, 1854
Fig. 29
Hawking (1986,1995); Theischinger (1998d, 2000b); Hawking
& Theischinger (1999); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Austrogomphus (Austrogomphus) collaris Hagen, 1854
Watson (1962); Watson et al. (1991); Theischinger (1998d,
2000b); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
Austrogomphus (Austrogomphus) cornutus Watson, 1991
Fig. 30
Hawking (1986), as Austrogomphus sp. “c”; Hawking & New
(1996); Theischinger (1998d, 2000b); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
Austrogomphus (Austrogomphus) doddi Tillyard, 1909
Larva not yet recognized.
Austrogomphus (Austrogomphus) guerini (Rambur, 1842)
O’Farrell (1970); Allbrook (1970); Hawking (1986); Watson &
O’Farrell (1991); Watson et al. (1991), Hawking & Smith
(1997), as A. ochraceus-, Theischinger (1998d, 2000b);
Hawking & Theischinger (1999); Gooderham & Tsyrlin
(2002); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009).
Austrogomphus (Austrogomphus) mjobergi Sjostedt, 1917
Fig. 31
Hawking (1993); Theischinger (1998d, 2000b); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Austrogomphus (Austrogomphus) mouldsorum Theischinger,
1999
Larva not yet recognized.
Austrogomphus (Austrogomphus) ochraceus (Selys, 1869)
Fig. 32
Tillyard (1916b, 1917b, 1926); Hawking (1986); Hawking &
New (1996); Theischinger (1998d, 2000b, 2004); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009).
Austrogomphus (Austrogomphus) pusillus Sjostedt, 1917
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
*Genus Austrogomphus, Subgenus Austrogomphus Selys,
1854
The larvae of two species, A. angelorum , probably restricted,
if still surviving, to the mature Murray River, and A.
mouldsorum, a large species possibly endemic to the
Kimberley, are still undescribed and assumed to be
recognisable when found. Other than that a single species and
four twin groups can confidently be separated based on
morphology. Three of the twin groups are identifiable to the
species by allopatry. Only A. guerini and A. ochraceus cannot
be distinguished at present. Of these two only A. guerini is
found in South Australia and Tasmania (Theischinger 2000b;
Theischinger & Endersby 2009).
Austrogomphus (Pleiogomphus) amphiclitus (Selys, 1873)
Fig. 33
Theischinger (1998d, 2000b, 2004); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
Austrogomphus (Pleiogomphus) bifurcatus Tillyard, 1909
Theischinger (1998d, 2000b); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Austrogomphus (Pleiogomphus) divaricatus Watson, 1991
Larva not available or inseparable from A. bifurcatus.
Austrogomphus (Pleiogomphus) prasinus Tillyard, 1906
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
92
G. Theischinger & I. Endersby
*Genus Austrogomphus, Subgenus Pleiogomphus Watson,
1991
Of the four species only A. amphiclitus can confidently be
identied on morphology, and it is also the only species found
over much of eastern and inland Queensland and New South
Wales, whereas the other three species are apparently restricted
to north-eastern Queensland (Theischinger 2000b;
Theischinger & Endersby 2009).
*Genus Austrogomphus Selys, 1854
The larvae of the two subgenera Austrogomphus and
Pleiogomphus are clearly separable on morphological
differences (Theischinger 2000b; Theischinger & Endersby
2009).
Hemigomphus atratus Watson, 1991
Larva not yet recognized.
Hemigomphus comitatus (Tillyard, 1909)
Theischinger (1998d, 2000b); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Hemigomphus cooloola Watson, 1991
Theischinger (1998d, 2000b); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Hemigomphus gouldii (Selys, 1854)
Williams (1980); Hawking (1986); Hawking & New (1996);
Hawking & Smith (1997); Theischinger (1998d, 2000b);
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009).
Hemigomphus heteroclytus Selys, 1854
Figs 34, 90
Tillyard (1910a, 1914, 1916b, 1917b); Hawking (1986);
Theischinger (1998d, 2000b); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009); Hawking et al. (2013).
Hemigomphus magela Watson, 1991
Hawking (1993); Theischinger (1998d, 2000b); Theischinger
& Hawking (2006); Peters & Theischinger (2007);
Theischinger & Endersby (2009).
Hemigomphus theischingeri Watson, 1991
Theischinger (1998d, 2000b); Theischinger & Hawking (2003,
2006); Theischinger & Endersby (2009).
*Genus Hemigomphus Selys 1854
H. cooloola and H. magela have characters different from the
morphologically rather uniform remaining species. In addition
H. magela has a restricted geographical range within the
Northern Territory, whereas H. atratus (larva still unknown),
H. comitatus and H. theischingeri are restricted to north¬
eastern Queensland and H. gouldii and H. heteroclytus are
more or less confined to south-eastern Australia. Only H.
heteroclytus, the only Hemigomphus occurring in southern
inland Queensland, slightly overlaps the range of the three
north-eastern species (Theischinger 2000b; Theischinger &
Endersby 2009).
Odontogomphus donnellyi Watson, 1991
Fig. 35
Watson (1991), under Genus Odontogomphus-, Theischinger
(1998d, 2000b); Theischinger & Hawking (2006); Theischinger
& Endersby (2009); Hawking et al. (2013). Genus monotypic.
Zephyrogomphus lateralis (Selys, 1873)
Fig. 36
Watson (1962), as Austrogomphus lateralis-, Theischinger
(1998d, 2000b); as Austrogomphus (Zephyrogomphus )
lateralis-, Theischinger (2004); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Zephyrogomphus longipositor (Watson, 1991)
Theischinger (1998d, 2000b), as ?Austrogomphus
(?Zephyrogomphus) longipositor, Theischinger (2004);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009).
*Genus Zephyrogomphus Watson, 1991
Widely disjunct distributions confirm identification based on
morphology of the two species (Theischinger 2000b;
Theischinger & Endersby 2009).
Family Synthemistidae
Eight genera distinguishable on morphology, two of them,
Choristhemis and Eusynthemis difficult (Theischinger &
Hawking 2006; Theischinger & Endersby 2009; Hawking et
al. 2013).
Archaeosynthemis leachii (Selys, 1871)
Fig. 37
Watson (1967); Watson et al. (1991); Theischinger (2001a);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009); Hawking et al. (2013).
Archaeosynthemis occidentalis (Tillyard, 1910)
Watson (1962, 1967), Watson & O’Farrell (1991, 1994), all as
Synthemis macrostigma-, Watson et al. (1991), as Synthemis
macrostigma occidentalis-, Theischinger (2001a); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
93
Figs 37-48. Final instar larvae of Australian Anisoptera: (37-44) Synthemistidae (with insert of frontal plate): (37) Archaeosynthemis leachii:
(38) Austrosynthemis cyanitincta\ (39) Choristhemis flavoterminata ; (40) Eusynthemis Ursula ; (41) Parasynthemis regina\ (42) Synthemiopsis
gomphomacromioides\ (43) Synthemis eustalacta\ (44) Tonyosynthemis claviculata\ (45) Macromia tillyardi (Macromiidae); (46-48) Corduliidae:
(46) Hemicordulia tau; (47) Pentathemis mebranulata; (48) Procordulia jacksoniensis.
94
G. Theischinger & I. Endersby
Archaeosynthemis orientalis (Tillyard, 1910)
Tillyard (1910b, 1914, 1916b, 1917b), O’Farrell (1970),
Allbrook (1979), Hawking (1986), Watson & O’Farrell (1991),
Watson et al. (1991), all as Syntliemis macrostigma-, Hawking
& Theischinger (1999), as Archaeosynthemis macrostigma-,
Theischinger (2001a); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009).
Archaeosynthemis spiniger (Tillyard, 1913)
Watson (1962, 1967), as Syntliemis spiniger, Theischinger
(2001a); Theischinger & Hawking (2006); Theischinger &
Endersby (2009).
*Genus Archaeosynthemis Carle, 1995
Confident identifications based on morphology can be achieved
for the three south-western Australian species S. leachii, S.
occidentalis and S. spiniger, S. orientalis is the only species
from south-eastern Australia (Theischinger 2001a;
Theischinger & Endersby 2009).
Austrosynthemis cyanitincta (Tillyard, 1908)
Fig. 38
Watson (1962, 1967), as Synthemis cyanitincta-, Watson et al.
(1991); Theischinger (1998a, 2001a); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013). Genus monotypic.
Choristhemis flavoterminata (Martin, 1901)
Fig. 39
Tillyard (1910b); Hawking & Theischinger (1999);
Theischinger (2001a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Choristhemis olivei (Tillyard, 1909)
Theischinger (2003); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
*Genus Choristhemis Tillyard, 1910
Confident morphology based identifications should be possible
(Theischinger 2001a, 2003), but all larvae from south of the
Daintree River, certainly from south of the Paluma-Eungella
gap, can be confirmed as C. flavoterminata.
Eusynthemis aurolineata (Tillyard, 1913)
Theischinger (1998e); Hawking & Theischinger (1999);
Theischinger (2001); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Eusynthemis barbarae (Moulds, 1985)
Theischinger (2001a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Eusynthemis brevistyla (Selys, 1871)
Hawking (1986, 1995); Hawking & Theischinger (1999);
Theischinger (2001a); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009).
Eusynthemis deniseae Theischinger, 1977
Theischinger (1977, 2001a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Eusynthemis guttata (Selys, 1871)
Theischinger (1995, 1998e, 2001a); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
& Endersby (2009). Tillyard (1910b) and Hawking (1986) have
to be referred to E. tillyardi.
Eusynthemis netta Theischinger, 1999
Larva not yet recognized.
Eusynthemis nigra (Tillyard, 1906)
Hawking & Theischinger (1999); Theischinger (2001a);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009).
Eusynthemis rentziana Theischinger, 1998
Theischinger (1998e; 2001a); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009).
Eusynthemis tenera Theischinger, 1995
Larva not yet recognized.
Eusynthemis tillyardi Theischinger, 1995
Tillyard (1910b, 1916b), Hawking (1986), all as E. guttata-,
Theischinger (1995, 1998e); Hawking & Theischinger (1999);
Theischinger (2001a); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009); Hawking et al. (2013).
Eusynthemis ursa Theischinger, 1999
Larva not yet recognized.
Eusynthemis Ursula Theischinger, 1998
Fig. 40
Theischinger (2000a, 2001a); Theischinger & Hawking (2000,
2006); Theischinger & Endersby (2009).
Eusynthemis virgula (Selys, 1874)
Fig. 91
Hawking (1986); Hawking & Theischinger (1999);
Theischinger (2001a); Theischinger & Hawking (2003, 2006);
Theischinger & Endersby (2009).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
95
* Gen us Eusynthemis Forster, 1903
Based on the morphology of the described larvae three groups
can be distinguished: E. Ursula-, E. brevistyla and E. virgula;
the remaining species (Theischinger 2001a; Theischinger &
Endersby 2009). It is supposed that E. ursa (larva still
undescribed) will closely resemble E. Ursula and that E. netta,
the adults of which are quite distinct, will be recognisable
when found. Firm geographical support for specific
identification is not available but the specific ranges
(Theischinger 2001a; Theischinger & Endersby 2009) should
be looked at when morphology based results appear doubtful.
Parasynthemis regina (Selys, 1874)
Fig. 41
Tillyard (1910b), Hawking (1986), both as Synthemis regina;
Hawking & Theischinger (1999); Theischinger (2001a);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Hawking et al. (2013). Genus monotypic.
Synthemiopsis gomphomacromioides Tillyard, 1917
Fig. 42
Theischinger (2000d, 2001a); Gooderham & Tsyrlin (2002), as
Synthemiopsis; Theischinger & Hawking (2006); Theischinger
& Endersby (2009); Hawking et al. (2013). Tillyard (1917b),
Allbrook (1979), both to be referred to a different synthemistid
species. Genus monotypic.
Synthemis eustalacta (Burmeister, 1839)
Fig. 43
Tillyard (1910b, 1917b, 1926); O’Farrell (1970); Williams
(1980); Hawking (1986); Watson & O’Farrell (1991, 1994);
Hawking & Smith (1997); Hawking & Theischinger (1999);
Theischinger (2001a, 2010); Theischinger & Hawking (2003,
2006); Theischinger & Endersby (2009); Hawking et al.
(2013).
Synthemis tasmanica Tillyard, 1910
Allbrook (1979); Theischinger (2001a); Theischinger &
Hawking (2006); Theischinger & Endersby (2009).
*Genus Synthemis Selys, 1870
Confirmation of morphology based specific identification by
available distributions (Theischinger 2001a; Theischinger &
Endersby 2009)). Mainland Australia: S. eustalacta; Tasmania:
S. tasmanica. However, Synthemis larvae from the west of
Victoria and eastern South Australia agree with S. tasmanica
and may well be this species.
Tonyosynthemis claviculata (Tillyard, 1909)
Fig. 44
Theischinger 1998a, 2001a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
Tonyosynthemis ofarrelli (Theischinger & Watson, 1986)
Theischinger (1998a, 2001a, 2010); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
*Genus Tonyosynthemis Theischinger, 1998
Confident specific identification possible only by considering
distributions (Theischinger 1998a, 2001a). North of Paluma-
Eungella gap: T. claviculata; south-eastern Queensland and
north-eastern New South Wales: T. ofarrelli.
Family Macromiidae
Only a single genus clearly distinguishable on morphology
(Theischinger & Hawking 2006; Theischinger & Endersby
2009; Hawking et al. 2013).
Macromia tillyardi Martin, 1906
Fig. 45
Hawking (1993); Theischinger (2001a); Theischinger &
Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013).
Macromia viridescens Tillyard, 1911
Theischinger (2001a); Theischinger & Hawking (2006);
Theischinger & Endersby (2009).
*Genus Macromia Rambur, 1842
Identifications are reliable based on morphology (Theischinger
2001). It seems clear that M. viridescens is restricted to Cape
York peninsula but existence there of M. tillyardi cannot be
excluded.
Family Corduliidae
Four genera clearly distinguishable on morphology
(Theischinger & Hawking 2006, under Corduliidae and
Hemicorduliidae; Theischinger & Endersby 2009; Hawking et
al. 2013).
Hemicordulia australiae (Rambur, 1842)
Watson (1962), O’Farrell (1970); Allbrook (1979); Williams
(1980), Hawking (1986); Watson & O’Farrell (1991); Hawking
& Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Hemicordulia continentalis Martin, 1907
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger (2007a); Theischinger & Endersby
(2009).
Hemicordulia flava Theischinger & Watson, 1991
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
96
G. Theischinger & I. Endersby
Hemicordulia intermedia (Selys, 1871)
Hawking (1993); Hawking & Theischinger (1999);
Theischinger & Fleck (2003); Theischinger & Hawking (2003,
2006); Theischinger (2007a); Theischinger & Endersby
(2009).
Hemicordulia kalliste Theischinger & Watson, 1991
Larva not yet recognized.
Hemicordulia koomina Watson, 1969
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Hemicordulia superba Tillyard, 1911
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009).
Hemicordulia tau (Selys, 1871)
Fig. 46
Tillyard (1914, 1915b, 1916b, 1917b, 1926, 1932); Watson (1962,
1968); O’Farrell (1970); Allbrook (1979); Williams (1980);
Hawking (1986,1993,1995); Watson & O’Farrell (1991); Watson
et al. (1991); Hawking & Smith (1997); Ingram et al. (1997);
Hawking & Theischinger (1999); Gooderham & Tsyrlin (2002);
Theischinger & Hawking (2003, 2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Hemicordulia Selys, 1870
The larvae of each of H. australiae, H. flava and H. superba
can be identified based on morphology (Theischinger 2007a).
Of the morpho-group H. intermedia and H. koomina only H.
intermedia has a wide geographical range including northern,
central and much of eastern Australia so that only identifications
from the Pilbara area are doubtful. Of the morpho-group H.
tau, H. continentalis and H. kalliste it appears that H. kalliste
is the only species at, and restricted to, the extreme north of
Australia, whereas H. tau is the only one occurring in Western
Australia, central and most of southern Australia.
Metaphya tillyardi Ris, 1913
Larva not yet recognized. Sole species of the genus in
Australia. Some information on the larva of M. elongata
Campion, 1921, made available by Fleck (2007) is produced
by Theischinger & Endersby (2009) in order to give an idea of
what the still undescribed larva of M. tillyardi may look like.
Pentathemis membranulata Karsch, 1890
Fig. 47
Hawking (1993); Young (2001); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009); Hawking et al. (2013). Genus monotypic.
Procordulia affinis (Selys, 1871)
Watson (1962); Theischinger & Hawking (2006); Theischinger
(2007a); Theischinger & Endersby (2009).
Procordulia jacksoniensis (Rambur, 1842)
Fig. 48
O’Farrell (1970); Allbrook (1979); Hawking (1986); Watson &
O’Farrell (1991); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Procordulia Martin, 1907
Identifications of the two species based on morphology are
confirmed beyond any doubt by their widely disjunct
distributions (Theischinger 2007a). Southwestern Australia: P.
affinis-, eastern Australia and South Australia: P. jacksoniensis.
Family Libellulidae
Of 27 genera four, Crocothemis, Diplacodes, Nannodiplax
and Neurothemis, are difficult to distinguish from each other,
and of two, Notolibellula and Raphismia, the larvae are still
undescribed (Theischinger & Hawking 2006, under
Urothemistidae and Libellulidae; Theischinger & Endersby
2009; Hawking et al. 2013).
Aethriamanta circumsignata Selys, 1897
Hawking (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013), as
Aethriamanta.
Aethriamanta nymphaeae Lieftinck, 1949
Fig. 49
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
*Genus Aethriamanta Kirby, 1889
The known morphological characters (Hawking 1993) appear
insufficient to distinguish the two species. Only A.
circumsignata has hitherto been found to occur in New South
Wales (Theischinger 2007a; Theischinger & Endersby 2009).
Agrionoptera insignis allogenes Tillyard, 1908
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013).
Agrionoptera longitudinalis biserialis Selys, 1879
Fig. 50
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
97
Figs 49-60. Final instar larvae of Australian Libellulidae: (49) Aethriamanta nymphaeae; (50) Agrionoptera longitudinalis; (51) Austrothemis
nigrescens; (52) Brachydiplax denticaudcr, (53) Camacinia gigantecr, (54) Crocothemis nigrifrons; (55) Diplacodes haematodes; (56) Huonia
melvillensis; (57) Hydrobasisleus brevistylus; (58) Macrodiplax corn; (59) Nannodiplax rubra; (60) Nannophlebia risi.
98
G. Theischinger & I. Endersby
* Genus Agrionoptera Brauer, 1854
The two species can confidently be identified based only on
morphology. Only A. insignis ranges south and west beyond
tropical Queensland (Theischinger 2007a; Theischinger &
Endersby 2009).
Austrothemis nigrescens (Martin, 1901)
Fig. 51
Watson (1962); Allbrook (1979); Hawking (1986); Hawking &
Smith (1997); Hawking & Theischinger (1999); Theischinger
& Hawking (2003, 2006); Theischinger (2007a); Theischinger
& Endersby (2009); Hawking et al. (2013). Genus monotypic.
Brachydiplax denticauda (Brauer, 1867)
Fig. 52
Hawking (1993); Theischinger & Hawking (2006); Theischinger
(2007a); Theischinger & Endersby (2009); Hawking et al. (2013).
Brachydiplax duivenbodei (Brauer, 1866)
Larva not yet recognized.
* Genus Brachydiplax Brauer, 1868
Only Brachydiplax larvae from south of the Paluma-Eungella
gap can with high probability be confirmed as B. denticauda
(Theischinger 2007a).
Camacinia othello Tillyard, 1908
(Fig. 53, C. gigantea )
Larva not yet recognized. Sole species of Camacinia in
Australia. It is assumed that the larva of C. othello will be
found to be very similar to its closely related congener C.
gigantea which should be used as a substitute to allow
identification of C. othello in future (Theischinger & Hawking
2006; Theischinger & Endersby 2009; Hawking et al. 2013).
Crocothemis nigrifrons (Kirby, 1894)
Fig. 54
Watson (1962); Hawking (1986, 1993); Hawking & Smith
(1997); Hawking & Theischinger (1999); Theischinger &
Hawking (2003, 2006); Theischinger (2007a); Theischinger &
Endersby (2009); Hawking et al. (2013). Sole species of
Crocothemis in Australia. Difficult to distinguish from
Diplacodes , Nannodiplax and Neurothemis.
Diplacodes bipunctata (Brauer, 1865)
Tillyard (1917b, 1926); Lieftinck (1962); Watson (1962);
O’Farrell (1970); Hawking (1986, 1993); Watson & O’Farrell
(1991); Watson et al. (1991); Rowe (1992); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Diplacodes haematodes (Burmeister, 1839)
Fig. 55
Tillyard (1914, 1916b, 1917b); Watson (1962); Williams (1980);
Hawking (1986, 1993); Hawking & New (1996); Hawking &
Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Diplacodes melanopsis (Martin, 1901)
Hawking (1986); Hawking & Theischinger (1999);
Theischinger & Hawking (2003, 2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013).
Diplacodes nebulosa (Fabricius, 1793)
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Diplacodes trivialis (Rambur, 1842)
Lieftinck (1962); Kumar (1977); Hawking (1993); Theischinger
& Hawking (2006); Theischinger (2007a); Theischinger &
Endersby (2009).
*Genus Diplacodes Kirby, 1889
Morphological differences separate either of D. haematodes
and D. melanopsis from the remainder of this genus and from
Nannodiplax rubra, whereas D. bipunctata morphologically
pairs up with D. trivialis and D. nebulosa pairs up with N.
rubra. Confident identifications can be achieved for only D.
bipunctata from Western Australia, central and southern
Australia and N. rubra from the Kimberley (Theischinger
2007a; Theischinger & Endersby 2009).
Huonia melvillensis Brown & Theischinger, 1998
Fig. 56
Theischinger & Brown (2002); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009); Hawking et al. (2013). Sole species of Huonia in
Australia.
Hydrobasileus brevistylus (Brauer, 1865)
Fig. 57
Fraser (1963); Hawking (1993); Hawking & Theischinger
(1999); Theischinger & Hawking (2006); Theischinger
(2007a); Theischinger & Endersby (2009); Hawking et al.
(2013). Sole species of Hydrobasileus in Australia.
Lathrecista asiatica festa (Selys, 1879)
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009). The larva referred to in
these three papers was identified by supposition only. Sole
species of Lathrecista in Australia.
Macrodiplax cora (Kaup, 1867)
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
99
Fig. 58
Lieftinck (1962); Watson (1962); Hawking (1993); Hawking &
Theischinger (1999); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013). Sole species of Macrodiplax in
Australia.
Nannodiplax rubra Brauer, 1868
Fig. 59
Hawking (1993); Hawking & Theischinger (1999); Theischinger
& Hawking (2006); Theischinger (2007a); Theischinger &
Endersby (2009). Genus monotypic. Larva at present
indistinguishable from Diplacodes nebulosa, but can be identified
if found in the Kimberley (see under Genus Diplacodes ).
Nannophlebia eludens Tillyard, 1908
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Nannophlebia injibandi Watson, 1969
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Nannophlebia mudginberri Watson & Theischinger, 1991
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Nannophlebia risi Tillyard, 1913
Fig. 60
Tillyard (1913); Hawking (1986, 1995); Hawking &
Theischinger (1999); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013).
*Genus Nannophlebia Selys, 1878
Distributions confirm Nannophlebia larvae from New South
Wales and Victoria as N. risi. Larvae from north-eastern
Australia may be either N. risi or N. eludens , whereas larvae
from northern and Western Australia may be either N. eludens,
N. injibandi or N. mudginberri (Theischinger 2007a;
Theischinger & Endersby 2009).
Nannophya australis Brauer, 1865
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger (2007); Theischinger & Endersby
(2009).
Nannophya dalei (Tillyard, 1908)
Fig. 92
Allbrook (1979); Hawking (1986); Hawking & Theischinger
(1999); Theischinger & Hawking (2003, 2006); Theischinger
(2007a); Theischinger & Endersby (2009); Hawking et al.
(2013).
Nannophya occidentalis (Tillyard, 1908)
Watson (1962); Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Nannophya paulsoni Theischinger, 2003
Larva not yet recognized.
Nannophya sp.
Fig. 61
Status uncertain; known only from larvae from near
Barcaldine, Queensland.
*Genus Nannophya Rambur, 1842
Distributions confirm most of the identifications based on
morphology (Theischinger 2007a). Larvae from the very north
of Australia may belong to either N. australis or N. paulsoni
(larva still undescribed).
Neurothemis oligoneura Brauer, 1867
Larva not yet recognized.
Neurothemis stigmatizans (Fabricius, 1775)
Fig. 62
Lieftinck (1962); Hawking (1993); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009); Hawking et al. (2013). Difficult to distinguish from
Crocothemis, Diplacodes and Nannodiplax.
*Genus Neurothemis Brauer, 1867
Neurothemis larvae from the very north of Australia may
belong to either N. stigmatizans or to N. oligoneura, but only
N. stigmatizans occurs in the Kimberley and in south-eastern
Queensland and north-eastern New South Wales (Theischinger
2007a).
Notolibellula bicolor Theischinger & Watson, 1977
Larva not yet recognized. Genus monotypic.
Orthetrum balteatum Lieftinck, 1933
Hawking & Theischinger (2002); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009). The larva was identified by supposition only.
Orthetrum boumiera Watson & Arthington, 1978
Watson & Arthington (1978), with error as pointed out in
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger (2007a); Theischinger & Endersby
(2009).
100
G. Theischinger & I. Endersby
Figs 61-72. Final instar larvae of Australian Libellulidae: (61) Nannophya sp. (from Barcaldine); (62) Neurothemis stigmatizans; (63) Orthetrum
caledonicum; (64) Pantala flavescens; (65) Potamarcha congener, (66) Rhodothemis lieftincki; (67) Rhyothemis princeps; (68) Tetrathemis
irregularis; (69) Tholymis tillarga; (70) Tramea stenoloba; (71) Urothemis aliena; (72) Zyxomma elgneri.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
101
Orthetrum caledonicum (Brauer, 1865)
Figs 63, 93
Tillyard (1916b, 1917b); Watson (1962); O’Farrell (1970);
Watson & Arthington (1978); Hawking (1986, 1993, 1995);
Watson & O’Farrell (1991), Hawking & New (1996); Hawking
& Smith (1997); Hawking & Theischinger (1999); Theischinger
& Hawking (2003, 2006); Theischinger (2007a); Theischinger
& Endersby (2009); Hawking et al. (2013).
Orthetrum migratum Lieftinck, 1951
Watson & Arthington (1978); Hawking (1993); Theischinger
& Hawking (2006); Theischinger (2007a); Theischinger &
Endersby (2009).
Larva not identifiable at present.
Orthetrum sabina (Drury, 1770)
Needham (1904); Watson & Arthington (1978); Hawking (1993);
Hawking & Theischinger (1999); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby (2009).
Orthetrum serapia Watson, 1984
Larva not yet recognized.
Orthetrum villosovittatum (Brauer, 1868)
Watson & Arthington (1978); Hawking (1986, 1993);
Theischinger & Hawking (2003, 2006); Theischinger (2007a);
Theischinger & Endersby (2009).
* Gen us Orthetrum Newman, 1833
Distributions confirm identifications on morphological basis
from New South Wales and Victoria as O. sabina and O.
villosovittatum and from north-western Australia as O.
migratum. Larvae from northern Australia identified based on
morphology as O. sabina may belong to either O. sabina or O.
serapia. O. caledonicum can also be confidently identified if
the larvae do not come from coastal south-eastern Queensland
and coastal north-eastern New South Wales where O.
boumiera occurs in dune situations (Theischinger 2007a).
Pantala flavescens (Fabricius, 1798)
Fig. 64
Cabot (1890), Lieftinck (1962); Watson (1962); Hawking (1993);
Hawking & Ingram (1994); Hawking & Smith (1997); Hawking
& Theischinger (1999); Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013). Sole species of Pantala in Australia.
Potamarcha congener (Rambur, 1842)
Fig. 65
Kumar (1977); Van Tol (1992); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013). Sole species of Potamarcha in Australia.
Raphismia bispina (Hagen, 1867)
Larva not yet recognized. Sole species of Raphismia in
Australia.
Rhodothemis lieftincki Fraser, 1954
Fig. 66
Hawking (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013). Sole
species of Rhodothemis in Australia.
Rhyothemis braganza Karsch, 1890
Hawking (1993); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Rhyothemis graphiptera (Rambur, 1842)
Hawking (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013).
Rhyothemisphyllis (Sulzer, 1776)
Lieftinck (1962); Hawking & Theischinger (1999);
Theischinger (2000a, 2007a); Theischinger & Hawking
(2006); Theischinger & Endersby (2009).
Rhyothemisprinceps Kirby, 1894
Fig. 67
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Rhyothemis resplendens Selys, 1878
Larva not yet recognized.
*Genus Rhyothemis Hagen, 1867
Larvae from tropical Queensland identified as either R.
braganza, R. graphiptera, R. phyllis or R. princeps may
belong to R. resplendens the larva of which is still undescribed,
whereas Rhyothemis larvae collected outside of tropical
Queensland can confidently be identified on morphology
(Theischinger 2007a).
Tetrathemis irregularis cladophila Tillyard, 1908
Fig. 68
Theischinger & Fleck (2003); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009); Hawking et al. (2013). Sole species of Tetrathemis in
Australia.
102
G. Theischinger & I. Endersby
Tholymis tillarga (Fabricius, 1798)
Fig. 69
Lieftinck (1962); Hawking (1993); Theischinger & Hawking
(2006); Theischinger (2007a); Theischinger & Endersby
(2009); Hawking et al. (2013). Sole species of Tholymis in
Australia
Tramea eurybia Selys, 1878
Larva not yet recognized.
Tramea loewii Kaup, 1866
Tillyard (1917b, 1926); Hawking (1986, 1993), all as
Trapezostigma loewii-, Theischinger & Hawking (2003, 2006);
Theischinger (2007a); Theischinger & Endersby (2009);
Hawking et al. (2013).
Tramea propinqua Lieftinck, 1942
Lieftinck (1962); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
Tramea stenoloba (Watson, 1962)
Fig. 70
Watson (1962), Hawking (1993), both as Trapezostigma
stenoloba-, Theischinger & Hawking (2006); Theischinger
(2007a); Theischinger & Endersby (2009).
Larva not identifiable at present.
*Genus Tramea Hagen, 1861
Distributions confirm only identification of Tramea larvae
from southern New South Wales and Victoria as T. loewii.
Tramea larvae from north-eastern New South Wales may
belong to either T. loewii or T. eurybia, from inland (including
northern) and Western Australia either to T. loewii or T.
stenoloba, whereas all four Tramea species may have to be
considered in north-eastern Australia (Theischinger 2007a).
Urothemis aliena Selys, 1878
Fig. 71
Hawking (1993); Burwell & Theischinger (2003); Theischinger
& Hawking (2006); Theischinger & Endersby (2009); Hawking
et al. (2013). Sole species of the genus in Australia.
Zyxomma elgneri Ris, 1913
Fig. 72
Hawking (1993); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009); Hawking et al. (2013).
Zyxomma multinervorum Carpenter, 1897
Larva not yet recognized.
Zyxomma petiolatum Rambur, 1842
Lieftinck (1962); Hamada & Inoue (1985), not conforming to
Lieftinck (1962); Theischinger & Hawking (2006);
Theischinger (2007a); Theischinger & Endersby (2009).
*Genus Zyxomma Rambur, 1842
The larva of Z. multinervorum is still unknown and non-
conforming descriptive information is available for Z.
petiolatum. All three species inhabit northern Queeensland
and Northern Territory, but only Zyxomma elgneri occurs in
southern Queensland, New South Wales and north-western
Australia (Theischinger 2007a).
Genera Incertae Sedis
Nine genera clearly distinguishable on morphology; several
very distinct units distinguishable but without general
taxonomic recognition (Theischinger & Hawking 2006, under
Gomphomacromiidae, Pseudocorduliidae, Austrocorduliidae,
Cordulephyidae and Oxygastridae; Theischinger & Endersby
2009, under Gomphomacromiidae, Pseudocorduliidae,
Austrocorduliidae and Cordulephyidae; Hawking et al. 2013).
Archaeophya adamsi Fraser, 1959
Fig. 73
Theischinger & Watson (1984); Hawking & Theischinger
(1999); Theischinger (2001a); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013).
Archaeophya magnifica Theischinger & Watson, 1978
Theischinger (1978), as Gomphomacromiinae sp.; Williams
(1980), as Archaeophya-, Theischinger & Watson (1984);
Hawking (1995); Theischinger (2001a); Theischinger &
Hawking (2006); Theischinger & Endersby (2009).
*Genus Archaeophya Fraser, 1959
Identifications based on morphology can be confirmed by the
widely disjunct distributions (Theischinger 2001a) . Tropical
Queensland: A. magnifica-, greater Sydney area: A. adamsi.
(Theischinger et al. 2011)
Pseudocordulia circularis Tillyard, 1909
Fig. 94
Larva not identifiable/?available.
Pseudocordulia elliptica Tillyard, 1913
Fig. 94
Larva not identifiable/?available.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
103
Figs 73-81. Final instar larvae of Australian Libelluloidea of genera incertae sedis: (73) Archaeophya adamsv, (74) Cordulephya pygmaecr, (75)
Apocordulia macrops\ (76) Austrocordulia leonardv, (77) Austrophya my Stic a\ (78) ?Austrophya sp.; (79) Hesperocordulia berthoudv, (80)
Lathrocordulia metallica ; (81) Micromidia convergens.
104
G. Theischinger & I. Endersby
*Genus Pseudocordulia Tillyard, 1909
Watson (1982), Theischinger & Watson (1984), Theischinger
(2001a, 2010), Theischinger & Hawking (2006), Theischinger
& Endersby (2009), Hawking etal. (2013), all as Pseudocordulia
sp. The adults of the two Pseudocordulia species are extremely
similar, and apparently the two species usually coexist
(Theischinger & Watson 1978). Specific identification will
probably be difficult even when larvae associated with adults
of both species become available.
Cordulephya bidens Sjostedt, 1917
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Cordulephya divergens Tillyard, 1917
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Cordulephya montana Tillyard, 1911
Tillyard (1911b, 1917b); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a);
Theischinger & Endersby (2009).
Cordulephya pygmaea Selys, 1870
Fig. 74
Tillyard (1911b, 1914, 1916b, 1917b); Williams (1980),
Hawking (1986); Hawking & Theischinger (1999);
Theischinger & Hawking (2006); Theischinger (2007a, 2010);
Theischinger & Endersby (2009); Hawking et al. (2013).
*Genus Cordulephya Selys, 1870
Cordulephya larvae identified from north of the Paluma-
Eungella gap can be confirmed by distribution as C. bidens. C.
pygmaea is probably the only species in Queensland south of
the Paluma-Eungella gap (Theischinger 2007a). C. pygmaea ,
C. divergens and C. montana may coexist in south-eastern
Australia and distinguishing C. pygmaea from C. divergens /
montana from there is difficult and often doubtful. Separating
larvae of C. divergens and C. montana is not possible at
present.
Apocordulia macrops Watson, 1980
Fig. 75
Theischinger & Watson (1984); Hawking (1986); Hawking &
Theischinger (1999); Theischinger (2001a, 2009, 2010);
Theischinger & Hawking (2003, 2006); Theischinger &
Endersby (2009); Theischinger et al. (2012, 2013); Hawking et
al. (2013).
Genus monotypic.
Austrocordulia leonardi Theischinger, 1973
Fig. 76
Theischinger (1973, 2001a, 2010); Theischinger & Watson
(1984); Hawking & Theischinger (1999); Theischinger &
Hawking (2006); Theischinger & Endersby (2009);
Theischinger et al. (2009, 2013).
Austrocordulia refracta Tillyard, 1909
Tillyard (1910c, 1914,1916b 1917b); Theischinger (1973, 1999,
2001a, 2010); Theischinger & Watson (1984); Hawking (1986);
Hawking & Theischinger (1999); Theischinger & Hawking
(2003, 2006); Theischinger & Endersby (2009); Theischinger
et al. (2009).
Austrocordulia territoria Theischinger & Watson, 1978
Theischinger & Watson (1984); Hawking (1993); Theischinger
(2001a); Theischinger & Hawking (2006); Theischinger &
Endersby (2009); Hawking et al. (2013).
*Genus Austrocordulia Tillyard, 1909
A significant disjunction exists between the ranges of A.
territoria (north of Northern Territory) and A. leonardi
(eastern New South Wales). A disjunction also exists between
the ranges of A. territoria and A. refracta (eastern Australia)
which in eastern New South Wales coexists in places with A.
leonardi. However, exclusive geographical ranges are not
necessary for confident identifications of the three species
(Theischinger 2001a).
Austrophya mystica Tillyard, 1909
Fig. 77
Theischinger & Watson (1984); Theischinger (2001a, 2010);
Theischinger & Hawking (2006); Theischinger & Endersby
(2009); Hawking et al. (2013). Genus possibly monotypic.
?Austrophya sp.
Fig. 78
Theischinger (2001a), as Genus “L”, species”m”.
*Genus Austrophya Tllyard, 1909
There are marked morphological and size differences between
A. mystica and A. sp. It is not considered certain that A. sp. is
congeneric with A. mystica.
Hesperocordulia berthoudi Tillyard, 1911
Fig. 79
Ris (1910), as larva E; Watson (1962); Theischinger & Watson
(1984); Theischinger (2001a, 2010); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013). Genus monotypic.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
105
Figs 82-94. Larvae of Australian Odonata: (82) Synlestes weyersii (Synlestidae); (83) Griseargiolestes intermedins (Argiolestidae); (84)
Xanthagrion erythronearum (Coenagrionidae); (85, 86) Aeshnidae: (85) Anax papuensis', (86) Notoaesclma sagittatcr, (87- 90) Gomphidae: (87)
Ictinogiomphus australis ; (88) Antipodogomphus acolythus; (89) Austroepigomphus (Xerogomphus) turneri\ (90) Hemigomphus heteroclytus ;
(91) Eusynthemis virgula (Synthemistidae); (92, 93) Libellulidae: (92) Nannophya dalev, (93) Orthetrum caledonicum\ (94) Pseudocordulia sp.
(Libelluloidea genera incertae sedis).
106
G. Theischinger & I. Endersby
Lathrocordulia garrisoni Theischinger & Watson, 1991
Larva not available.
Lathrocordulia metallica Tillyard, 1911
Fig. 80
Watson (1962); Theischinger & Watson (1984); Theischinger
(2001a, 2010); Theischinger & Hawking (2006); Theischinger
& Endersby (2009); Hawking et al. (2013).
*Genus Lathrocordulia Tillyard, 1911
The significant disjunction between the ranges of L. metallica
(south-western Australia) and A. garrisoni (tropical
Queensland) should be sufficient to establish or support
confident identification of the two species once the larva of L.
garrisoni is discovered (Theischinger 2001a; Theischinger &
Endersby 2009).
Micromidia atrifrons (McLachlan, 1883)
Theischinger (1978), as Gomphomacromiinae sp.;
Theischinger & Watson (1984); Hawking & Theischinger
(1999); Theischinger (2001a); Theischinger & Hawking
(2006); Theischinger & Endersby (2009); Hawking et al.
(2013).
Micromidia convergens Theischinger & Watson, 1978
Fig. 81
Theischinger & Watson (1984), as Micromidia “1”; Hawking &
Theischinger (1999); Theischinger (2001a, 2010); Theischinger
& Hawking (2006); Theischinger & Endersby (2009).
Micromidia rodericki Fraser, 1959
Larva not available.
*Genus Micromidia Fraser 1959
The island distribution (Thursday Island, Torres Strait) will
most probably confirm the identification of the larva of M.
rodericki once it is available (Theischinger 2001a).
Distributional support is not needed to distinguish the larvae
of the other two species. It appears that M. atrifrons is not
present in southern inland Queensland, whereas there are no
records of M. convergens from north-eastern Queensland
(Theischinger & Endersby 2009).
Table 1. Australian odonate species and their larvae: original description, first descriptions of larva, confidence in identifications, supportive
information
Taxon
OD
Ld
Au
IDR (*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
ORDER ODONATA
2 suborders clearly distinguishable on morphology
SUBORDER ZYGOPTERA
8 families clearly distinguishable on morphology
Family Hemiphlebiidae
monotypic
Hemiphlebia mirabilis
1869
1928
Ti
*
*
Family Synlestidae
3 genera clearly distinguishable on morphology
Chorismagrion risi
1914
1956
Fr
*
*
Episynlestes albicauda
1913
1993
Thea
+
*
*
s and i Qld, ne NSW
Episynlestes cristatus
1977
1956
Fr
*
*
Qld N of P-E gap
Episynlestes intermedius
1985
1993
Thea
*
*
Qld: Eungella area
Synlestes selysi
1917
1993
Thea
+
+
*
*
P: Qld: Eungella area
Synlestes weyersii
1869
1914
Ti
*
*
P: Qld: Carnarvon N.P, Victoria
Synlestes tropicus
1917
1993
Thea
*
*
Qld: N of P-E gap
Family Lestidae
3 genera clearly distinguishable on morphology
Austrolestes aleison
1979
1962
Wa
+
*
*
sWA
Austrolestes psyche
1862
1917
Ti
*
*
se A, SA
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
107
Taxon
OD
Ld
Au
IDR (*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
Austrolestes minjerriba
1979
1999
HaTh
*
*
Austrolestes annulosus
1862
1910
Ri
*
*
Austrolestes analis
1842
1906
Ti
*
*
Austrolestes aridus
1908
1960
Li
*
+
*
Austrolestes cingulatus
1839
1906
Ti
*
*
Austrolestes io
1862
1960
Li
*
*
Austrolestes leda
1862
1906
Ti
*
*
Austrolestes insularis
1913
*
0
/
most of n A
Indolestes alleni
1913
0
Indolestes obiri
1979
?+
+
0
Indolestes tenuissimus
1906
1960
Li
Lestes concinnus
1862
1960
Li
*
*
Family Lestoideidae
2 genera clearly distinguishable on
morphology and size
Lestoidea barbarae
1967
0
Lestoidea brevicauda
1996
?
0
Lestoidea conjuncta
1913
1956
Fr
+
+
Lestoidea lewisiana
1996
*
0
/
P: Qld: Mt Lewis area
Diphlebia coerulescens
1913
1980
St
*
*
P: Qld: Eungella area
Diphlehia euphoeoides
1907
1980
St
7
Diphlebia hybridoides
1912
1980
St
+
Diphlebia lestoides
1853
1909
Ti
+
Diphlebia nymphoides
1912
1912
Ti
+
*
*
P: Qld: Carnarvon N.P.
Family Argiolestidae
5 genera clearly distinguishable on
morphology
Archiargiolestes parvulus
1977
1998
Th
Archiargiol. pusillissimus
1925
1998
Th
+
+
Archiargiolestes pusillus
1908
1962
Wa
Austroargiolestes alpinus
1913
0
Austroargiol. brookhousei
1986
0
Austroargiolestes amabilis
1899
0
Austroargiolestes aureus
1906
2006
ThHa
Austroargiolestes calcaris
1958
1999
HaTh
Austroargiolestes Christine
1986
+
+
0
Austroargiolestes chrysoides
1913
2006
ThHa
Austroargiolestes elke
1986
0
Austroargiolestes isabellae
1986
1995
Mu
Austroargiolestes icteromelas
1862
1917
Ti
108
G. Theischinger & I. Endersby
Taxon
OD
Ld
Au
IDR(*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
Griseargiolestes albescens
1913
1999
HaTh
*
+
*
Griseargiolestes bucki
1998
1998
Th
*
*
Griseargiolestes eboracus
1913
1999
HaTh
*
*
Griseargiolestes griseus
1862
1914
Ti
+
*
*
P: N and E from alpine region
Griseargiolestes intermedius
1913
1999
HaTh
*
*
P: alpine region
Griseargiolestes fontanus
1913
*
0
E: rain forest
Griseargiolestes metallicus
1917
*
0
/
Qld N of P-E gap
Miniargiolestes minimus
1908
1962
Wa
*
*
Podopteryx selysi
1899
1978
WaDy
*
*
*
E: treeholes
Family Isostictidae
8 genera clearly distinguishable on morphology
Austrosticta fieldi
1908
1993
Ha
+
9
+
*
*
P: NT
Austrosticta soror
1917
1991
WaOF
Austrosticta frater
1997
*
0
/
P: most of n Qld
Eurysticta coolawanyah
1969
1969
Wa
+
?
*
*
n WA: Pilbara area
Eurysticta coomalie
1991
1993
Ha
+
Eurysticta kununurra
1991
1993
Ha
Eurysticta reevesi
2001
*
0
/
n Qld
Labidiosticta vallisi
1955
1999
HaTh
*
*
Lithosticta macra
1991
1993
Ha
*
*
Neosticta canescens
1913
1914
Ti
*
*
se Qld, e NSW
Neosticta fraseri
1991
2006
ThHa
+
Neosticta silvarum
1917
0
Oristicta fUicicola
1913
1956
Fr
*
*
Rhadinosticta banksi
1913
1993
Ha
*
+
*
Rhadinosticta simplex
1901
1914
Ti
*
*
*
P: s Q, NSW, Vic
Selysioneura sp.
2009
Th
*
*
Qld N of P-E gap;
Adults unknown
Family Platycnemididae
1 genus distinguishable on morphology
Nososticta baroalba
1984
?+
+
0
Nososticta coelestina
1906
0
Nosostictafraterna
1933
1993
Ha
Nososticta kalumburu
1984
0
Nososticta koolpinyah
1984
0
Nososticta koongarra
1984
1993
Ha
Nososticta liveringa
1984
0
Nososticta mouldsi
2000
0
Nososticta pilbara
1969
1969
Wa
Nososticta solitaria
1906
0
Nososticta taracumbi
1984
0
Nososticta solida
1860
1982
Nu
*
*
P: NSW, Vic
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
109
IDR (*=for
species,
+ =for
group of species)
based on
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
Taxon
OD
Ld
Au
M
G
g
e
n
IDR
Family Coenagrionidae
13 genera distinguishable on
morphology, two of them difficult, larvae of one unknown
Aciagrion fragile
1906
1993
Ha
*
*
Agriocnemis argentea
1906
0
Agriocnemis dobsoni
1954
0
Agriocnemis kunjina
1969
2006
ThHa
?+
+
Agriocnemis rubricauda
1913
0
Agriocnemis pygmaea
1842
1979
A1
*
*
P: NSW
Agriocnemis femina
1868
1962
Li
*
*
nCY
Archibasis mimetes
1913
0
no substitute species
Argiocnemis rubescens
1877
1917
Ti
*
*
Austroagrion cyane
1876
1962
Wa
*
*
s WA, SA
Austroagrion watsoni
1982
1917
Ti
+
*
*
se A (excl. western Victoria)
Austroagrion pindrina
1969
*
0
/
n WA: Pilbara area
Austroagrion exclamationis
1915
1993
Ha
*
*
ne and n A except Pilbara area
Austrocnemis maccullochi
1926
1993
Ha
*
*
Austrocnemis obscura
1991
9
*
0
/
WA: Kimberley
Austrocnemis splendida
1901
1917
Ti
+
*
*
e A
Austrocoenagrion lyelli
1913
1979
A1
*
*
Caliagrion billinghursti
1901
1914
Ti
*
*
Ceriagrion aeruginosum
1869
1936
Li
*
*
Ischnura aurora
1865
1917
Ti
*
*
Ischnura heterosticta
1839
1917
Ti
*
+
*
Ischnura pruinescens
1906
1993
Ha
*
*
Pseudagrion aureofrons
1906
1986
Ha
*
*
Pseudagrion microcephalum
1842
1962
Li
*
*
Pseudagrion ignifer
1906
2000
Th
*
*
Pseudagrion lucifer
1997
2006
ThHa
*
+
*
Pseudagrion cingillum
1869
0
Pseudagrion jedda
1991
0
Teinobasis rufithorax
1877
+
0
/
ne Qld, CY; id by substitution (71 ariel)
Xanthagrion erythroneurum
1876
1962
Wa
*
*
SUBORDER ANISOPTERA
8 families + 1 group of genera incertae sedis clearly distinguishable on morphology
Family Austropetaliidae
2 genera clearly distinguishable on
morphology
Archipetalia auriculata
1917
1979
A1
*
*
Austropetalia annaliese
2013
*
0
/
NSW N of Hunter River
Austropetalia patricia
1910
1910
Ti
*
*
*
NSW N of latitude ca 35° and S of
Hunter River
Austropetalia tonyana
1995
1986
Ha
*
*
*
NSW S of latitude ca 35°, Vic
Family Aeshnidae
15 genera: 14 distinguishable on morphology and size, larvae of one undescribed; several
very distinct units distinguishable but without general taxonomic recognition
Adversaeschna brevistyla
1842
1910
Ri
*
*
Agyrtacantha dirupta
1889
+
0
/
CY
110
G. Theischinger & I. Endersby
IDR(*=for
species, + =for
group of species)
based on
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
Taxon
OD
Ld
Au
M
G
g
e
n
IDR
Anaciaeschna jaspidea
1839
2002
Th
*
*
Anax georgius
1872
1987
WaTh
*
*
Anax gibbosulus
1842
1987
WaTh
*
*
Anax guttatus
1839
2002
Th
*
*
Anax papuensis
1839
1916
Ti
*
*
*
P: WA W of Kimberley, c & s A
Austrogynac. heterogena
1908
1993
Ha
*
*
Gynacantha dobsoni
1951
1916
Ti
Gynacantha rosenbergi
1867
2007
Th
+
Gynacantha kirbyi
1898
9
+
0
Gynacantha mocsaryi
1898
1963
Fr
+
Gynacantha nourlangie
1991
1993
Ha
*
*
Dendroaeschna conspersa
1907
1914
Ti
*
*
Acanthaeschna victoria
1901
2000
Th
*
*
Antipodophlebia asthenes
1916
1980
WaTh
*
*
Austroaeschna Christine
1993
1993
Th
*
*
Qld: Eungella area
Austroaeschna ingrid
2008
2008
Th
*
*
Vic: Grampians
Austroaeschna multipunctata
1901
1982
Th
+
*
*
NSW S of lat. ca 35°S, most of Vic
Austroaeschna sigma
1982
1982
Th
*
*
se Qld; NSW N of lat. ca 34°S
Austroaeschna parvistigma
1883
1916
Ti
*
*
E: boggy and swampy habitats
Austroaeschna obscura
1982
1916
Ti
*
*
Austroaesch. flavomaculata
1916
1982
Th
*
*
Austroaeschna atrata
1901
1982
Th
*
*
*
NSW and Vic: alpine region
Austroaeschna subapicalis
1982
1916
Ti
*
+
*
*
se Qld; NSW and Vic: N, S, E and W
of alpine region
Austroaeschna hardyi
1917
1979
A1
*
*
Austroaeschna tasmanica
1916
1979
A1
*
+
*
Austroaeschna anacantha
1908
1910
Ri
*
*
*
sWA
Austroaeschna cooloola
1991
1999
HaTh
*
*
Qld: Cooloola area
Austroaeschna pinheyi
2001
1982
Th
*
*
si Qld
Austroaeschna speciosa
1917
1982
Th
+
*
*
Qld N of P-E gap
Austroaeschna unicornis
1901
1916
Ti
*
*
e A S of P-E gap & except Cooloola
region
Austroaeschna inermis
1901
1975
Th
*
*
Austroaeschna eungella
1993
1993
Th
*
*
*
Qld: Eungella a. & Clarke Ra.
Austroaeschna muelleri
1982
1982
Th
*
*
*
Qld: Carnarvon N.P.
Austroaeschna pulchra
1909
1916
Ti
*
*
*
much of e A
Austrophlebia costalis
1907
1916
Ti
*
*
*
e A: S of P-E gap
Austrophlebia subcostalis
1996
1996
Th
*
*
*
Qld: N of P-E gap
Dromaeschna forcipata
1907
1982
Th
*
*
Dromaeschna weiskei
1908
1982
Th
*
+
*
Notoaeschna geminata
1982
1916
Ti
*
*
se Qld, NSW N of Hunter River
Notoaeschna sagittata
1901
1970
OF
+
*
*
NSW S of Hunter River, Vic
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
111
Taxon
OD
Ld
Au
IDR(*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
Spinaeschna tripunctata
1901
1975
Th
*
*
*
NSW, Vic
Spinaeschna watsoni
1982
1982
Th
*
*
*
Qld: N of P-E gap
Telephlebia brevicauda
1916
1970
OF
+
*
*
NSW S of lat. ca 35°30’S, Vic
Telephlebia cyclops
1916
1999
HaTh
*
*
Qld S of P-E gap, ne NSW
Telephlebia godeffroyi
1883
1916
Ti
*
*
NSW Noflat, ca 35°30’S
Telephlebia tillyardi
1916
2002
Th
+
*
*
Qld: N of P-E gap
Telephlebia tryoni
1917
2002
Th
*
*
coastal se Qld and ne NSW
Telephlebia undia
1985
*
0
/
Qld: Carnarvon N. P.
Family Petaluridae
1 genus distinguishable on morphology
Petalura gigantea
1815
1909
Ti
+
*
*
non-coastal se Qld, most of NSW
Petalura litorea
1999
2000
Th
*
*
coastal se Qld and ne NSW
Petalura hesperia
1958
1958
Wa
*
*
*
sWA
Petalura ingentissima
1908
1998
An
*
+
*
Qld: N of P-E gap
specific status of P. pulcherrima still
uncertain
Petalura pulcherrima
1913
*
0
/
Family Gomphidae
7 genera clearly distinguishable on morphology; 2 subfamilies
Ictinogomphus australis
1873
1917
Ti
+
+
*
*
P: much of n and e A
Ictinogomphus paulini
1991
0
Ictinogomphus dobsoni
1969
1998
Th
*
*
WA: Pilbara area
Antipodogomphus acolythus
1901
1917
Ti
+
+
*
*
P: NSW, Vic
Antipodogomphus dentosus
1991
1993
Ha
Antipodogomphus edentulus
1991
0
Antipodogomphus neophytus
1958
1993
Ha
Antipodogomph. proselythus
1901
2007
Th
Antipodogomphus hodgkini
1969
1998
Th
*
*
WA: Pilbara area
Armagomphus armiger
1913
1962
Wa
*
*
Austroepigomph. praeruptus
1857
1998
Th
*
*
*
P: much of s Qld, NSW, Vic
Austroepigomphus gordoni
1962
1962
Wa
*
*
*
WA, c A
Austroepigomphus turneri
1901
1993
Ha
*
*
*
nA
Austrogomphus angelorum
1913
*
0
E: mature Murray River
Austrogomphus arbustorum
1906
1998
Th
+
*
*
e Qld
Austrogomphus pusillus
1917
2006
ThHa
*
*
WA: Kimberley
Austrogomphus mjobergi
1917
1993
Ha
*
*
*
n Au
Austrogomphus australis
1854
1986
Ha
+
*
*
eA, SA
Austrogomphus collaris
1854
1962
Wa
*
*
sWA
Austrogomphus cornutus
1991
1986
Ha
+
*
*
i & se Qld, NSW, Vic, SA
Austrogomphus doddi
1909
*
0
/
ne Qld
Austrogomphus guerini
1842
1970
OF
+
+
*
*
P: SA, Tas
Austrogomphus ochraceus
1869
1916
Ti
Austrogomphus mouldsorum
1999
*
0
WA: Kimberley
112
G. Theischinger & I. Endersby
IDR(*=for
species, + =for
group of species)
based on
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
Taxon
OD
Ld
Au
M
G
g
e
n
IDR
Austrogomphus amphiclitus
1873
1998
Th
*
*
*
P: much of e and i Qld, NSW
Austrogomphus bifurcatus
1909
1998
Th
7
Austrogomphus divaricatus
1991
+
0
Austrogomphus prasinus
1906
2006
ThHa
+
Hemigomphus atratus
1991
0
Hemigomphus comitatus
1909
1998
Th
Hemigomphus theischingeri
1991
1998
Th
+
Hemigomphus heteroclytus
1854
1910
Ti
+
*
*
P: si Qld
Hemigomphus gouldii
1854
1980
Wi
Hemigomphus cooloola
1991
1998
Th
*
*
*
Qld: Coolola area;
E: dune situations
Hemigomphus magela
1991
1993
Ha
*
*
*
nNT
Odontogomphus donnellyi
1991
1991
Wa
*
*
Zephyromphus lateralis
1873
1962
Wa
*
*
*
sWA
Zephyrogomph. longipositor
1991
1998
Th
*
*
*
Qld N of P-E gap
Family Synthemistidae
8 genera distinguishable
on morphology, two of them difficult
Archaeosynthemis leachii
1871
1967
Wa
*
*
Archaeosynth. occidentalis
1910
1962
Wa
*
+
*
Archaeosynthemis spiniger
1913
1962
Wa
*
*
Archaeosynthemis orientalis
1910
1910
Ti
*
*
se A
Austrosynthemis cyanitincta
1908
1962
Wa
*
*
Choristhemis jlavoterminata
1901
1910
Ti
*
*
*
P: e Au S of Daintree River
Choristhemis olivei
1909
2003
Th
*
+
*
Eusynthemis barbarae
1985
2001
Th
+
*
*
Qld: Mt Lewis
Eusynthemis tenera
1995
9
0
Eusynthemis aurolineata
1913
1998
Th
*
*
Eusynthemis rentziana
1998
1998
Th
*
*
Eusynthemis tillyardi
1995
1910
Ti
*
*
Eusynthemis guttata
1871
1995
Th
*
+
*
Eusynthemis nigra
1906
1999
HaTh
*
*
Eusynthemis deniseae
1977
1977
Th
*
*
Eusynthemis brevistyla
1871
1986
Ha
*
*
Eusynthemis virgula
1874
1986
Ha
*
+
*
Eusynthemis netta
1999
0
Qld: Mt Lewis area
Eusynthemis ursa
1999
?
*
0
/
NSW: Barrington Tops
Eusynthemis Ursula
1998
2000
Th
+
*
*
NSW: Chichester S.F.
Parasynthemis regina
1874
1910
Ti
*
*
*
E: streams that dry to pools
Synthemiopsis
gomphomacromioides
1917
2000
Th
*
*
Synthemis eustalacta
1839
1910
Ti
*
*
*
se A exc. Grampians, Tas and e SA
Synthemis tasmanica
1910
1979
A1
*
*
*
Vic: Grampians, SA, Tas
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
113
Taxon
OD
Ld
Au
IDR(*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
Tonyosynthemis claviculata
1909
1998
Th
+
*
*
Qld N of P-E gap
Tonyosynthemis ofarrelli
1986
1998
Th
*
*
se Qld, ne NSW
Family Macromiidae
1 genus distinguishable on morphology
Macromia tillyardi
1906
1993
Ha
*
*
*
P: e Qld ?except CY, ne NSW
Macromia viridescens
1911
2001
Th
*
*
Family Corduliidae
4 genera clearly distinguishable on morphology
Hemicordulia australiae
1842
1962
Wa
*
*
Hemicordulia continentalis
1907
1999
HaTh
+
+
Hemicordulia tau
1871
1914
Ti
*
*
P: WA, s & cA
Hemicordulia kalliste
1991
*
0
/
extreme N of Au
Hemicordulia flava
1991
2006
ThHa
*
*
c A
Hemicordulia intermedia
1871
1993
Ha
+
+
*
*
P: n, c and much of e A; WA except
Pilbara area
Hemicordulia koomina
1969
2006
ThHa
Hemicordulia superba
1911
1999
HaTh
*
*
Metaphya tillyardi
1913
+
0
/
ident. by subst. (M. elongata )
Pentathemis membranulata
1890
1993
Ha
*
*
Procordulia affinis
1871
1962
Wa
*
*
*
sWA
Procordulia jacksoniensis
1842
1970
OF
*
*
*
e Au
Family Libellulidae
27 genera: 21 clearly distinguishable on morphology, larvae of 2 genera unknown
Aethriamanta circumsignata
1897
1993
Ha
+
+
*
*
P: NSW
Aethriamanta nymphaeae
1949
1993
Ha
Agrionopt. insignis allogenes
1908
1993
Ha
*
+
*
*
P: NT, Qld S of P-E gap, NSW
Agr. longitudinalis biserialis
1879
2006
ThHa
*
*
Austrothemis nigrescens
1901
1962
Wa
*
*
Brachydiplax denticauda
1867
1993
Ha
+
+
*
*
P: Kimberley, NT, Qld S of P-E gap
Brachydiplax duivenbodei
1866
0
/
Camacinia othello
1908
+
0
/
id by substitution (C. gigantea )
Crocothemis nigrifrons
1894
1962
Wa
*
*
Diplacodes haematodes
1839
1914
Ti
*
+
*
Diplacodes bipunctata
1865
1917
Ti
+
*
*
P: WA, c and s A
Diplacodes trivialis
1842
1962
Li
Diplacodes melanopsis
1901
1986
Ha
*
*
Diplacodes nebulosa
1793
1993
Ha
+
Nannodiplax rubra
1868
1993
Ha
*
*
P: Kimberley
Huonia melvillensis
1998
2002
ThBr
*
*
Hydrobasileus brevistylus
1865
1963
Fr
*
*
Lathrecista asiatica festa
1879
2006
ThHa
*
*
identified by supposition
Macrodiplax cora
1867
1962
Li
*
*
114
G. Theischinger & I. Endersby
IDR (*=for
species, + =for
group of species)
based on
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
Taxon
OD
Ld
Au
M
G
g
e
n
IDR
Nannophlebia eludens
1908
2006
ThHa
Nannophlebia injibandi
1969
1993
Ha
*
*
P: Pilbara area
Nannophlebia mudginberri
1991
1993
Ha
+
+
Nannophlebia risi
1913
1913
Ti
*
*
P: NSW, Vic
Nannophya australis
1865
1999
HaTh
*
*
*
P: most of ne A
Nannophya paulsoni
2003
*
0
Nannophya sp.
2007
Th
*
*
Qld: nr Barcaldine;
adults unknown
Nannophya dalei
1908
1979
A1
*
*
se A
Nannophya occidentalis
1908
1962
Wa
+
*
*
sWA
Neurothemis oligoneura
1867
?
0
Neurothemis stigmatizans
1775
1962
Li
+
+
*
*
P: S of extreme n NT and CY
Notolibella bicolor
1977
0
Orthetrum balteatum
1933
2002
HaTh
*
*
identified by supposition
Orthetrum boumiera
1978
1978
WaAr
*
E: dune situations
Orthetrum caledonicum
1865
1916
Ti
+
+
*
*
P: A except coastal se Qld and ne NSW
Orthetrum migratum
1951
1978
WaAr
*
*
P: Kimberley, Pilbara area
Orthetrum villosovittatum
1868
1978
WaAr
+
+
*
*
P: NSW, Vic
Orthetrum sabina
1770
1904
Ne
?
*
*
P: n WA and se A, i Qld
Orthetrum serapia
1984
+
+
0
Pantala flavescens
1798
1890
Ca
*
*
Potamarcha congener
1842
1977
Ku
*
*
Raphismia bispina
1867
0
Rhodothemis lieftincki
1954
1993
Ha
*
*
Rhyothemis braganza
1890
1993
Ha
+
*
*
P: WA: Kimberley, n NT, se Qld
Rhyothemis resplendens
1878
?
+
0
Rhyothemis graphiptera
1842
1993
Ha
*
*
*
P: Pilbara, c-Au
Rhyothemis phyllis
1776
1962
Li
*
+
*
Rhyothemis princeps
1894
2006
ThHa
*
*
Tetra. irregularis cladophila
1908
2003
ThFl
*
*
Tholymis tillarga
1798
1962
Li
*
*
Tramea eurybia
1878
0
Tramea loewii
1866
1917
Ti
*
*
P: se NSW, Vic
Tramea propinqua
1942
1962
Li
+
+
Tramea stenoloba
1962
1962
Wa
Urothemis aliena
1878
1993
Ha
*
*
Zyxomma elgneri
1913
1993
Ha
*
*
P: s Qld, NSW. n-w Australia
Zyxomma multinervorum
1897
+
?
+
0
Zyxomma petiolatum
1842
1962
Li
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
115
Taxon
OD
Ld
Au
IDR (*=for
species, + =for
group of species)
based on
n
IDR
Total geographical range or, indicated by
P, part of it where I based on M is
reliable or supported
M
G
g
e
Genera incertae sedis
9 genera clearly distinguishable on morphology; several very distinct units distinguishable
but without general taxonomic recognition
Archaeophya adarnsi
1959
1984
ThWa
+
*
*
se NSW
Archaeophya magnified
1978
1978
Th
*
*
QldNofP-E gap
Pseudocordulia circularis
1909
1982
Wa
?+
+
*
?
P: terrestrial in rain forest leaf litter
Pseudocordulia elliptica
1913
*
?
Cordulephya bidens
1917
2006
ThHa
+
*
*
QldNofP-E gap
Cordulephya pygmaea
1870
1911
Ti
*
*
mainland e A S of P-E gap
Cordulephya divergens
1917
2006
ThHa
+
+
Cordulephya montana
1911
1911
Ti
Apocordulia macrops
1980
1984
ThWa
*
*
Austrocordulia refracta
1909
1910
Ti
*
*
*
P: Qld, ne NSW, Vic
Austrocordulia leonardi
1973
1973
Th
*
*
Austrocordulia territoria
1978
1984
ThWa
*
*
*
n NT
Austrophya mystica
1909
1984
ThWa
*
+
*
?Austrophya sp.
2001
Th
*
*
Qld: Thornton Peak;
adults unknown
Hesperocordulia berthoudi
1911
1910
Ri
*
*
Lathrocordulia garrisoni
1991
?
+
*
0
I
Qld N of P-E gap
Lathrocordulia metallica
1911
1962
Wa
*
*
s WA
Micromidia-atrifrons
1883
1978
Th
*
+
*
*
P: ne Qld, CY
Micromidia convergens
1978
1984
ThWa
*
*
Micromidia rodericki
1959
*
0
/
Thursday Island
Abbreviations used in the table. General terms: OD=year of original description of adult; Ld=first description/descriptive detail of larva;
Au=author/s of Ld; M=morphological disparity; G=distributional disparity; g=partial distributional disparity; e=ecological particular; n=larva
not available (given by 0); IDR=reliable Identification possible. Geographical terms: A=Australia; CY=Cape York Peninsula; e=eastern; i=inland;
n (in table head)= no descriptive information available at the present time (indicated by 0); n (in distribution column) northern; N=north;
ne=north-eastern; P-E gap=Paluma-Eungella gap; s=southern; S=south; se=south-eastern; NG=New Guinea; NSW=New South Wales;
NT=Northern Territory; Qld=Queensland; SA=South Australia; si=southern inland;WA=Western Australia; Vic=Victoria. Distributional data
are included only with species for which these details markedly improve the reliability of identification. Authors: Al=Allbrook; An=Andress;
Ca=Cabot; Fr=Fraser; Ha=Hawking; HaTh=Hawking & Theischinger; Ku=Kumar; Li=Lieftinck; Mu=Murray; Ne=Needham; Nu=Nuttall;
OF=0’Farrell; St=Stewart; Th=Theischinger; Thea=Theischinger et al.; ThBr=Theischinger & Brown; ThFl=Theischinger & Fleck;
ThHa=Theischinger & Hawking; Ti=Tillyard; Wa=Watson; WaAr=Watson & Arthington; WaDy=Watson & Dyce; WaOF= Watson & O’Farrell;
WaTh=Watson & Theischinger; Wi=Williams.
Geographical range or part of is only given if it markedly effects the reliability of identification. Full geographical ranges are written in bold;
part of the range for which reliable identification is written in normal subsequent to P:.
Some species are, within their genus, not listed in alphabetical order to better show morphological or geographical mutualities by the symbol +
in cells ‘merged’ down the subcolumns M and G of column IDR.
Reasonably reliable identifications can be achieved at least for part of their ranges for 235 of the 325 species if the individuals to be identified are
in good shape and close to final instar, and if their origin is known. Of these 215 are marked in column IDR by the symbol *, the remaining 20
by the symbol /. Identifications for 90 of the 325 species are at present hardly possible and therefore not marked with any symbol in the column
IDR. Should larvae be identified as belonging to a species without an icon in the column IDR, it is strongly recommended that the details be
thoroughly checked by repeating the identification procedure.
116
G. Theischinger & I. Endersby
Figure 95. Accumulation curve illustrating the increase in descriptive information for Australian odonate larvae between 1880 and 2014.
Conclusions and outlook
This compilation of the information regarding Australian
dragonfly larvae and the possibility for accurate identification
provides some interesting results. Of 325 Australian Odonata
species, larvae are known for 263 species, or about 80% of the
total fauna. No descriptive information is available for the larvae
of 62 species (marked with the symbol 0 in column n of Table 1).
Reliable identifications, based on morphology alone are
possible for 136 species, an additional 47 species can be
identified reliably using a combination of morphological and
distributional data. On top of that identifications of 30 more
species are reliable within particular parts of their ranges, and
one more can be identified based on its ecology. Considering
these factors, it should also be possible to reliably identify
another 20 species once their larvae are available.
The larvae of four Australian dragonfly genera, Archibasis,
Camacinia, Notolibellula and Raphismia are unknown or
undescribed.
These numbers show that the ratio ‘Number of identifiable
species/Total number of species’ is markedly higher for
Anisoptera (170/214) than for Zygoptera (64/111) and makes
the Platycnemididae, Lestoideidae and Argiolestidae (in that
order) the families for which progress in larval taxonomy is
most urgently needed. This is of course also a reflection of the
larval taxonomic difficulties of these groups. To improve the
situation remains a big challenge for identification certifiers
and taxonomists and would also make, perhaps in connection
with more applied and timely issues, great topics for regional
or Australia-wide PhD studies. Also DNA-matching of adults
and larvae/exuviae will be a powerful method of confirming
identifications in future.
Table 2. Distribution of knowledge sufficient for specific identifications
across families
Family
Species
identifiable
Total
species
Ratio
Platycnemididae
1
12
0.08
Lestoideidae
3
9
0.33
Argiolestidae
8
22
0.36
Gomphidae
23
38
0.61
Isostictidae
11
16
0.69
Libellulidae
40
57
0.70
Coenagrionidae
23
30
0.77
Lestidae
11
14
0.79
Lib. incertae sedis
16
20
0.80
Corduliidae
10
12
0.83
Aeshnidae
46
50
0.92
Synthemistidae
24
26
0.92
Hemiphlebiidae
1
1
1.00
Synlestidae
7
7
1.00
Austropetaliidae
4
4
1.00
Petaluridae
5
5
1.00
Macromiidae
2
2
1.00
Total
235
325
0.72
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
117
Summary
This paper summarises the morphological and geographic
information for the larvae of all species of Australian
dragonflies. We present an annotated checklist giving all
known references which provide information on the
identification characters of each species. For each genus that
includes more than one species there is a paragraph which
discusses if species can already, or cannot yet, be distinguished
on morphological characters. We also include information on
whether, and under which conditions, geographic locality
helps or is enough to make a diagnosis. A table provides the
year of original description and of first description of the larva
of each species. It also indicates the level of confidence of
identifications from available keys and other supportive
information. The paper is fully referenced and includes, for
more than 70% of the Australian dragonfly genera, illustrations
of final stage larvae or exuviae (“shells”).
We wrote this paper to improve the reliability of
identification of the larvae of Australian species of dragonflies.
It brings together references to all available information on the
identification of larvae of any Australian dragonfly species.
This encourages access to original sources and to confirm
results of identifications by using several ways of diagnosing
when in doubt. In particular it emphasizes the geographical
aspect of making identifications. Geographical information
can improve confidence of inconclusive morphological
identifications of larvae by reducing the number of possible
options and improves the chances for reliable identification of
even relatively early larval stages. Identifications are only
valuable if they are accurate and reliable, so the paper will be
helpful in many current issues including biodiversity,
conservation, river health, climate change and others.
References
Allbrook, P. 1979. Tasmanian Odonata. Fauna of Tasmania Handbook
No. 1. University of Tasmania, Fauna of Tasmania Committee:
Hobart.
Andress, R. 1998. Description of the larva of Petalura ingentissima
Tillyard, 1907 (Anisoptera: Petaluridae). Odonatologica 27: 353-359.
Burwell, C.J. and Theischinger, G. 2003. New distribution records and
notes on the larva of Urothemis aliena Selys (Odonata:
Urothemistidae). Australian Entomologist 39: 57-64.
Cabot, L. 1890. The immature state of the Odonata. Part III. Subfamily
Cordulina. Memoirs of the Museum of Comparative Zoology 17:1-52.
Calvert, P.P. 1934. The rates of growth, larval development and
seasonal distribution of dragonflies of the genus Anax (Odonata:
Aeshnidae). Proceedings of the American Philosophical Society
73: 1-70.
Dijkstra, K.-D. B., Bechly, G., Bybee, S.M., Dow, R.A., Dumont, H.J.,
Fleck, G., Garrison, R.W., Hamalainen. M., Kalkman, V.J.,
Karube, H., May, M.L., Orr, A.G., Paulson, D.R., Rehn, A.C.,
Theischinger, G., Trueman, J.W.H., van Tol, J., von Ellenreider, N.
and Ware, J. 2013. The classification and diversity of dragonflies
and damselflies (Insecta: Odonata). Zootaxa 3703 (1): 36-45.
Fleck, G. 2007. Contribution a la connaissance des Odonates de
Nouvelle-Caledonie: une larve du genre Metaphya Laidlaw, 1912
(Anisoptera, Corduliidae). Bulletin de la Societe entomologique
de France 112: 183-186.
Fraser, F.C. 1956. The nymphs of Synlestes tropicus Tillyard,
Chorismagrion risi Morton, Oristicta filicicola Tillyard and
Lestoidea conjuncta Tillyard: With Description of the Female of
the Latter and Further Notes on the Male. Australian Zoologist
12(3): 284-292.
Fraser, F.C. 1959. New genera and species of Odonata from Australia
in the Dobson collection. Australian Zoologist 12: 352-361.
Fraser, F.C. 1963. The larvae of Gynacantha mocsaryi Forster and
Hydrobasileus brevistylus (Brauer) (Odonata). Australian
Zoologist 13: 23-25.
Gooderham, J. and Tsyrlin, E. 2002. The Waterbug Book. A Guide to
the Freshwater Macroinvertebrates of Temperate Australia.
CSIRO Publishing: Collingwood.
Hamada, K. and Inoue, K. 1985. The Dragonflies of Japan in Colour.
Vol. 1. Kodansha: Tokyo.
Hawking, J.H. 1986. Dragonfly Larvae of the River Murray System. A
Preliminary Guide to the Identification of known Final Instar
Odonate Larvae of South-eastern Australia. Technical Report
No. 6. Albury Wodonga Development Corporation: Wodonga.
Hawking, J.H. 1991. The first record of the dragonfly Dendroaeschna
conspersa from Victoria. Victorian Naturalist 108: 6-7.
Hawking, J.H. 1993. A Preliminary Guide to the Identification of
Dragonfly Larvae from the Alligator Rivers region of the Northern
Territory. Open File Record 102. Office of the Supervising
Scientist, Alligator Rivers Region: Jabiru.
Hawking, J.H. 1995. Odonata. In J.H. Hawking (ed.). Monitoring
River Health Initiative, Taxonomic Workshop Handbook, pp. 22-
31. Murray-Darling Freshwater Research Centre: Albury.
Hawking, J.H. and Ingram, B.A. 1994. Rate of development of Pantala
flavescens (Fabricius) at its southern limit of range in Australia
(Anisoptera: Libellulidae). Odonatologica 23: 63-68.
Hawking, J.H. and New, T.R. 1996. The development of dragonfly
larvae (Odonata: Anisoptera) from two streams in north-eastern
Victoria, Australia. Hydrobiologia 317: 13-30.
Hawking, J.H. and Smith, F. 1997. Colour Guide to Invertebrates of
Australian Inland Waters. Identification Guide No. 8 Cooperative
Research centre for Freshwater Ecology: Albury.
Hawking J.H., Smith L.M. and LeBusque K. (editors) 2013.
Identification and Ecology of Australian Freshwater
Invertebrates. Murray-Darling Freshwater Research Centre.
http://www.mdfrc.org.au/bugguide [Accessed October 31st 2013]
Hawking, J. and Theischinger, G. 1999. Dragonfly Larvae (Odonata):
A guide to the identification of larvae of Australian families and
to the identification and ecology of larvae from New South Wales.
Cooperative Research Centre for Freshwater Ecology, Thurgoona
(NSW) and Australian Water Technologies Pty Ltd, West Ryde
(NSW).
Hawking J.H. and Theischinger, G. 2002. The larva of Orthetrum
balteatum Lieftinck (Odonata: Libellulidae). Linzer Biologische
Beitrage 34: 1511-1514.
Hawking, J.H. and Watson, J.A.L. 1990. First Australian record of
chironomid larvae epizoic on larval Odonata. Aquatic Insects 12:
241-245.
Ingram, B., Hawking, J.H. and Shiel, R.L. 1997. Aquatic life in
Freshwater ponds. A Guide to the Identification and Ecology of
Life in Aquaculture Ponds and Farma Dams in South-eastern
Australia. Identification Guide No. 9. Cooperative Research
centre for Freshwater Ecology: Albury.
Kalkman, V.J. and Theischinger, G. 2013. Generic revision of the
Argiolestidae (Odonata), with four new genera. International
Journal of Odonatology 16: 1-52.
Kumar, A. 1977. Descriptions of the last instar larvae of Odonata from
Dehra Dun Valley (India), with notes on biology. II. Suborder
Anisoptera. Oriental Insects 7: 291-334.
118
G. Theischinger & I. Endersby
Lieftinck, M.A. 1936. Die Odonaten der Kleinen Sund-Inseln. Revue
Suisse de Zoologie 43(5): 99-160.
Lieftinck, M.A. 1960. Considerations on the genus Lestes Leach with
notes on the classification and description of Indo-Australian
species and larval forms (Odonata: Lestidae). Nova Guinea Zool.
8: 127-171.
Lieftinck, M.A. 1962. Insects of Micronesia Odonata. Insects of
Micronesia 5: 1-95.
Lieftinck, M.A. 1976. The dragonflies (Odonata) of New Caledonia
and the Loyalty Islands. Part 2. Immature stages. Cah.
O.R.S.T.O.M., ser. Hydrobiol. 9: 165-200.
Murray, K. 1995. Development of the caudal lamellae in Austroargiolestes
isabellae Theischinger andO’Farrell (Odonata: Megapodagrionidae).
Australian Entomological Magazine 22: 43-46.
Needham 1904. New dragonfly nymphs in the United States National
Museum. Proceedings of the United States National Museum 27:
685-720.
Nuttall, P.M. 1982. A guide to the identification of larvae of the
Zygoptera (Odonata) of Victoria. Technical report No. 20.
Dandenong Valley Authority: Dandenong.
O’Farrell, A.F. 1970. Odonata (dragonflies and damselflies). In The
Insects of Australia, pp. 241-261. Melbourne University Press:
Melbourne.
Peters, G. and Theischinger, G. 2007. Die gondwanischen Aeshniden
Australiens (Odonata: Telephlebiidae und Brachytronidae).
Denisia 20, zugleich Katalog der oberdsterreichischen
Landesmuseen, N.S. 66: 517-574.
Richter, R. 2014. Discovery of the Damselfly Austroagrion cyane in
Victoria. Victorian Entomologist 44: 38-40.
Ris, F. 1910. Odonata. In Die Fauna Siidwest-Australians, ed. W.
Michaelsen and R. Hartmeyer. 2: 417-450. Fischer: Jena.
Rowe, R.J. 1992. Larval development in Diplacodes bipunctata
(Brauer) (Odonata: Libellulidae). Journal of the Australian
Entomological Society 31: 351-355.
Schmidt, E. 1941. Petaluridae, Gomphidae and Petaliidae der
Schdnemannnschen Sammlungen aus Chile (Ordnung Odonata).
Archiv fiir Naturgeschichte, N. F. 10: 231-258.
Stewart, W.F. 1980. The Australian genus Diphlebia Selys (Odonata:
Amphipterygidae) II. Taxonomy of the larvae. Australian Journal
of Zoology, Supplementary Series No. 75: 59-69.
Theischinger, G. 1973. Eine zweite Art der Gattung Austrocordulia
Tillyard (Odonata, Anisoptera). Annalen des Naturhistorischen
Museums in Wien 77: 387-397.
Theischinger, G. 1975 Two undescribed Acanthaeschna larvae from
New South Wales, Australia (Anisoptera: Aeshnidae).
Odonatologica 4: 185-190
Theischinger, G. 1977. A new species of Eusynthemis Foerster from
Australia (Anisoptera: Synthemistidae). Odonatologica 6: 105-110.
Theischinger, G. 1978. Libellenstudien in Australien. Naturkundliches
Jahrbuch der Stadt Linz 23: 79-89.
Theischinger, G. 1982. A revision of the Australian genera
Austroaeschna Selys and Notoaeschna Tillyard (Odonata:
Aeshnidae: Brachytroninae). Australian Journal of Zoology,
Supplementary Series No. 87: 1-67.
Theischinger, G. 1993. Two new species of Austroaeschna Selys from
Queensland, Australia (Odonata: Aeshnidae: Brachytroninae).
Linzer Biologische Beitrage 25: 805-819.
Theischinger, G. 1995. The Eusynthemis guttata (Selys) group of
species from Australia (Odonata: Synthemistidae). Linzer
Biologische Beitrage 27: 297-310.
Theischinger, G. 1996. The species of Austrophlebia Tillyard (
Insecta: Odonata: Anisoptera: Aeshnidae: Brachytroninae).
Linzer Biologische Beitrage 28: 305-314.
Theischinger, G. 1998a. Tonyosynthemis, a new dragonfly genus from
Australia (Insecta: Odonata: Synthemistidae). Linzer Biologische
Beitrage 30: 139-142.
Theischinger, G. 1998b.Supra-specific diversity in Australian “ Argiolestes ”
(Odonata: Zygoptera: Megapodagrionidae). Stapfia 55: 613-621.
Theischinger, G. 1998c. A new species of Griseargiolestes
Theischinger from Australia (Odonata: Zygoptera:
Megapodagrionidae). Stapfia 55: 623-627.
Theischinger, G. 1998d. The larvae of the Australian Gomphidae
(Anisoptera). Odonatologica 27: 435-467.
Theischinger, G. 1998e. The Eusynthemis guttata (Selys) group of
species from Australia (Odonata, Synthemistidae) -Part 2. Linzer
Biologische Beitrage 30: 147-153.
Theischinger, G. 1999. Regions of taxonomic disjunction in Australian
Odonata and other freshwater insects: first addendum, with the
description of Austrocordulia refracta jurzitzai ssp. nov.
(Anisoptera: Corduliidae). Odonatologica 28: 377-384.
Theischinger, G. 2000a. Update on: “Dragonfly larvae (Odonata) A
guide to the identification of larvae of Australian families and to
the identification and ecology of larvae from New South Wales.”
Cooperative Research Centre for Freshwater Ecology, Thurgoona
(NSW) and Australian Water Technologies Pty Ltd, West Ryde
(NSW).
Theischinger, G. 2000b. Preliminary keys for the identification of
larvae of the Australian Gomphides (Odonata). Cooperative
Research Centre for Freshwater Ecology: Thurgoona (NSW).
Theischinger, G. 2000c. The Acanthaeschna Story. Linzer Biologische
Beitrage 32: 235-240.
Theischinger, G. 2000d. Thelarva of Synthemiopsis gomphomacromioides
Tillyard (Odonata: Synthemistidae). Linzer Biologische Beitrage
32: 259-263.
Theischinger, G. 2001a. Preliminary keys for the identification of
larvae of the Australian Synthemistidae, Gomphomacromiidae,
Pseudocorduliidae, Macromiidae and Austrocorduliidae
(Odonata). Cooperative Research Centre for Freshwater Ecology:
Thurgoona (NSW) 8.
Theischinger, G. 2001b. Regions of taxonomic disjunction in Australian
Odonata and other freshwater insects: second addendum, with the
description of Austroaeschna unicornis pinheyi ssp. nov.
(Anisoptera: Aeshnidae). Odonatologica 30: 87-96.
Theischinger, G. 2001c. The larva of Gynacantha mocsaryi Forster
(Odonata: Aeshnidae). Linzer Biologische Beitrage 33: 603-606.
Theischinger, G. 2002. Preliminary keys for the identification of larvae
of the Australian Petaluridae, Archipetaliidae, Austropetaliidae,
Telephlebiidae and Aeshnidae (Odonata). Cooperative Research
Centre for Freshwater Ecology, Thurgoona: (NSW).
Theischinger, G. 2003. The larva of Choristhemis olivei (Tillyard)
(Odonata: Synthemistidae). Linzer Biologische Beitrage 35:
657-660.
Theischinger, G. 2004. Affinities and status of some genus group taxa in
Australian Gomphidae (Anisoptera). Odonatologica 33: 413-421.
Theischinger, G. 2007a. Preliminary Keys for the Identification of
Larvae of Australian Odonata: Cordulephyidae, Oxygastridae,
Corduliidae, Hemicorduliidae (all Corduliidae s.l.), Libellulidae
and Urothemistidae (both Libellulidae s.l.). Department of
Environment and Conservation NSW: Sydney.
Theischinger, G. 2007b. The final instar larvae of Gynacantha
rosenbergi KAUP and Antipodogomphus proselythus
(MARTIN) (Odonata, Aeshnidae & Gomphidae). Linzer
Biologische Beitrage 39: 1233-1237.
Theischinger, G. 2008a. Notable Range Extensions of Dragonflies in
New South Wales- More Species in Victoria? Victorian
Entomologist 38: 59-65.
Australian Dragonfly (Odonata) Larvae: Descriptive history and identification
119
Theischinger, G. 2008b. Austroaeschna ingrid, sp. nov. from
Victoria, Australia (Odonata: Telephlebiidae). International
Journal of Odonatology 11: 241-247.
Theischinger, G. 2009. Dragonfly genera new in Australia and
Queensland (Odonata: Isostictidae, Austrocorduliidae). Victorian
Entomologist 39: 115-120.
Theischinger, G. 2010. Der GSI-Clade (Odonata, Libelluloidea) in
Australian - Systematik im Fluss. Entomologica Austriaca 17:
49-66.
Theischinger, G. 2012. Classification of the Austroeschna group of
genera including the introduction of four new subgenera
(Glaciaeschna subgen. nov., Montiaeschna subgen. nov.,
Occidaeschna subgen. nov., and Petersaesclma subgen. nov.)
(Anisoptera: Telephlebiidae). Libellula Supplement 12: 29-48.
Theischinger, G. and Brown, G.R. 2002. The larva of Huonia
melvillensis Brown & Theischinger (Anisoptera: Libellulidae.
Odonatologica 31: 319-322.
Theischinger, G. and Endersby, I. 2009. Identification Guide to the
Australian Odonata. Department of Environment, Climate
Change & Water NSW: Sydney.
Theischinger, G. and Fleck, G. 2003. A new character useful for
taxonomy and phylogeny of Anisoptera (Odonata). Bulletin de la
Societe entomologique de France 108: 409-412.
Theischinger, G. and Hawking, J.H. 2000. The larva of Eusynthemis
Ursula Theischinger (Odonata: Synthemistidae). Linzer
Biologische Beitrdge 32: 247-251.
Theischinger, G. and Hawking, J.H. 2003. Dragonflies of Victoria.
An Identification guide to adult and larval dragonflies (Odonata).
Cooperative Research Centre for Freshwater Ecology: Thurgoona
(NSW).
Theischinger, G. and Hawking, J. H. 2006. The Complete Field
Guide to Dragonflies of Australia. CSIRO Publishing:
Collingwood.
Theischinger, G. and Jacobs, S. 2012. Surprise rediscovery of
Acanthaeschna victoria , a key taxon in dragonfly evolution
(Odonata, Aeshnoidea, Telephlebiidae. Agrion 16(1): 4-9.
Theischinger, G., Jacobs, J., and Bush, A. 2013: Interesting range
extensions of Apocordulia macrops and Austrocordulia leonardi
(Odonata: Libelluloidea). Victorian Entomologist 43: 6-10.
Theischinger, G., Jacobs, S., and Krogh, M. 2011. Archaeophya
adamsi Fraser (Odonata, Gomphomacromiidae): not in
Queensland, safe in New South Wales? Agrion 15(2): 64-68.
Theischinger, G., Jacobs, S. and Mawer, D., 2012. Murray Darling
Icon Apocordulia macrops closes the gaps (Anisoptera:
Austrocorduliidae). Agrion 16(2): 42-46.
Theischinger, G., Miller, J., Miller, R. and Krogh. M. 2009.
Rediscovery of Austrocordulia leonardi (Sydney Hawk) in the
suburbia of Sydney. Agrion 13(2): 50-53.
Theischinger, G. and Tang, C. 2013. Diagnostic characters of the
larvae of Austropetalia Tillyard (Anisoptera: Austropetaliidae).
Agrion 17(1): 4-7.
Theischinger, G. and Watson, J.A.L. 1978. The Australian
Gomphomacromiinae (Odonata: Corduliidae). Australian Journal
of Zoology 26: 399-431.
Theischinger, G. and Watson, J.A.L. 1984. Larvae of Australian
Gomphomacromiinae and their bearing on the status of the
Synthemis group of genera (Odonata: Corduliidae). Australian
Journal of Zoology 32: 67-95.
Theischinger, G., Watson, J.A.L. and Rowe, R. 1993. Larvae of
Australian Synlestidae (Odonata: Zygoptera). Journal of the
Australian Entomological Society 32: 113-119.
Tillyard, R.J. 1906. Life-history of Lestes leda Selys. Proceedings of the
Linnean Society of New South Wales 31: 409-422.
Tillyard, R.J. 1909a. Studies in the life-histories of Australian Odonata.
Part i. The life-history of Petalura gigantea Leach. Proceedings of
the Linnean Society of New South Wales 34: 256-267.
Tillyard, R.J. 1909b. Studies in the life-histories of Australian Odonata.
Part ii. Life-history of Diphlebia lestoides Selys. Proceedings of the
Linnean Society of New South Wales 34: 370-383.
Tillyard, R.J. 1910a. Studies in the life-histories of Australian Odonata.
No. 3.Notes on a new species of Phyllopetalia, with description of
nymph and imago. Proceedings of the Linnean Society of New South
Wales 34: 697-708.
Tillyard, R.J. 1910b. Monograph of the genus Synthemis (Neuroptera:
Odonata). Proceedings of the Linnean Society of New South Wales
35:312-377.
Tillyard, R.J. 1910c. On some experiments with dragonfly larvae.
Proceedings of the Linnean Society of New South Wales 35: 665-
676.
Tillyard, R.J. 1911a. Studies in the life-histories of Australian Odonata.
No. 4. Lurther notes on the life-history of Petalura gigantea Leach.
Proceedings of the Linnean Society of New South Wales 36: 86-96.
Tillyard, R.J. 1911b. On the genus Cordulephya. Proceedings of the
Linnean Society of New South Wales 36: 388-422.
Tillyard, R.J. 1912. On the genus Diphlebia , with descriptions of new
species, and life-histories. Proceedings of the Linnean Society of
New South Wales 36: 584-604.
Tillyard, R.J. 1913. Descriptions and life-history of a new species of
Nannophlebia. Proceedings of the Linnean Society of New South
Wales 37(1912): 712-726.
Tillyard, R.J. 1914. On some problems concerning the development of
the wing venation of Odonata. Proceedings of the Linnean Society of
New South Wales 39: 163-216.
Tillyard, RJ. 1915a. On the development of the wing venation in
zygopterous dragonflies with special reference to the Calopterygidae.
Proceedings of the Linnean Society of New South Wales 40: 212-
230.
Tillyard, R.J. 1915b. On the physiology of the rectal gills in the larvae of
anisopterid dragonflies. Proceedings of the Linnean Society of New
South Wales 40: 422-437.
Tillyard, R.J. 1916a. Life-histories and descriptions of Australian
Aeschninae: with a description of a new form of Telephlebia by
Herbert Campion. Journal of the Linnean Society (Zoology) 33:
1-83.
Tillyard, R.J. 1916b. A study of the rectal breathing apparatus in the
larvae of anisopterid dragonflies. Journal of the Linnean Society
(Zoology) 33: 127-196.
Tillyard, R.J. 1917a. On the morphology of the caudal gills of the larvae
of zygopterid dragonflies. Introduction, Part 1 (General Morphology)
and Part 2 (Studies of the separate types). Proceedings of the Linnean
Society of New South Wales 42: 31-112.
Tillyard, R.J. 1917b. The Biology of Dragonflies (Odonata or
Paraneuroptera). Cambridge University Press: Cambridge.
Tillyard, R.J. 1926. The Insects of Australia and New Zealand. Odonata
pp. 65-86. Angus & Robertson: Sydney.
Tillyard, RJ. 1928. The larva of Hemiphlebia mirabilis Selys (Odonata).
Proceedings of the Linnean Society of New South Wales 53: 193-
206.
Tillyard, R.J. 1932. The life of a Dragonfly. The Australian Museum
Magazine 1932: 310-315.
Van Tol, J. 1992. An annotated index to names of Odonata used in the
publications by M.A. Lieftinck. Zoologische Verhandelingen.
Leiden No. 279: 1-263.
Ware, J.L., Beatty, C.D., Sanchez Herrera, M., Valley, S., Johnson, J.,
Kerst, C., May, M.L. & Theischinger, G. 2014. The petaltail
dragonflies (Odonata: Petaluridae): Mesozoic habitat specialists that
survive to the modem day. Journal of Bio geography 41: 1291-1300.
120
G. Theischinger & I. Endersby
Watson, J.A.L. 1958. A new species of Petalura Leach (Odonata) from
Western Australia. Proceedings of the Royal Entomological
Society London (B) 27: 116-120.
Watson, J.A.L. 1962. The Dragonflies (Odonata) of South-western
Australia. A Guide to the Identification, Ecology, Distribution
and Affinituies of Larvae and Adults. Handbook No. 7. Western
Australian Naturalist’s Club: Perth.
Watson, J.A.L. 1967. The larva of Synthemis leachi Selys, with a key
to the larvae of Western Australian Synthemistidae. Western
Australian Naturalist 10: 86-91.
Watson, J.A.L. 1968. Australian Dragonflies. Australian Natural
History June 1968: 33-38.
Watson, J.A.L. 1969. Taxonomy, ecology and zoogeography of
dragonflies (Odonata) from the north-west of Western Australia.
Australian Journal of Zoology 17: 65-112.
Watson, J.A.L. 1982. A truly terrestrial dragonfly larva from Australia
(Odonata, Corduliidae). Journal of the Australian Entomological
Society 21: 309-311.
Watson, J.A.L. 1991. The Australian Gomphidae (Odonata).
Invertebrate Taxonomy 5: 289-441.
Watson, J.A.L. and Arthington A.H. 1978. A new species of Orthetrum
from dune lakes in eastern Australia (Odonata: Libellulidae).
Journal of the Australian Entomological Society 17: 151-157.
Watson, J.A.L. and Dyce, A.L 1978. The larval habitat of Podopteryx
selysi (Odonata: Megapodagrionidae). Journal of the Australian
Entomological Society 17: 361-362.
Watson, J.A.L. and O’Farrell, A.F. 1991. Odonata (dragonflies and
damselflies). In CSIRO (eds). The Insects of Australia, pp. 294-
310. 2 nd edition. Melbourne University Press: Melbourne.
Watson, J.A.L. and O’Farrell, A.F. 1994. Odonata (dragonflies and
damselflies). In Naumann (ed.). Systematic & Applied
Entomology. Melbourne University Press: Carlton.
Watson, J.A.L. and Theischinger, G. 1980. The larva of
Antipodophlebia asthenes (Tillyard): a terrestrial dragonfly?
(Anisoptera: Aeshnidae). Odonatologica 9: 253-258.
Watson, J.A.L. and Theischinger, G. 1984. Regions of taxonomic
disjunctions in Australian Odonata and other freshwater insects.
Odonatologica 13: 147-157.
Watson, J.A.L. and Theischinger, G. 1987. Anax georgius Selys, 1872
(Odonata: Aeshnidae) rediscovered, in Australia. Journal of the
Australian Entomological Society 26: 67-71.
Watson, T., Theischinger, G. and Abbey, H. 1991. The Australian
Dragonflies. A Guide to the Identification, Distribution and
Habitats of Australian Odonata. CSIRO: Canberra and
Melbourne.
Williams, W.D. 1980. Australian Freshwater Life. 2nd Ed. MacMillan:
Melbourne.
Young, W.J. 2001. Riverine animals 6.1 Invertebrates large and
small, pp. 223-228 in Young, W.J. CSIRO land and Water (ed.)
Rivers as Ecological Systems: The Murray Darling Basin.
Memoirs of Museum Victoria 72:121-129 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
A reassessment of the pycnogonid genus Stylopallene (Arthropoda,
Callipallenidae) with description of a new genus
DAVID A. Staples (http://zoobank.org/urn:lsid:zoobank.org:author:E7483D15-ECCD-4066-975D-FFB401309363)
Museum Victoria, GPO Box 666, Melbourne, Victoria, 3001, Australia (dstaples@museum.vic.gov.au)
http://zoobank.Org/urn:lsid:zoobank.org:pub:44100BE0-6002-4467-B58F-lB104735AE2F
Abstract Staples D.A. 2014. A reassessment of the Pycnogonid Genus Stylopallene (Arthropoda, Callipallenidae) with description
of a new genus. Memoirs of the Museum of Victoria 72: 121-129.
The genus Stylopallene comprising only four species is reviewed. All species are recorded from Australia,
predominantly from the southern and south-eastern coastlines in association with arborescent bryozoans. Sexual
dimorphism in the scape segments is recognized in the genus for the first time. The status of Stylopallene dorsospinum is
re-evaluated and assigned to the new genus Bamberene. A diagnosis of the new genus is provided along with additional
images to complement existing figures.
Keywords Callipallenidae, Stylopallene , Bamberene, southern Australia, Western Port, pycnogonid, arborescent bryozoans
Introduction
This is the second paper reviewing the family Callipallenidae.
The first paper summarized the systematic position of the
family and reviewed the genus Pseudopallene (Staples, 2014).
In this paper the genus Stylopallene (Clark, 1963) is reviewed.
The genus Stylopallene was erected by Clark (1963) to
accommodate several specimens from Port Arthur, southern
Tasmania. The type species of the genus is S. cheilorhynchus
Clark, 1963. In the same paper Clark described S. dorsospinum
Clark, 1963 and S. tubirostris Clark, 1963 both recorded from
localities off the New South Wales coastline. Stock (1973a)
recorded a fourth species, S. longicauda Stock, 1973a from
Western Port, Victoria. Stylopallene cheilorhynchus,
S. longicauda and S. tubirostris share a smooth, oval trunk;
similarly shaped chela with fingers much shorter than the
palm; eight eye lenses; sexually dimorphic scape segments
and the presence of an oviger claw. These species are
associated with arborescent bryozoans predominantly
belonging to the genus Amathia Lamouroux, 1812. Since the
recent introduction of the seasonally abundant bryozoan
Zoobotryon sp. (possibly Z. verticillatum ) into Western Port,
Victoria, S. longicauda has also been associated with that
genus. Juveniles are carried by the adult male presumably
until they reach the stage of independence (fig. 2C). All three
species are active swimmers (fig. 2E, F). Other species
wait description.
Proximolateral processes found on the chelifore scapes of
all female Stylopallene are grasped by the male chelae and
serve as anchoring points during the mating process (fig. 2D).
These processes do however appear to have a structure more
complex than simply folds in the cuticle to be grasped by the
male and I suspect that their full function is still to be resolved
(fig. 3C, H). Similar processes or nodes are recorded on the
chelifore scapes of Cheilopallene nodulosa (Hong and Kim,
1987) and were suspected by Nakamura and Child (1991) to be
indicators of sexual dimorphism.
Stylopallene dorsospinum does not accord with the
accepted concept of Stylopallene. The trunk is extremely
compact, almost circular in outline and with tall mid-dorsal
trunk processes. The cephalon is shorter than the remainder of
the trunk and there is no obvious neck. There are four eyes
only; the chela palm is much shorter than the fingers; the
female scape shows no evidence of sexual dimorphism, and
the oviger claw is absent.
In the absence of a terminal claw on the ovigers, S.
dorsospinum conforms to the diagnoses of Callipallene Flynn,
1929, Pallenoides Stock, 1951 and Austropallene Hodgson,
1915. In these genera the trunk is elongate with clearly-spaced
lateral processes that do not conform to the compact, inflated
and almost circular shape of S. dorsospinum. The highly
developed dorsal trunk processes, the tapering proboscis with
protruding jaws and gaping, smooth chela fingers of S.
dorsospinum have no counterpart in Callipallene and
Pallenoides. Auxiliary claws are always present and well
developed in Callipallene whereas in Pallenoides they may be
absent, small or vestigial but the fan-shaped oviger spines in
Pallenoides are characteristic of that genus. Stylopallene
dorsospinum substantially agrees with the diagnosis of
122
D.A. Staples
Austropallene; in particular with Austropallene cristata
(Bouvier, 1911) with which it shares the robust mid-dorsal
trunk processes. It also shares a strongly tapered proboscis
with A. tibicina Caiman, 1915. Interestingly both these species
are recorded from the Campbell Plateau in far southern New
Zealand waters and are geographically closest to the recorded
distribution of S. dorsospinum. Possession of femoral cement
glands is shared with Austropallene but no species shares the
compact, almost circular body shape with S. dorsospinum or
chelifore fingers which are conspicuously longer than the
palm. The chelifore scapes of S. dorsospinum are carried
directly in front of the cephalon and the chelae are directed
slightly outward from the midline of the scapes. In all species
of Austropallene the chelifore scapes are directed away from
the midline and the chelae face inward to transverse the front
of the proboscis. The oviger spines in Austropallene are
numerous and distinctly compound whereas in S. dorsospinum
they tend to be few in number variably developed. The
Antarctic and sub-Antarctic distribution records of
Austropallene are also inconsistent with the temperate water
records of S. dorsospinum. So far as I am aware the presence
of male genital pores on all legs of S. dorsospinum is unique
within the family.
Stylopallene dorsospinum cannot be accommodated in
any existing genus in the family Callipallenidae and a new
genus Bamberene is proposed.
As a consequence of this ongoing family review, the
necessity to modify generic diagnoses is evident. The status of
specimens assigned to species incertae sedis will need to be
resolved and in some cases this may only be accommodated
by the erection of additional genera.
A generic key is deferred pending the unraveling of these
taxonomic issues.
Materials and methods
Comparative material was sourced from the Australian
Museum (AM), Museum Victoria (NMV) and the author’s
private collection.
Unless stated otherwise, terminology and measurements
are as defined by Fry and Hedgpeth 1969.
Reference to the neck region of the cephalon refers to the
narrow section between the anterior margin of the first lateral
processes and the base of the distal inflated part or crop.
The length of the trunk is measured from the anterior
margin of the cephalon to the tip of a fourth lateral process.
Leg span represents the sum of individual leg segments of
the third pair of legs plus the width of the trunk measured
across the second lateral processes. Measurements are derived
from the original descriptions of the type specimens and
adjusted where necessary in the light of additional material.
The leg span should be regarded as an approximation of a
typical specimen.
Photographs of live specimens were taken in situ by the
author. Preserved specimens were photographed by the author
using a Leica DM5000 B compound microscope and a Leica
DC500 camera with montage software.
For the purpose of this paper, the term ‘larvae’ describes
individuals still attached to the male ovigers and ‘juvenile’ to
those unattached individuals with incompletely developed legs.
The term ‘swimming’ refers to the vigorous treading
action that lifts the specimen into the water column thenceforth
to be carried by the currents.
The term ‘lips’ appears to have been first introduced by
Stock, 1955 to describe the projecting mouth parts of the genus
Cheilopallene (Cheilos: lip) and was again used by Clark
(1963) in his diagnosis of Stylopallene. In neither genera are
the lips attached to, nor do they surround, any other structure
that could otherwise be defined as jaws in which case the lips
are simply modified jaws. A more appropriate description
would perhaps have been ‘lip-like’ jaws. The term ‘jaws’ is
used throughout this paper to describe the three antimeres
surrounding the mouth opening.
Callipallenidae Hilton, 1942
Stylopallene Clark, 1963
Diagnosis (modified from Clark, 1963). Trunk robust,
compact, smooth, ovoid. Cephalon well developed, length
about equal to remainder of trunk, neck broad, hardly
narrowing throughout. Lateral processes touching or almost
touching, separated from central inflated part of the trunk by a
transverse suture. Ocular tubercle low, rounded, wider than
tall and placed on posterior half of cephalon. Eight eyes,
arranged in four groups of two. Proboscis glabrous, with a
broad cylindrical basal part tapering to a narrow, short or long
tubular distal part separated by a transverse cuticular suture.
Jaws tripartite, projecting, pointed, glabrous. Abdomen
fusiform, broad or slender, not reaching beyond the end of
coxa 1 of leg 4. Palps absent. The orientation of the chelifores
follows the curvature of the trunk, chelifore scape one-
segmented, female with proximolateral process on each scape.
Chela fingers held in prolongation with the palm, shorter than
palm, curved, gaping when closed, non-denticulate,
immoveable finger blunt, rounded throughout, without defined
chitinous cutting edge, moveable finger pointed, both fingers
contorted in early juvenile stages. Ovigers ten-segmented in
both sexes, terminal claw non-denticulate or with single tooth,
distal apophysis on fifth segment in male globular, strigilis
spines weakly denticulate. Legs stout, smooth, propodus
curved, with well-defined heel. Auxiliary claws absent.
Femoral cement gland ducts absent. Genital pores on ventral
surface of coxa 2 on all legs of female, legs 3 and 4 of male.
Type species. Stylopallene cheilorhynchus Clark, 1963.
Stylopallene cheilorhynchus Clark, 1963.
Figurel A-F
Stylopallene cheilorhynchus. Clark, 1963: 36-38—Stock, 1973a:
117-Stock, 1973b: 92-Staples, 1997: 1055-Staples, 2005: 166-
168—Arango and Brenneis, 2013: 430
Remarks. The leg span is about 20 mm. The segmentation
between trunk segments 3 and 4 is present but indistinct. The
Reassessment of the genus Stylopallene Staples
123
first two pairs of lateral processes are often more widely
separated than the others, processes 2-4 are touching
throughout most of their length or narrowly separated. The
length of the narrow distal part of the proboscis is about 40%
of the basal part. The abdomen is short, broad, shield-shaped
and directed slightly downward. A depression at the base of the
abdomen gives the impression that it is segmented and possibly
accounts for Clark’s illustration of a segmentation line (Clark,
1963, fig. 19A). The oviger spines are variable and irregular in
shape; the spine teeth are generally poorly developed. The
terminal claw is strong, about one-third the length of segment
10 and with a slightly irregular inner margin but without teeth.
A piece of a fragmented exuvia shows that the trunk
separates around the lateral ecdysial line and that the dorsal
Figure 1. Stylopallene cheilorhynchus, A, B, male, dorsal and lateral views of trunk; C, female, anterior view; D, live specimen; E, protonymphon
on ovigers; F, discarded exuvia.
124
D.A. Staples
surface of the trunk is discarded inclusive of the lateral
processes and abdomen. The transverse suture that divides the
trunk from the lateral processes remains intact. The abdomen
does not separate into dorsal and ventral components (fig. IF).
This species is most-often recorded in association with
Amathia wilsoni Kirkpatrick, 1888. Specimens are present in
large numbers seasonally with fertile specimens commonly
observed from November to April in water temperatures of
15-26 degrees centigrade and less frequently at other times of
the year. Fifty-two protonymphon which probably represents
more than one mating event have been recorded from a single
oviger. Ovigerous and larvae-bearing males together with
juveniles at various stages of development are recorded from
the same bryozoan colony. Juvenile chela fingers are slender,
distorted of the form described by Staples (2005 figs. 5B).
Body markings. Specimens are usually described as being
‘banded’. The abdomen, central region of trunk and proboscis
are typically cream; lateral processes are dark. The cephalon is
mostly dark dorsally, widening from the ocular tubercle to the
base of the chelifores. The chelifore scapes are light and the
chelae black. The distal half to one-third of the femur and
tibiae are black, tarsus black, dorso-distal surface of propodus
black and claw light. Distal oviger segments black. The light
colour may vary slightly from cream to yellow or with a slightly
green tinge.
Stylopallene cheilorhynchus is widely distributed and
often recorded along the southern Australian coastline.
Distribution. Southern New South Wales to southern Western
Australia and Tasmania at 1.0 to 90 m depth.
Stylopallene longicauda Stock, 1973
Figures 2 A-D
Stylopallene longicauda. Stock, 1973a: 117-119—Staples, 1997:
1055—Sherwood et al, 1998
Remarks. The leg span is typically about 30 mm. Although not
recorded by Stock, the segmentation line between trunk
segments 3 and 4 is present but often obscure. The first and
second pairs of lateral processes are usually more widely
spaced than the remainder which are touching at their bases
and narrowly separated distally. The transverse suture line in
the cuticle that separates the proximal part of the proboscis
from the tapered distal part was not illustrated by Stock (1973a,
fig. 8b). The distal portion of the proboscis is about one-third
the length of the basal part. The abdomen ranges from
horizontal to slightly inclined. The oviger spines are strongly
curved distally and have several irregular denticulations as
illustrated by Stock (1973a, fig. 8g). The terminal claw is
robust, smooth and curved inwards distally. A small tooth is
variably present on the inner margin of the claw at about the
point of curvature but in the specimens examined there is no
evidence of a tooth on the outer margin as illustrated by Stock
(1973a, fig. 8f). One or two tiny crenulations may follow the
main tooth. Thirty to forty eggs are carried on each male
oviger. This species is most often recorded in association with
the bryozoan Amathia biseriata Krauss, 1837.
Stylopallene longicauda and S. cheilorhynchus are
remarkably similar with identical colour patterns. The most
conspicuous difference is evident in the legs and abdomen of
S. longicauda which are longer and more slender. Little else
differentiates the two species.
Analysis of seventy-nine specimens of S. longicauda
collected from a single bryozoan colony in Western Port revealed
only one exception to the otherwise consistent colour pattern.
Records of S. longicauda outside of Western Port are rare.
Distribution Western Port, central Victoria.
Stylopallene tubirostris Clark, 1963
Figures 3A-H
Stylopallene tubirostris. Clark, 1963: 40-42—Child, 1975: 15-
16—Staples, 1997: 1055—Bamber, 2005: 334—Arango and Brenneis,
2013: 431
Siphopallene tubirostris Stock, 1968: 45-46
Siphopallene tubirostrum Stock, 1973b: 96
Remarks. The leg span is typically about 25 mm. The lateral
processes are either touching or narrowly separated at their
bases. The first and second processes are often more widely
spaced than the remainder. Clark (1963) recorded the length of
the cephalon as being equal to the remaining three segments
but in the specimens examined the cephalon is clearly longer
(fig. 3A). The syringe-like distal part of the proboscis is about
as long as the basal part and terminates in three short, chitinous
jaws. The abdomen is longer and narrower than figured by
Clark (1963 fig. 21 A). The oviger spines are variably compound
with 4-5 teeth mainly confined to the upper margin. One male
examined carried 15 eggs on a single oviger.
This species has been recorded on the arborescent
bryozoans Amathia tortuosa Tenison-Woods, 1880 and A.
woodsi Goldstein, 1879.
Anecdotal evidence suggests that this species is most
common in eastern Victoria and southern New South Wales.
Distribution. Yanchep Reef, Esperance Bay, Western Australia
to Coffs Harbour, New South Wales and Bass Strait, Tasmania.
Tide pools to 65m depth.
Discussion. The body markings of S. tubirostris are much the
same as in S. longicauda and S. cheilorhynchus but
distinguished by a black shoulder band or saddle that runs
through the ocular tubercle and by the dark chelifore scapes
(fig. 3A, E). The cephalon is otherwise a pale colour. By and
large the markings are constant and provide a useful initial
diagnostic character.
Along with other species of Stylopallene some specimens
have been described as having a pink tinge although this can
often be attributed to epiphytic coralline algae (fig. 3E).
Genus Bamberene gen. nov.
Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:
BF93B44B-479D-4DD3-BE50-2453D872F74A
Diagnosis. Trunk, compact, ovoid, mid-dorsal processes tall,
prominent, segmentation distinct, lateral processes and legs
Reassessment of the genus Stylopallene Staples
125
with numerous spiniform projections, cephalon shorter than
remainder of trunk, carried horizontally, neck constricted.
Dorsal swellings over bases of chelifore insertions bulbous,
occupying entire cephalon forward of the ocular tubercle.
Lateral processes in contact throughout length, separated from
the central trunk region by transverse suture lines. Ocular
tubercle taller than wide, placed on posterior half of cephalon.
Four eyes. Distal half of proboscis tapering to narrow tip, basal
half inflated with slight mid-constriction, the two halves
transition seamlessly. Abdomen fusiform, inflated in mid-
Figure 2. Stylopallene longicauda, A, B, male dorsal and lateral views of trunk; C, male carrying juveniles, D, mating pair, male dorsal; E,
swimming; F, plummeting on completion of the swimming phase.
126
D.A. Staples
Figure 3. Stylopallene tubirostris, A, B, male, dorsal and lateral views of trunk; C, female, anterior view of cephalon; D, scape process; E, live
specimen; F, juveniles on male; G, juvenile; H, exuviae attached to male oviger.
Reassessment of the genus Stylopallene Staples
127
region, not reaching beyond distal margin of fourth lateral
processes. Palps absent. Chelifores directed forward, apart
from spination there is no evidence of sexual dimorphism in
the scapes. Chelae directed slightly outwards from midline of
scapes, fingers much longer than palm, smooth, carried
vertically to each other. Ovigers ten-segmented, both sexes,
spines on segments 7-10 compound, few in number, terminal
claw absent, male segment 5 longest, with prominent distal
apophysis, female segment 4 longest. Legs with numerous
spine-tipped tubercles, tibia 2 longest, propodus gently curved
without prominent heel. In male, femoral cement glands
present. Genital pores on ventrodistal surface of coxa 2 of all
legs in both sexes; those of the female larger than the male.
Auxiliary claws absent.
Type species. Stylopallene dorsospinum Clark, 1963
Etymology. This genus name honors the outstanding
contribution by Dr. Roger Bamber to pycnogonid taxonomy
and literature. Gender feminine.
Bamberene dorsospina (Clark, 1963)
Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:
FD54384E-DF6A-4763-B1A9-BCC93C4C89F7
Figures 4 A-H
The specific name is here amended to the correct gender ending.
Stylopallene dorsospinum Clark, 1963: 38-40—Staples, 1997:
1055
Material examined. Australia, AM P42848 East of Long Reef, New
South Wales 33° 43'S, 151° 46'E, K85-21-08, 174 m, FRV Kapala, 12
Sep 1985,1 male, 1 female, 2 subadults. AM P43312 off Sydney, NSW,
33° 46'S, 151° 43'E, stn K77-23-01, 176m FRV Kapala, 12 May 1977,
2 males, 2 subadults, 1 juv. NMV J62425 Waterloo Bay, Wilsons
Promontory, 10 m, D.A. Staples, 28 Mar 1981, 1 female. NMV J48962
New South Wales, off Nowra, SLOPE 1 (34° 59. 31'S, 151° 05. 56'E),
204m, WHOI epibenthic sled, substrate coarse shell, coll. G.C.B.
Poore et al., 14 Jul 1986. 1 subadult.
Distribution. Port Phillip, Victoria to Botany Bay, New South
Wales. Depth 1-204 m.
Remarks. Leg span 15-20 mm. Clark’s description of S.
dorsospinum is based on three females, a damaged male and
two juveniles trawled off Twofold Bay and Wata Mooli, New
South Wales. Examination of additional material held in the
Australian museum and Museum Victoria has enabled further
observations to be recorded. The ocular tubercle has two
dorsal papillae. The proboscis is setose distally, the setae
surrounding the jaws being much shorter but denser than the
proximal setae so much so that the jaws are obscured when
closed (fig. 4F). The jaws appear to be soft and flexing, petal¬
like when open. The arthrodial membrane at the base of the
proboscis is broad enabling the proboscis to move through 45°
to a vertical position. The movable finger of the chela has an
outward bend in the mid-region which is most evident in
ventral view (fig. 4F). Near the tip of the finger is a short lip on
the inner margin upon which the tip of the immoveable finger
comes into contact when the chela is closed. The lip gives the
tip of the finger a slightly thickened, bifurcate appearance.
The oviger is ten-segmented and a terminal claw is completely
lacking (fig. 4D). In the male specimens examined the surfaces
of segments 7-10 are covered in filaments which obscure the
number of compound spines present. The terminal ‘boss-like
structure’ noted by Clark on the female oviger is not present
but several simple (some tiny) spines originate from the
surface, compound spines on segments 7-10 are slender with
one or two-pair of lateral teeth. The spine formula is variable
between specimens but spines are either absent or few (1-4).
Several simple spines are also present. A conical swelling on
the outer surface of segment 4 in both sexes is probably the site
of a gland opening. In the females examined it varies in size
between specimens.
In males, femoral cement glands are represented by two
pale swellings on the lateral margin of the posterior surface of
all legs. Gland openings are obscure (fig. 4B). Spines broken
off the dorsodistal part of the femur and elsewhere leave a
hollow in the basal tubercle giving the incorrect impression
that these are gland ducts. Females are less spinous than
males; the spine-tipped tubercles on the chelifore scape are
absent and those on the femur are less abundant.
Should Bamberene dorsospina adopt the same (dorsal to
ventral) mating position as do species of Meridionale (Staples
2014, fig. 4A) and Stylopallene (fig. 2E), then the presence of
mid-dorsal trunk processes would be an encumbrance to the
transfer of eggs. This suggests an alternative mating position
for this species and perhaps explains the absence of a
proximolateral chelifore scape process. In a group of otherwise
smooth species, the presence of dorsal processes may be of
evolutionary significance. In the light of this observation the
standing of Austropallene cristata (Bouvier, 1911) within
Austropallene may need to be reconsidered.
The host substrate and colour markings of S. dorsospina
are not recorded and evidence of body markings has not
persisted in the specimens examined.
Larval and juvenile forms. The protonymphon is attached to
the male oviger by a single thread extending from one chelifore.
A gland duct is not evident. The proboscis is not completely
developed in the early stages. At the stage where the third pair
of legs is present but still incompletely developed, the distal
tubiform part of the juvenile proboscis is absent. At this stage
the mouth is wide and open. The juvenile chela is well-
developed, fingers strongly bowed and gaping.
Acknowledgments
I am indebted Philip Bock for identification of bryozoans and
to Stephen Keable of the Australian Museum for facilitating
specimen loans. To Robert (Bob) Burn I express my gratitude
for his helpful advice in addressing nomenclature issues. I am
grateful to my son Aaron Staples for the presentation of
the images and to my colleagues Melanie Mackenzie and
Joanne Taylor for their ongoing assistance. To the reviewers
of my manuscript, I express my appreciation for their
constructive assessments.
128
D.A. Staples
Figure 4. Bamberene dorsospina, AM P42848 male. A, B, dorsal and ventral views of trunk; C, anterior view of cephalon: D, male, oviger; E,
female oviger; F, NMV J62425, proboscis tip and chelae; G, AM P43312 larva removed from male; H, juvenile removed from male.
Reassessment of the genus Stylopallene Staples
129
References
Arango, C.P, and Brenneis, G. 2013. New species of Australian
Pseudopallene (Pynogonida: Callipallenidae) based on live
colouration, morphology and DNA. Zootaxa, 3616 (5), 401-436.
Bamber, R.N. 2005. Pycnogonids (Arthropoda: Pycnogonida) from the
Recherche Archipelago, Esperance, Western Australia, Australia.
The Marine Flora and Fauna of Esperance, Western Australia.
Western Australian Museum, Perth. 325-341.
Bouvier, E.L. 1911. Observations sur les Pycnogonomorphes et
principalement sur le Pentapycnon geayi, espec tropicale a dix
pattes. Comptes rendus de l’Academie des Sciences., Paris, 152:
491-494.
Caiman W.T. 1915. Pycnogonida. British Antarctic (Terra Nova)
Expedition, 1910, Zoology. 3 (1): 1-74.
Child, C.A. 1975. Pycnogonida of Western Australia. Smithsonian
Contributions to Zoology 19, 1-29.
Clark, W.C. 1963. Australian Pycnogonida. Records of the Australian
Museum 26 (1), 1-81.
Flynn, T.T. 1929. Pycnogonida from the Queensland coast. Memoirs of
the Queensland Museum 9, (3), 252-260.
Fry, W.G. and Hedgpeth, J. W. (1969). The Fauna of the Ross Sea, Part
7. Pycnogonida, 1: Colossendeidae, Pycnogonidae, Endeidae,
Ammotheidae. New Zealand Department of Scientific and Industrial
Research Bulletin 198, 1-139.
Hilton, W.A. 1942. Pycnogonids from the Allan Hancock Expeditions.
Reports of the Allan Hancock Pacific Expedition, 5 (9), 277-339.
Hodgson, T.V. 1915. The Pycnogonida collected by the Gauss in the
Antarctic regions. Annals and Magazine of Natural History 8, 141-
149.
Hong, J.S. and Kim, I.H. 1987. Korean Pycnogonids Chiefly Based on
the Collections of the Korea Ocean Research and Development
Institute. Korean Journal of Systematic Zoology, 3 (2), 137-164.
Nakamura, K. and Child, C.A. 1991. Pycnogonida from Waters Adjacent
to Japan. Smithsonian Contributions to Zoology, 512,1-74.
Sherwood, J., Walls, J.T. and Ritz, D.A. 1998. Amathamide alkaloids in
the pycnogonid, Stylopallene longicauda, epizoic on the chemically
defended bryozoan, Amathia wilsoni. Papers and Proceedings of the
Royal Society of Tasmania 732, 65-70.
Staples, D.A. 1997. Sea spiders or pycnogonids. (Phylum Arthropoda).
pp. 1040-1072 In Shepherd, S.A. and Davies, M. (eds). Marine
Invertebrates of Southern Australia. Part 111. (South Australian
Research and Development institute and Flora of South Australia
Handbooks Committee, Adelaide).
Staples, D.A. 2005. Pycnogonida of the Althorpe Islands, South
Australia. Transactions of the Royal Society of South Australia
(2005), 129(2), 158-169.
Staples D.A. 2014. A Revision of the callipallenid genus Pseudopallene
Wilson, 1878 (Pycnogonida, Callipallenidae). Zootaxa 3765 (4):
339-359.
Stock J.H. 1951. Resultats scientifiques des croisieres du navire-ecole
beige “Mercator”. V. Pantopoda. Memories, Institut Royal des
Sciences Naturelles de Belgique 2,1-23.
Stock, J.H. 1968. Pycnogonida collected by the Galathea and Anton
Braun in the Indian and Pacific Oceans. Videnskabelige Meddelelser
Fra Dansk Naturhistorisk Forening, i kjpbenhavn (131), 7-65.
Stock, J.H. 1973a. Pycnogonids from south-eastern Australia. Beaufortia,
20,99-127.
Stock, J.H. 1973b. Achelia shepherdi n. sp. and other Pycnogonida from
Australia. Beaufortia. 21, (279), 91-98.
Memoirs of Museum Victoria 72:131-140 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
A new species of Sigsbeia and additional records of ophiuroids from the Great
Australian Bight
TIMOTHY D. O’Hara (http://zoobank.org/urn:lsid:zoobank.org:author:9538328F-592D-4DD0-9B3F-7D7B135D5263) AND
CAROLINE Harding (http://zoobank.org/urn:lsid:zoobank.org:author:FC3B4738-4973-4A74-B6A4-F0E606627674)
Museum Victoria, GPO Box 666E, Melbourne, 3001, AUSTRALIA. Correspondence: tohara@museum.vic.gov.au
http://zoobank.Org/urn:lsid:zoobank.org:pub:D2C88781-FF15-4103-A312-0AF9AA3EBD64
Abstract O'Hara, T.D. and Harding, C. 2014. A new species of Sigsbeia and additional records of ophiuroids from the Great
Australian Bight. Memoirs of Museum Victoria 72: 131-140.
A new species of Sigsbeia (Hemieuryalidae: Ophiuroidea) is described from south-western Australia. Previously,
all species of Hemieuryalidae sensu stricto have been found in the tropical western Atlantic and eastern Pacific Oceans.
Consequently, all currently recognised families of Ophiuroidea now have been collected from the Australian and New
Zealand region. Additional new ophiuroid records from the Great Australian Bight include Astrotoma manilense,
Ophiothrix albostriata, previously known only from the holotype, and Ophiomusium scalare. New Zealand records
formerly called Astrotoma drachi are referred to A. manilense. The available name Ophiomusium aporum is synonymised
with O. scalare rather than O. incertum or O. australe where it has previously been placed.
Keywords Ophiuroidea, Australia, marine, continental slope, Hemieuryalidae, Astrotoma, Ophiothrix, Ophiomusium
Introduction
As part of a multi-institutional project to survey marine
biodiversity on the continental slope of the Great Australian
Bight (GAB, for more details see Acknowledgements), one of
us (TOH) was commissioned to identify ophiuroids in the
South Australian Museum collected from the outer shelf and
slope of this region. This report is some taxonomic changes
arising from this research, including the description of a new
species, one species not seen since the holotype, and alterations
to two existing synonymies.
The ophiuroid fauna of the GAB is not well known. Tall
cliffs surround much of the coastline preventing ready access
to shallow water. Moreover, there have been few targeted
expeditions to survey the seafloor biodiversity of either the
continental shelf, slope or abyss. The USSR Dmitry Mendeleev
Cruise 16 sampled the Bight in February 1976 with the resulting
material being deposited in various museums, including
Museum Victoria, the Australian Museum, Te Papa in New
Zealand, and the Russian Academy of Sciences Institute of
Oceanology in Moscow (Baker 1979; Litvinova 2010; O’Hara
unpublished). There have been three important expeditions on
Australia’s research vessel Franklin (FR0594, FR0694 and
FR0795), the first being a biodiversity study of eastern South-
Australia (the second SLOPE survey, lead by Museum
Victoria), and the second two examining the formation of
bicarbonate sediments (James & Bone 2011). There have been
two expeditions on Australia’s RV Southern Surveyor (SS01/00
and SS03/2008) which sampled a few stations in the GAB in
order to characterise the benthos and understand ecosystem
function. Most of museum collections from the region have
been collected as incidental coastal collections, dredged by the
naturalist Sir Joseph Verco between 1890 and 1912 (Verco,
1935) and reported by H.L. Clark (1928), or as bycatch on
fishing vessels in the 1980s (O’Hara unpublished data).
Montage photos were taken with a Leica 205C DFC
microscope mounted camera and Zerene Stacker software.
Abbreviations include: SAM (South Australian Museum,
Adelaide), AM (Australian Museum, Sydney), MV (Museum
Victoria, Melbourne), MCZ (Museum of Comparative
Zoology, Harvard), NIWA (National Institute of Water and
Atmospheric Research, Wellington), TMAG (Tasmanian
Museum and Art Gallery, Hobart), d.d. (disc diameter).
Systematic Account
Family Hemieuryalidae
Sigsbeia oloughlini sp. nov.
Fig. 1 and 2.
Zoobank LSID. http://zoobank.org:act:AE0247F3-DAE5-4F5E-
B966-431AD6668EA9
Material examined. — Australia. FR0795: stn 111, SW of Esperance,
34° 23'S, 120° 39'E, 95 m, 1995, holotype: 1 (SAM K4005).
132
T.D. O’Hara & C. Harding
Figure 1. Sigsbeia oloughlini sp. nov., holotype SAM K4005, A, dorsal view; B, ventral view.
A new species of Sigsbeia and additional records of ophiuroids from the Great Australian Bight
133
Figure 2. Sigsbeia oloughlini sp. nov., holotype SAM K4005, A, dorsal disc details; B, lateral view of disc and arm base; C, lateral view of arm
showing supplementary dorsal arm plates; D, arm tip; E, ventral view of disc; F, ventral view of disc and base of arm.
134
T.D. O’Hara & C. Harding
Description. Disc 4.8 mm d.d., arms five, approximately 14 mm
long. Disc round to pentagonal, covered in flat polygonal to
rounded plates. Primary disc plates are distinct, separated by a
series of small interradial plates. A 2nd circle of larger radial and
interradial plates occurs near the proximal end of the radial
shields, separated by small intercalary platelets. A long narrow
plate is present at the interradial margin, 2 times as long as wide,
separated from the parallel radial shields by a single series of
small platelets. The radial shields are long narrow plates, 3.5-4
times as long as wide, that extend from near the arm base, around
the arm, to the latero-ventral edge of the disc. They converge
proximally, but do not touch, separated by the secondary radial
plate. There are 1-3 tumid quadrangular to triangular plates on
the lower side of each arm base, adjacent to the radial shield,
which are potentially homologous to the series of plates distal to
the radial shields in Ophiolepis and Ophiozonella.
The ventral interradial disc is completely covered in plates,
including short wide plates at the proximal margin, probably
rudimentary genital scales. The central area is dominated by 2-3
tumid to protuberant plates, surrounded by 1-2 series of small
intercalary platelets. The genital slits are small, and extend from
the oral shield for the length of the 1st lateral arm plate.
The jaws are wider than long, with 4 oral papillae on each
side that almost completely cover the jaw slit; the inner ones are
block-like (almost resembling the infradental papillae on
amphiurids), the 2nd and 3rd are smaller, trapezoid, slightly
longer than wide, the distal ones are enlarged, 1-5-2 times as
wide as long, with an angle proximally and a sloping distal
edge. There is also a tiny recurved scale wrapped around the
2nd oral tentacle pore near the apex of the slit. The oral shields
are roughly pentagonal, with rounded angles and concave
proximo-lateral margins, as wide as long. The madreporite is
distinct and enlarged. The adoral shields are sausage-shaped, 2
times as wide as long, separated proximally by a triangular
intercalary plate.
The 1st dorsal arm plates are triangular, 2 times as wide as
long, and are placed where the arm is inserted into the disc,
adjacent to the secondary radial plate and proximal ends of the
radial shields. Subsequent plates are oblong to hexagonal,
becoming progressively larger and longer from the 2nd to 4th
plate, 2-4 times as wide as long with straight proximal and
distal margins and a convex to angular lateral margins, fully
contiguous until about the 12th plate, after which they become
pronounced proximally, as wide as long, and narrowly separate.
There are 1-3 accessory dorsal arm plates extending from the
distolateral edge of each dorsal arm plate. The largest accessory
plate is triangular and contiguous with the main dorsal arm
plate. There is often a smaller triangular plate extending from
the ventral corner of the larger plate to near the upper arm
spine. A tiny intercalary plate is sometimes present at the distal
junction of the main dorsal and largest accessory arm plate.
The first 2 arm segments have only a single accessory plate
angled distally with respect to the dorsal arm plate.
The lateral arm plate extends around the arm from the dorsal
to ventral arm plate, having a swollen ventro-distal flange which
usually bears 2 small cylindrical arm spines, the upper is 2 times
as tall as wide with a blunt rounded apex, the lower is slightly
longer or subequal, to 2/3rds the length of the arm segment.
There is one, almost granule-like, spine on the first segment and
up to 3 cylindrical spines on some segments near the arm tip.
The 1st ventral arm plate is rounded-triangular, the
proximal angle forms the apex of the jaw slit, the proximolateral
sides are contiguous with the adoral plates and the lateral end
of the distal margin with the first lateral arm plates, the centre
of the distal margin is contiguous with the 2nd ventral arm
plate. The 2nd plate is bell-shaped to pentagonal, with a curved
to angular proximal margin, sides recurved around the tentacle
pore, and a convex distal margin. From the 3rd plate, the plates
are sunken around the margin and covered in thick epithelium
or connective tissue, the raised central portion of the plate is
pentagonal to ovoid, the 3rd and 4th slightly wider than long,
and thereafter as wide as long. The tentacle pores are oval, the
base as long as the raised section of the ventral arm plate, but
becoming progressively shorter. A thin sunken oval tentacle
scale almost completely covers the pore.
The colour (in ethanol) is brown and white. The dorsal disc
is mostly brown, except for a splash of white from the centre to
one interradial margin and series of small white intercalary
plates around the radial shields. Arms are banded, with 1-2
pale and 2-3 darker segments; in addition, there is a strong
narrow transverse white band along the distal edge of each
dorsal arm plate and adjacent accessory plates. The oral
shields (often with whiter proximal apices), ventral disc plates
adjacent to the oral shields and the intercalary plate separating
the adoral shields are also pale. The distal ventral disc plates,
raised section of the ventral arm plates, lateral arm plates,
tentacle scales, adoral shields and oral plates are brown.
Distribution. Southwestern Western Australia, 95 m
Remarks. Despite being known from only one specimen, which
precludes dissection, this species has characteristic features that
warrant its description. We place it in the genus Sigsbeia in the
family Hemieuryalidae on the basis of the coiled arms, adapted
for an epizoic habit, the integration of the arms into the disc, the
narrow radial shields that extend around the lateral disc margin
almost to the ventral surface, the presence of accessory plates at
the distal lateral comers of the dorsal arm plates, the single tentacle
scale and the second oral tentacle pore hidden within the jaw slit.
Matsumoto (1915) recognised two subfamilies within the
Hemieuryalidae, the Hemieuryalinae with supplementary or
subdivided dorsal arm plates and the Ophiochondrinae with
entire plates. Martynov (2010) reviewed several genera within
the Ophiochondrinae and on the basis of their arm spine
articulation morphology regarded them as belonging to the
Ophiacanthidae. He thus restricted the Hemieuryalidae to
those genera formerly in the Hemieuryalinae, explicitly
Hemieuryale von Martens, 1867 and Sigsbeia Lyman, 1878b.
To these we can add the similar genera Quironia A.H. Clark,
1934, Ophioplus Verrill, 1899, and Ophioholcus H.L. Clark,
1915. Two additional genera remain problematic and require
further study. Ophioleila A.H. Clark, 1949 is superficially
similar to Ophioplinthaca, an ophiacanthid, and Amphigyptis
Nielsen, 1932 was provisionally referred to the synonymy of
the amphiurid Axiognathus (=Amphipholis ) by Thomas (1966).
The other genera of hemieuryalids are separated from
Sigsbeia as follows (Fell 1960). Hemieuryale has fragmented
A new species of Sigsbeia and additional records of ophiuroids from the Great Australian Bight
135
dorsal arm plates, Ophioholcus has 6 arms and contiguous
radial shields, Quironia also has 6 arms and a single genital slit
in each interradius that continues around the distal edge of the
oral shield, and Ophioplus has a few accessory plates spaced
along the distal edge of the dorsal arm plates. All four of these
genera are monospecific, with their species restricted to the
Caribbean/Western Atlantic continental shelf and upper slope.
The four previously known species of Sigsbeia differ from
S. oloughlini most notably in the morphology of the disc plates,
dorsal arm plates, arm spines and colour pattern. The type
species, S. murrhina Lyman, 1878b (holotype: 12 mm d.d.) and
S. conifera Koehler, 1914 (5 mm d.d.), both from the Caribbean,
have granulated disc plates, a single rectangular to ovoid
accessory dorsal arm plate, and two rounded, slightly flattened,
arm spines. Furthermore, on S. conifera some of the larger
dorsal disc plates are tumid and the dorsal plates non-contiguous
after the basal few. Sigsbeia lineata Liitken & Mortensen, 1899
from the Galapagos and Cocos Islands has smooth disc plates
without granules and the inner end of the ventral arm plates
sunken like on S. oloughlini, but has flat widened arm spines, a
trapezoid accessory arm plate, and two thin longitudinal stripes
running from the disc down each side of the dorsal arm surface.
Finally, Sigsbeia laevis Ziesenhene, 1940 from the Pacific coast
of Panama has tumid but ungranulated disc plates, small dorsal
arm plates, as long as wide, barely contiguous, and flattened
plate-like ovoid arm spines, and a squarish to rounded accessory
arm plate. None of these species have the tumid ventral disc
plates characteristic of S. oloughlini.
Different authors have disagreed about the nature of the
accessory dorsal arm plates. While Lyman (1878b), Koehler
(1914) and Fell (1960) have treated them as accessory arm
plates, Liitken & Mortensen (1899) and Ziesenhenne (1940)
considered them as highly modified upper arm spines that
overlie the lateral arm plate. While the ontology of these plates
cannot be fully addressed from our single specimen, here they
do appear to be true plates, lying in a series confluent with the
dorsal arm plate and abutting the edge of the previous lateral
arm plate. They do not align with the two arm spines which
emerge from a distal flange of the lateral arm plate. Moreover,
where these accessory plates are missing, the underlying areas
appear to be at least partially decalcified, suggesting that they
are dorsal arm plates. Under this interpretation, these plates and
the arm spines have converged in morphology in S. laevis and S.
lineata, possibly functioning as a frictional aide to climbing.
The position of the accessory dorsal arm plates in S.
oloughlini recalls Ophiolepis species such as O. elegans
Liitken, 1859 or O. superba H.L. Clark, 1915b. In fact, the
overall morphology is quite similar to Ophiolepis, including
the integration of the arms into the disc, the form of the oral
frame, and the disc plating. In particular, the row of disc plates
that are placed distal to the radial shields in Ophiolepis and
related genera are also apparent in Sigsbeia - the middle plate
placed between the proximal ends of the radial shields and the
lateral ones positioned at the base of the arm between the
radial shields and third dorsal arm plate. Ophiolepis can be
distinguished by its smaller radial shields, which are largely
restricted to the dorsal surface and the long genital slits
bordered by elongated genital scales.
This is the first record of a hemieuryalid species outside
the equatorial western Atlantic and eastern Pacific. Now all
recognised families of ophiuroids have been recorded from
the Australian/New Zealand region. The new record from the
outer continental shelf off SW Australia may indicate a lack of
sampling at these depths from this region. Three of the other
four Sigsbeia have been recorded living on stylasterids. The
catch description for this sample did not record stylasterids
explicitly but did record abundant octocorals, ascidians,
sponges, and bryozoans.
Etymology. Named after Mark O’Loughlin, teacher, mentor
and friend (of TOH) for over 35 years.
Family Gorgonocephalidae
Astrotoma manilense Doderlein, 1927
Astrotoma manilense Doderlein, 1927: 19-21, pi. l(l-lb).
Astrotoma drachi.— McKnight, 2000: 68, fig. 33, pi. 32.—Okanishi
& Fujita, 2013: 569 [Non Astrotoma drachi Guille A, 1979].
Material examined. Great Australian Bight. 110 nm due W of
Whidbey Point, 34° 65'S, 132° 51'E, 880-940 m, 1989: 2 (SAM K2734).
- 165 nm SW of Eucla, 33° 23'S, 126° 26.3'E, 391-398 m, 1988: 1
(SAM K3105). - 75 nm ESE of Cape Arid, 34° 15’S, 124° 42’E, 920-
1120 m, 1989: 1 (SAM K2732). - 105 nm SSE of Eucla, 33° 35'S, 129°
4'E, 860-931 m, 1989: 4 (SAM K2731). - Adelaide Pearl: stn 15, 125
nm E of Cape Arid, 34° 3’S, 125° 3PE, 1011-1020 m, 1988: 1 (SAM
K2763). - Adelaide Pearl: stn 28, 125 nm S of Eucla, 33° 45'S, 129°
17'E, 999-1110 m, 1988: 3 (SAM K2762); 1 (SAM K2726).- 80 nm SW
of Pearson Is, 35° 4’S, 133° 35’E, 900-960 m, 1989: 1 (SAM K3106).
- Margaret Phillipa 6: stn 4, South of Ceduna, 33° 48’S, 130° 33’E to
33° 42'S, 130° 31'E, 1040 m, 1984: 3 (TMAG H1985).
New South Wales. NZOI: stn U223, east of Newcastle, New
South Wales, Australia, 32° 58.8'S, 152° 41.598'E, 1150 m, 1982: 1
(NIWA 49781). - K88-22: stn 01, east of Ulladulla, 35° 27'S, 150°
54'E, 1060-1123 m, 1988: 1 (AM J22108).
New Zealand. TAN0604: stn 133, Shipley Seamount, 41°
48.072'S, 179° 29.61’W to 41° 48.03'S, 179° 30.198’W, 1240-1275 m,
2006: 1 (NIWA 42265). - TAN0705: stn 211, 9D19, 42° 39.28'S, 177°
12.792’W to 42° 38.88’S, 177° 12.462’W, 1377-1402 m, 2007, identified
by Okanishi & Fujita (2013) as Astrotoma drachi : 1 (NIWA 30980).
- NZOI: stn 1666, 47° 47.502'S, 178° 59.502'W, 1165 m, 1979,
identified by McKnight (2000) as Astrotoma drachi: 1 (NIWA 48404);
1 (NIWA 48405). - TRIP1650: stn 23, 46° 45'S, 170° 3'E, 1036-1312
m, 2002: 1 (NIWA 49785).- TRIP2124: stn 21, 49° ITS, 176° 18'E,
1192-1300 m, 2006: 1 (NIWA 75841).
Distribution. Philippines (721 m), Japan (660-710 m), Great
Australian Bight (391-1120 m), Eastern Australia (1060-1150
m), SE New Zealand (1036-1402 m).
Remarks. There is a large Astrotoma species present on the
continental slope of southern Australia and New Zealand in 400-
1400 m. Specimens collected to date form three populations, in
the Great Australian Bight, off New South Wales and off south¬
east New Zealand, including the Campbell Plateau and the
Chatham Rise. The latter population was first reported by
McKnight (2000) who referred one lot (NZOI 1666) to the
species A. drachi Guille, 1979 without comment. This is one of
three similar species of Astrotoma reported from a few
specimens from the Philippines and Japan. The differences
136
T.D. O’Hara & C. Harding
between these species are minor, slight modifications to the
shape and density of the disc tubercles on the disc and the
number of arm spines, and may be related to size, with the
holotype of A. manilense measuring 31 mm d.d., A. drachi is 15
mm d.d., and A. deficiens Koehler, 1922 is 21 mm d.d..
Examination of a series of specimens from the Great
Australian Bight indicates that there is some variation with
growth. Smaller specimens (e.g. 2 specimens in SAM K2762;
10-12 mm d.d.) appear like A. drachi with 2 (rarely 3) arm
spines, sparse disc tubercles, and granular suboral papillae.
Larger specimens are like A. manilense (e.g., SAM K3106,
K3105; 25 & 34 mm d.d.) with a variable (medium to dense)
coating of stout hemispherical to cylindrical disc tubercles on
the radial shields and interradial margin, 3 (rarely 4) arm spines
and spiniform suboral papillae. Astrotoma deficiens may differ
in predominantly having conical pointed disc tubercles.
Without examining a range of specimens from the
Philippines, we are hesitant to formally synonymise any of
these species. However, there is no evidence of multiple species
in the Australian and New Zealand region and we refer all
specimens to the species A. manilense , as this name has date
priority and represents the adult form. We note that no specimens
of Astrotoma have been found in the tropical southern
hemisphere, including the densely sampled New Caledonian
region. Thus, as defined here, A. manilense has a disjunct
distribution, with at least four isolated populations. Molecular
data is required to further investigate species boundaries in this
genus. The species is adequately figured my McKnight (2000).
The only other species of Astrotoma is the type A. agassizii
Lyman, 1875 from circum-Antarctica and southern South
America. It differs from the other species in having a covering
of fine granules on the disc. Astrotoma agassizii has been
found to both brood young and have a pelagic larva (Heimeier
et al. 2010) and Hunter & Halanych (2008) also found several
separate genetic lineages that may indicate cryptic speciation.
Family Ophiotrichidae
Ophiothrix (. Placophiothrix ) albostriata H.L. Clark, 1928
Fig. 3
Ophiothrix albostriata Clark, H.L., 1928: 429-430, fig. 127.
Placophiothrix albostriata.—Clark, H.L., 1946: 227.
Ophiothrix (Placophiothrix) albostriata.— Clark, A.M., 1967:
648.—Baker & Devaney, 1981: 167, fig. 49-54.—Rowe & Gates, 1995: 427.
Material examined. — Great Australian Bight, holotype: 1 (SAM
K215). — Great Australian Bight, 75 nm SSW of Pearson Is, 35° 8'S,
133° 47'E, 920-1040 m, 1989: 2 (SAM K2748).
Figure 3. Ophiothrix albostriata H.L. Clark, 1928, SAM K2748, A, dorsal view of disc and arm base, B, ventral view of disc and arm base; C,
details of disc spinelets visible through epithelium.
A new species of Sigsbeia and additional records of ophiuroids from the Great Australian Bight
137
Distribution. Great Australian Bight, 7200-1040 m.
Remarks. This is the first record of this species since the 10 mm
d.d. holotype was described by H.L. Clark in 1928. Baker &
Devaney (1981) figured the dorsal disc and arms of the holotype.
Key diagnostic characters include the large (2/5 d.d.) naked
radial shields; the tall (3-4x longer than wide) cylindrical disc
stumps with a crown of small thorns; the wide (2x as wide as
long) dorsal arm plates, with a centrally produced distal margin,
and two longitudinal lines (after the 20th segment); up to 9 arm
spines, the longest (2-3rd from the top) measuring 2x the width
of the dorsal arm plate, slightly expanded at the tip, with thorns
largely restricted to the apical half of the spine; oral shield
diamond-shaped, twice as wide as long; ventral arm plates
rectangular, 1.5x as wide as long, with a straight distal edge, and
a minute tentacle scale that becomes hook-shaped distally with
2-3 accessory points.
The two new specimens are considerably larger than the
type, 16 and 17 mm d.d., but share many of the features.
Differences include the elongated thorns on the disc spines,
which can measure Vi the height of the spine, the presence of a
row of minute spines along the abradial edge of the radial
shield, and the distal edge of the dorsal arm plates with is
convex rather than medially produced. The largest specimen
(Fig. 3a) has three longitudinal broken lines along the arm,
occasionally darkened into discrete spots, which can also
occur at the distal end of the radial shields.
These specimens were collected from 920-1040 m, which
is exceptionally deep for an ophiotrichid. The collection
details on the type specimen only list the locality (Great
Australian Bight) and not the depth, latitude/longitude or date.
Like many other specimens described by H.L. Clark in 1928,
they were presumably collected by the malacologist Joseph
Verco, who is known to have participated in an expedition by
the Australian fishery research vessel ‘Endeavour’ to the Great
Australian Bight in March 1909 (Verco 1935). They trawled
predominately along the “one hundred fathom line” in
approximately 125-220 m of water in an area 30-120 nautical
miles (55-222 km) west of Eucla. Possibly this species is
restricted to the upper continental slope (200-1040 m).
Family Ophiolepididae
Ophiomusium scalare Lyman, 1878
Fig. 4
Figure 4. Ophiomusium scalare Lyman, 1878, MV F214065, A, dorsal view of disc and arm base, B, ventral view of disc and arm base; C, lateral
view of arm segments from mid arm showing the three short arm spines clustered together (broken off from some segments), the middle arm
spine is microscopically hooked distally.
138
T.D. O’Hara & C. Harding
Ophiomusium scalare Lyman, 1878a: 117-118, pi. l(l-3).-Lyman,
1882:95-96,pi. l(4-6).-Koehler, 1897:308-312,pl. 6(24-25).-Koehler,
1899: 26-28, pi. 2(12-13), 3(21).-Koehler, 1904: 65,-Clark, H.L.,
1915a: 334,-Matsumoto, 1917: 285-268, fig. 77,-Koehler, 1922: 417,
pi. 89(7), 90(1-2).- -Koehl er, 1930: 242-243.-McKnight, 1975:
64-65.—Irimura, 1981: 40-41.-Guille, 1981: 454, pi. 9(56-57).-Vadon
& Guille, 1984: 584.-Rowe, 1989: 287,-Imaoka et al„ 1990: 93, fig.
51.—McKnight, 1993: 176, 189,-Liao & Clark, A.M. 1995: 296-297,
fig. 167.—Rowe & Gates, 1995: 435.—Stohr, 2011: 45-46, fig. 21g-I.
Ophiomusium aporum Clark, H.L., 1928: 447-449, fig.
134.-Clark, H.L., 1946: 275 [new synonymy].
Non Ophiomusium aporum.- Madsen, 1967: 143, fig. 8 [=
Ophiomusium incertum Koehler R, 1930; according to Baker, 1979].
Material examined. — ‘Spencer and St Vincent Gulfs’, holotype of O.
aporum : 1 (SAM K255). - 100 nm SSE of Cape du Couedic, 900-
1000 m, 1988: 1 (SAM K3990). - SS03/2008: stn47. Great Australian
Bight, 35° 12.564'S, 134° 27.012'E, 456 m, 2008 to 2008: 1 (MV
F159801). - SS03/2008: stn 69, 35° 8.436'S, 134° 16.482'E, 450 m,
2008 to 2008: 15 (MV F159741). - SS03/2008: stn 126, 35° 13.77'S,
134° 30.798'E to 35° 14.268'S, 134° 30.78’E, 300-400 m, 2008 to
2008: 4 (MV F159752). - SLOPE: stn 203, Off Murray River mouth
Encounter Bay, 37° 1.42'S, 137° 44.19’E to 37° 1.13'S, 137° 44.18’E,
403 m, 1994 to 1994: 18 (MV F89438). - FR0694: stn 22, 58 nm SW
Coffin Bay, 35° 27'S, 134° 48.6'E, 300-400 m, 1994: 10 (SAM K2770).
- SS10/2005: stn 80, Jurien Bay, 29° 50.514’S, 114° 21.72'E to 29°
51.012'S, 114° 22.02'E, 408-427 m, 2005 to 2005: 7 (MV F112020).
- SS10/2005: stn 34, Bald Island, 35° 12.81'S, 118° 39.06’E to 35°
12.24'S, 118° 40.14'E, 431-408 m, 2005 to 2005: 300 (MV F111164).
Distribution. India, Indonesia, western and south-western
Australia, Philippines, Japan, SW Pacific from Papua New
Guinea to the northern Louisville Ridge. Depth range 124-
1100 m
Remarks. H.L. Clark (1928) described two specimens of
Ophiomusium from South Australia as a new species O.
aporum. However, in 1946 he subsequently synonymised his
species with O. incertum Koehler, 1930, the existence of which
he had been unaware in 1928. Baker (1979) re-examined both
specimens and referred the holotype (SAM K481) to O.
australis H.L. Clark, 1928, on the basis that tentacle pores are
present on the first two arm segments, but leaving the smaller
3.3 mm d.d. paratype (MCZ 4712) as O. incertum.
However, after examination of hundreds of Ophiomusium
specimens from southern Australia, we consider that there are
three species characterised by having two-tumid plates along
each disc margin. These are 1) O. australe with smooth disc
plates, two arm spines (see O’Hara 1990), two ventral arm
plates and pore pairs (see Baker & Devaney 1981 fig. 25-28),
2) O. incertum with granulated disc plates, 3-5 arm spines, no
obvious pore pairs (except in small juveniles, see O’Hara
1990), and no ventral arm plates (see Madsen 1967 fig. 8), and
3) O. scalare with disc covered in wrinkled skin, 3 arm spines,
and two ventral arm plates and pore pairs.
We judge that the holotype of Ophiomusium aporum is
closer to O. scalare than O. incertum , as it has wrinkled skin
on the disc, two (although frequently indistinct) pore pairs,
and 3 arm spines. However, O. scalare is morphologically
variable (particularly the appearance of the dorsal disc) across
its large range and the form found off SW Australia could
easily be a separate cryptic species for which the name O.
aporum would be available. Ophiomusium scalare is known
from the Andaman Islands to Tonga, and Japan to the Taupo
Seamount in the Tasman Sea. It usually occurs in 100-1500 m.
A very similar species, O. ultima Hertz, 1927 has been
recorded off eastern Africa. We have not had the opportunity
to examine the smaller paratype of O. aporum in the MCZ
which has been described as having no tentacle pores and a
granulated disc. Our other records of O. incertum are restricted
to Tasmania and eastern Bass Strait.
Discussion
The last major study on the ophiuroids of the GAB was by
H.L. Clark (1928), where he described or reported species
from the South Australian Museum collections, many dredged
by the naturalist Joseph Verco. Unfortunately, the location
data on many of these specimens were imprecise and assumed
to be St Vincent and Spencer Gulfs where Verco did much of
his dredging. Verco also dredged along the upper continental
slope off Beachport (to 550 m) and Kangaroo Island (to 210 m)
(Verco 1935). This is significant as the seafloor depth in the
Gulfs is limited to less than 40 m but many of the species
reported by Clark have only been subsequently found on the
outer continental shelf or more usually the upper continental
slope (> 100 m) (O’Hara, unpublished information). These
species include Ophioscolex cf glacialis, Ophiacantha
brachygnatha, Amphiophiura collecta {-A. urbana ), Ophiura
ooplax, Ophiomusium anisacanthum, O. simplex var australe
(=0. australe ), and O. aporum ( =0. scalare, see above), and
Ophiozonella elevata (=0. bispinosa). Thus it is likely that the
reported localities for all these species (and the type localities
of O. brachygnatha and the Ophiomusium spp) are the upper
continental slope of eastern to central South Australia.
The discovery of new ophiuroid species on the continental
shelf and upper slope of South Australia indicates that the
fauna is still inadequately sampled to be complete. The report
of a hemieuryalid species on the Southern Australian coast is
remarkable as this family (as now restricted) has previously
only been found in the tropical western Atlantic and eastern
Pacific. However, this trans-Pacific distribution also occurs in
some other relict genera. For example Ophiopteris species are
only known from New Zealand and California (Devaney
1970). Extant Ophiocrossota is only known from southern
Australia ( O. multispina)\ however, fossils of this easily
recognised genus have also been found from the Miocene and
Eocene of the western United States (Blake, 1975; Blake &
Allison 1970) and the Miocene of Patagonia (Caviglia et al.
2007).
Acknowledgements
We thank the Great Australian Bight Research Program for
funding TOH to visit the South Australian Museum. The Great
Australian Bight Research Program is a collaboration between
BP, CSIRO, the South Australian Research and Development
Institute (SARDI), the University of Adelaide, and Flinders
University. We also thank Dr Andrea Crowther of the South
Australian Museum for providing collection support for the
visit, subsequent loans and data requests.
A new species of Sigsbeia and additional records of ophiuroids from the Great Australian Bight
139
References
Baker, A.N. 1979. Some Ophiuroidea from the Tasman Sea and
adjacent waters. New Zealand Journal of Zoology, 6: 21-51.
Baker, A.N. & Devaney, D.M. 1981. New records of Ophiuroidea
Echinodermata from southern Australia, including new species of
Ophiacantha and Ophionereis. Transactions of the Royal Society
of South Australia , 105: 155-178.
Blake, D. B. & Allison, R.C. 1970. A new west American Eocene
species of the Recent Australian ophiuroid Ophiocrossota.
Journal of Paleontology, 44: 925-927.
Blake, D.B. 1975. A new West American Miocene species of the
modern Australian ophiuroid Ophiocrossota. Journal of
Paleontology, 49: 501-507.
Caviglia, S.E., Martinez, S. & Del Rio, C.J. 2007. A new Early
Miocene species of Ophiocrossota Ophiuroidea from Southern
Patagonia, Argentina. Neues Jahrbuch fiir Geologie und
Paldontologie - Abhandlungen, 245: 147-152.
Clark, A.H. 1934. A new genus of brittle star from Puerto Rico.
Smithsonian Miscellaneous Collections, 91: 1-3, pi. 1.
Clark, A.H. 1949. Ophiuroidea of the Hawaiian Islands. Bulletin of the
Bernice Pauahi Bishop Museum, 195: 3-133.
Clark, A.M. 1967. Notes on the family Ophiotrichidae Ophiuroidea.
Annals and Magazine of Natural History, 9: 637-656, pis 10-11.
Clark, H.L. 1915a. Catalogue of recent ophiurans: based on the
collection of the Museum of Comparative Zoology. Memoirs of
the Museum of Comparative Zoology, Harvard University, 25:
165-376, pis 1-20.
Clark, H.L. 1915b. Echinoderms of Ceylon other than holothurians.
Spolia Zeylandica, 10: 83-102.
Clark, H.L. 1928. The sea-lilies, sea-stars, brittle-stars and sea-
urchins of the South Australian Museum. Records of the South
Australian Museum, 3: 361-482.
Clark, H.L. 1946. The echinoderm fauna of Australia. Its composition
and its origin. Carnegie Institution of Washington Publication,
566: 1-567.
Devaney, D.M. 1970. Studies on ophiocomid brittlestars. I. A new genus
Clarkcoma of Ophiocominae with a reevaluation of the genus
Ophiocoma Smithsonian Contributions to Zoology, 51: 1-41.
Doderlein, L. 1927. Indopacifische Euryalae. Abhandlungen der
Bayerische Akademie der Wissenschaften, 31: 1-105, pis 1-10.
Fell, H.B. 1960. Synoptic keys to the genera of Ophiuroidea. Zoological
Publications of the Victoria University Wellington, 26: 1-44.
Guille, A. 1979. Astrotoma drachi, nouvelle espece bathyale
d’ophiuride Gorgonocephalidae des iles Philippines. Vie Millieu,
28: 437-442.
Guille, A. 1981. Echinodermes: Ophiurides. Memoires de ORSTOM,
91: 413-456.
Heimeier, D., Lavery, S., Sewell, M.A. 2010. Molecular Species
Identification of Astrotoma agassizii from planktonic embryos:
further evidence for a cryptic species complex. Journal of
Heredity, 101: 775-779.
Hertz, M. 1927. Die Ophiuroiden der deutschen Tiefsee-Expedition. 1.
Chilophiurida Mats. Ophiolepididae: Ophioleucidae:
Ophiodermatidae: Ophiocomidae. Wissenschaftliche Ergebnisse
der Deutschen Tiefsee-Expedition auf dem Dampfer ‘Valdivia’
1898-1899, 22: 59-122, pis 6-9.
Hunter, R.L. & Halanych, K.M. 2008. Evaluating connectivity in the
brooding brittle star Astrotoma agassizii across the Drake passage
in the Southern Ocean. Journal of Heredity, 99: 137-148.
Imaoka, T., Irimura, S., Okutani, T., Oguro, C., Shigei, M. & Horikawa,
H. 1990. Echinoderms from continental shelf and slope around
Japan Vol. 1., Japan Fisheries Resource Conservation Association,
Tokyo, 159 pp.
Irimura, S. 1981. Ophiurans of Tanabe Bay and its vicinity, with the
description of a new species of Ophiocentrus. Publications of the
Seto Marine Biological Laboratory, 26: 15-49, pi. 1.
James, N.P. & Bone, Y. 2011. Neritic Carbonate Sediments in a
Temperate Realm: Southern Australia., Springer, Dordrecht,
247 pp.
Koehler, R. 1897. Echinodermes recueillis par TInvestigator dans
l’Ocean Indien. I. Les ophiures de mer profonde. Annales des
Sciences Naturelles, Zoologie, 8: 277-372, pis 5-9.
Koehler, R. 1899. An account of the deep-sea Ophiuroidea collected
by the Royal Indian Marine Survey ship Investigator., Indian
Museum, Calcutta, 76 pp, 14 pis.
Koehler, R. 1904. Ophiures de mer profonde. Siboga-Expeditie, 45:
1-176, pis 1-36.
Koehler, R. 1914. A contribution to the study of ophiurans of the
United States National Museum. Bulletin of the United States
National Museum, 84: 1-173, pis 1-18.
Koehler, R. 1922. Contributions to the biology of the Philippine
Archipelago and adjacent regions. Ophiurans of the Philippine
seas and adjacent waters. Bulletin of the United States National
Museum, 100: 1-486, pis 1-103.
Koehler, R. 1930. Ophiures recueillies par le Docteur Th. Mortensen
dans les Mers d Australie et dans TArchipel Malais. Videnskabelige
Meddelelser fra Danslc Naturhistorislc Forening, 89: 1-295,
pis 1-22.
Liao, Y. & Clark, A.M. 1995. The echinoderms of southern China,
Science Press, Beijing, 614 pp, 23 pis.
Litvinova, N.M. 2010. Catalogue of Brittle Stars Echinodermata,
Ophiuroidea of the World Ocean, from the Collection of the
Laboratory of Ocean Benthic Fauna, P.P. Shirshov Institute of
Oceanology, Russian Academy of Sciences., URSS, Moscow,
1-70 pp.
Liitken, C.F. 1859. Additamenta ad historiam Ophiuridarum. 2.
Beskrivelser af nye eller hidtil kun ufoldstaendigt kjendte Arter af
Slangestjerner. Kongelige Danslce Videnslcabernes Selskabs
Skrifter, 5: 179-271, pis 1-5.
Liitken, C.F. & Mortensen, T. 1899. Reports on an exploration off the
west coasts of Mexico, Central and South America, and off the
Galapagos Islands, in charge of Alexander Agassiz by the U.S.
Fish Commission steamer Albatross, during 1891, Lieut.
Commander Z.L. Tanner, U.S.N., commanding. XXV. The
Ophiuridae. Memoirs of the Museum of Comparative Zoology,
Harvard University, 23: 93-208, pis 1-23.
Lyman, T. 1875. Zoological results of the Hassler Expedition. 2.
Ophiuridae and Astrophytidae. Illustrated Catalogue of the
Museum of Comparative Zoology, Harvard University, 8: 1-34,
5 pis.
Lyman, T. 1878a. Ophiuridae and Astrophytidae of the exploring
voyage of H.M.S. Challenger, under Prof. Sir Wyville Thomson,
F.R.S. Part 1. Bulletin of the Museum of Comparative Zoology,
Harvard University, 5: 65-168, pis 1-10.
Lyman, T. 1878b. Ophiurans and Astrophytons. Reports on the
dredging operations of the U.S. coast survey Str. ‘Blake’. Bulletin
of the Museum of Comparative Zoology, Harvard University, 5:
217-238,3 pis.
Lyman, T. 1882. Ophiuroidea. Report on the Scientific Results of the
Voyage of the Challenger Zoology, 5: 1-385, pis 1-48.
Madsen, F.J. 1967. Ophiuroidea. Report of the British, Australian and
New Zealand Antarctic Research Expedition 1929-1931, 9: 123-
144, pi. 1.
Martens, E. von 1867. Uber vier neue Schlangensterne, Ophiuren, des
Kgl. zoologischen Museums vor. Monatsberichte der deutschen
Akademie der Wissenschaften, Berlin, 1867: 345-348.
140
T.D. O’Hara & C. Harding
Martynov, A.V. 2010. Reassessment of the classification of the
Ophiuroidea Echinodermata, based on morphological characters.
I. General character evaluation and delineation of the families
Ophiomyxidae and Ophiacanthidae. Zootaxa, 2697: 1-154.
Matsumoto, H. 1915. A new classification of the Ophiuroidea: with
descriptions of new genera and species. Proceedings of the
Academy of Natural Sciences of Philadelphia, 67: 43-92.
Matsumoto, H. 1917. A monograph of Japanese Ophiuroidea, arranged
according to a new classification. Journal of the College of
Science, Imperial University Tokyo, 38: 1-408, pis 1-7.
McKnight, D.G. 1975. Some echinoderms from the northern Tasman
Sea. Records of the New Zealand Oceanographic Institute,
2: 49-76.
McKnight, D.G. 1993. Records of echinoderms excluding holothurians
from the Norfolk Ridge and Three Kings Rise north of New
Zealand. New Zealand Journal of Zoology, 20: 165-190.
McKnight, D.G. 2000. The marine fauna of New Zealand: Basket-
stars and snake-stars Echinodermata: Ophiuroidea: Euryalinida.
NIWA Biodiversity Memoir, 115: 1-79.
Nielsen, E. 1932. Papers from Dr. Th. Mortensen’s Pacific Expedition
1914-16. LIX. Ophiurans from the Gulf of Panama, California,
and the Strait of Georgia. Videnskabelige Meddelelser fra Dansk
Naturhistorisk Forening, 91: 241-346.
O’Hara, T.D. 1990. New records of Ophiuridae, Ophiacanthidae and
Ophiocomidae Echinodermata: Ophiuroidea from south-eastern
Australia. Memoirs of the Museum of Victoria, 50: 287-305.
Okanishi, M. & Fujita, T. 2013. Molecular phylogeny based on increased
number of species and genes revealed more robust family-level
systematics of the order Euryalida Echinodermata: Ophiuroidea.
Molecular Phylogenetics and Evolution, 69: 566-580.
Rowe, F.W.E. 1989. Nine new deep-water species of Echinodermata
from Norfolk Island and Wanganella Bank, northeastern Tasman
Sea, with a checklist of the echinoderm fauna. Proceedings of the
Linnean Society of New South Wales, 111: 257-291.
Rowe, F.W.E. & Gates, J. 1995. Zoological Catalogue of Australia.
Vol. 33 Echinodermata., CSIRO Australia, Melbourne, 1-510 pp.
Stohr, S. 2011. New records and new species of Ophiuroidea
Echinodermata from Lifou, Loyalty Islands, New Caledonia.
Zootaxa, 3089: 1-50.
Thomas, L.P. 1966. A revision of the tropical American species of
Amphipholis Echinodermata: Ophiuroidea. Bulletin of Marine
Science, 16: 827-833.
Vadon, C. & Guille, A. 1984. Les Ophiuridae Ophiuroidea,
Echinodermata de la campagne MD 32 du « Marion-Dufresne
» autour de Tile de La Reunion. Bulletin du Museum National
d’Histoire Naturelle. Paris, 6: 583-615.
Verco, J. 1935. Combing the Southern Seas Edited by B.C. Cotton,
The Mail Newspapers, Adelaide, 174 pp.
Verrill, A.E. 1899. Report on the Ophiuroidea collected by the
Bahama expedition in 1893. Bulletin of the Laboratories of
Natural History of the State of Iowa, 5: 1-88, pis 1-8.
Ziesenhenne, F.C. 1940. New ophiurans of the Allan Hancock Pacific
Expeditions Allan Hancock Pacific Expedition, 8: 9-59.
Memoirs of Museum Victoria 72:141-151 (2014) Published December 2014
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/
Value and impacts of collecting vertebrate voucher specimens, with guidelines for
ethical collection
Nick Clemann 1 *, Karen M. C. Rowe 2 , Kevin C. Rowe 2 , Tarmo Raadik 1 , Martin Gomon 2 , Peter Menkhorst 1 ,
Joanna Sumner 2 , Dianne Bray 2 , Mark Norman 2 and Jane Melville 2
1 Arthur Rylah Institute for E nvironmental Research, Department of Environment, Land, Water and Planning, 123 Brown St,
Heidelberg VIC 3084.
2 Museum Victoria, Sciences Department, G.P.O. Box 666, Melbourne, VIC 3001
*to whom correspondence should be addressed. E-mail: nick.clemann@delwp.vic.gov.au
Abstract Clemann, N., Rowe, K.M.C., Rowe, K.C., Raadik, T., Gomon, M., Menkhorst, P., Sumner, J., Bray, D., Norman, M. and
Melville, J. 2014. Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection.
Memoirs of Museum Victoria 72: 141-151.
Museum collections of preserved faunal specimens are immensely valuable resources for understanding the natural
world, and such understanding has a crucial role to play during the current biodiversity extinction crisis. Collections of
specimens, and the benefits accrued by collections, are not static; new and fresh specimens, or specimens from uncollected
localities or of differing demographics, are always needed. Despite this, resistance to collecting specimens is mounting, as
is an erroneous belief that modern techniques (such as molecular analyses) and technologies (such as digital cameras and
tracking devices) negate the need to collect specimens. Contemporary technology sometimes facilitates a reduction in the
number of voucher specimens that need to be collected, but it does not eliminate the need to collect. Concerns about
animal rights have and will continue to play a crucial and desirable role in rectifying unnecessarily poor treatment of
fauna, but we believe that judicious collection of specimens is at times a higher priority than preserving the life of every
possible individual. We argue that museum collections provide essential verifiable evidence of species' occurrence over
time and space, and thus permit rigorous taxonomic, biological and ecological investigations. The value of specimen data
for these studies today and for the decades and centuries that follow, justifies the judicious collecting of specimens. Using
local examples, we demonstrate the benefits provided by specimens, the need for continued collecting in Victoria, and a
framework with which to guide the decision-making process for the collection of vertebrate specimens.
Keywords voucher specimen, fauna, museum, Victoria, natural history collections
Introduction
“A? this point I wish to emphasize what I believe will ultimately
prove to be the greatest value of our museum. This value will
not, however, be realized until the lapse of many years,
possibly a century, assuming that our material is safely
preserved. And this is that the student of the future will have
access to the original record of faunal conditions in California
and the west, wherever we now work.” (Grinnell 1910, p. 166).
Collections of voucher specimens that are catalogued and
curated in museums provide a critical foundation for taxonomy,
evolutionary biology, biodiversity research, conservation
biology, and public health and safety (Suarez and Tsutsui,
2004). Voucher specimens provide verifiable and permanent
records of wildlife and environmental conditions. In contrast
to many forms of botanical collection where only parts of a
plant are collected, faunal voucher specimens require the
sacrificing of an individual animal. Understandably, that loss
of an animal’s life results in concerns about animal welfare
and conservation (Lunney, 2012), particularly for vertebrates
(there is generally far less concern voiced about the welfare of
invertebrates). Thus the decision to collect an animal is not
made lightly or without substantial independent permitting
and review. However, increasing resistance to the collecting of
specimens (e.g., Minteer et al., 2014) threatens to undermine
the imperative to record today's dynamic faunal conditions for
future generations to reference and study.
The Australian state of Victoria’s Flora & Fauna Guarantee
Act (1988) requires that all of Victorias native flora and fauna
can survive, flourish and retain potential for evolutionary
development. This legislative requirement cannot be met without
a clear understanding of the taxa that make up Victoria’s biota -
an understanding that cannot be achieved without comprehensive
specimen collections. Furthermore, the Museums Act (1983)
states that the functions of Museum Victoria are, ‘to develop and
maintain the State collections of natural sciences, ...[and] to
promote the use of those collections for scientific research.’
142
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
In this paper, we first argue that the maintenance and
scientific value of faunal collections require continued
collection of voucher specimens, using vertebrate specimen
collection in Victoria as a focus. Second, we present a
framework with which researchers can evaluate the need for
and guide the collection of vertebrate specimens.
What are voucher specimens?
Voucher specimens are verifiable and permanent records,
because they preserve as much of the physical remains of an
organism as possible (Gans, 1993). Traditional voucher
specimens include taxidermied study skins, cleaned skeletal
material, and spirit specimens (Table 1). The latter represent
whole or partial animals fixed in a preservative (e.g., formalin
or ethanol). Each of these preparation methods preserves
different aspects of an organism, requiring multiple specimens
to document as complete a record as possible.
The formal taxonomic description of every non-fossil
species is based on traditional voucher specimens, and the
type specimens upon which the names of species are defined
must be voucher specimens. Voucher specimens are extremely
valuable because they preserve the characters by which species
can be distinguished. In many instances, these are very small,
requiring microscopy (e.g., reptile scale counts, pre-anal and
femoral pores, and subdigital lamellae), or are not present or
visible on the external anatomy (e.g., skull characteristics), so
a whole voucher specimen is critical to their definition.
Current methods of specimen preparation and collection
retain more data than ever (Table 1) and can be used in a
multitude of ways (Vuilleumier, 1998). Modern specimens are
often coupled with photographs, audio recordings (e.g., frog
calls), and GPS-based localities that improve the documentation
of their condition and provenance. The greatest shift in modern
voucher specimens has been the proliferation of genetic
samples coupled with traditional whole animal vouchers.
These genetic samples are collected from multiple tissue types
(e.g., muscle, heart, liver), and preserved cryogenically or in a
fixative that slows degradation (e.g., ethanol, RNALater).
Increasingly over the last decade, these tissue samples have
been accessed for uses other than just DNA, including
messenger RNA (the expressed form of DNA in cells),
proteins, parasites, venoms, toxins and odorant compounds
(e.g., Perkins et al., 1998; Nishimura et al., 2012).
The value of genetic samples to museum research has led
to an increasingly common perspective that non-destructive
genetic samples collected directly (e.g., blood, tail tip) or
indirectly (e.g., scat, hair, feathers) from the animal are
adequate replacements for physical specimens (Minteer et al.
2014; Table 1). These non-destructive genetic samples are
valuable because they can provide a larger population genetic
sample size than would otherwise be prudent if collected as
vouchers from a single locality. In some species, where genetic
variation has been previously characterised, non-destructive
genetic samples can also provide documentation of an
individual’s identity. However, genetic samples lack many
other sources of information preserved in voucher specimens
(Rocha et al., 2014). Non-destructive genetic samples are
typically small in size / volume, and often provide sufficient
material for only limited analyses or just a single research
project. Thus, they have restricted utility for documenting a
species permanently. They also lack relevant RNA and other
molecular information that is preserved in the tissues of entire
voucher specimens. Finally, genetic samples without voucher
specimens do not retain phenotypic morphological information
that could be associated with genetic variation (for a practical
example of why this is important, see Adams et al. 2014).
Victorian species’ records also come in the form of
photographs, videos, and audio recordings. For some species,
these can be sufficient to identify currently recognised species,
and they provide a low impact and efficient way to document
species’ occurrences. These records can preserve various
aspects of an organism that otherwise are not preserved in
voucher specimens (e.g., calls, behaviour). However, the value
of these records is limited when taxonomy redefines species’
limits, or for species that are difficult to distinguish from gross
external morphology. Many small and complex characters that
define species are not apparent on photographs. Images captured
by remotely-triggered camera systems are often of low
resolution; these enable identification of well-known species,
but can be of limited value for small or similar species. In
contrast, voucher specimens provide a range of data that cannot
be quantified from photographs, such as colour, morphology,
internal structures, diet, sex, and reproductive data.
Purely observational records, where there is no
substantiated record of the species except the notes of an
astute observer, reduces the long-term value of the data
because questionable records are unverifiable (Rocha et al.,
2014). The validity of an observation as a permanent record is
dependent on both the expertise of the observer and the degree
to which the expertise of the observer is known by the end
user. These records also lose value with changes in taxonomy
where it can be impossible to assign the original identification
to a currently recognised species. Observational records that
are coupled with representative voucher specimens are the
most valuable because they demonstrate the expertise and
accuracy of the observer, and can be assigned to species even
after taxonomic revision.
Why are voucher specimens so valuable?
The immense value of specimen collections for research and
reference underpins our understanding of biodiversity, and
these collections are critical for conservation assessments now
and in the centuries that follow. Voucher specimens serve a
variety of purposes, including providing the foundation for
understanding taxonomy and biodiversity, and are a verifiable
record of faunal conditions over time and space that can be
referred to repeatedly into the future. Museum collections are
used in many ways, including contributing to public health and
safety by permitting an examination of the history of infectious
diseases and their sources or reservoirs (e.g., Suarez and
Tsutsui, 2004). Perhaps the greatest value of specimens is that
they provide opportunities for future study. Here we highlight
some of the more common uses of voucher specimens within
Victoria’s vertebrate collections.
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
143
Table 1. Types of vertebrate records, their uses and drawbacks, and the direct impact of these records on individual fauna.
Record Type
Examples
Information content / uses
Example of uses
Drawbacks
Direct impact
to individual
Voucher
specimen
(non-DNA)
Skins, skeletons,
spirit specimens
Complete record of species’
morphological phenotype
(internal and external)
Lasting record
Taxonomy, species identification;
dietary analysis, morphological
adaptation and acclimation,
reproductive biology, ontogenetic
studies, biogeography, demographic
studies (e.g., sex ratios), global
change and phenotypes, isotopic
analysis, disease and public health
research, ecotoxicology, phenology
Removes individual from
the population; time- and
cost-intensive; requires
specialised skills
Death
Voucher
specimen
(DNA)
Tissues
Complete genome of
individuals, tissue-specific
RNA expression, proteins,
parasites and disease
Phylogenetics, species delimitation,
population genetics, phylogeography,
kinship, proteomics, transcriptomics,
public health and disease, genotype-
phenotype association studies
Removes individual from
the population, time- and
cost-intensive, requires
specialised skills
Death
Direct DNA
specimens
Ear snip; toe / tail /
fin clip; blood
sample
Complete genome of
individual. Value greatly
increased by subsamples of
voucher specimens from
same locality
Phylogenetics, population genetics,
phylogeography, kinship, species
delimitation (if coupled with
vouchers from same locality)
No record of the
individual’s phenotype;
difficult to assign to new
taxa when described.
Often limited in quantity
allowing relatively few
studies. Does not preserve
RNA
Minimal
Indirect DNA
specimens
Scat, hair, feather
sample, shed skin,
scale, skin and
buccal swabs
Some genetic approaches,
testing for pathogens (e.g.,
the amphibian chytrid fungus
in frogs)
Predator dietary analysis, species
identification (where species are
readily distinguishable by limited
DNA alone), population genetics,
phylogeography
Contamination issues
relating to mis-
identifications. Poor
quality DNA for most
genetic techniques
None
Image and
audio
recordings
Camera traps,
photographs,
video, audio
recordings
Captures an image or audio
recording of fauna, including
its colouration. Provides
species record that can be
evaluated by multiple people,
can ‘ride out’ inappropriate
survey weather, allows for 24
hour site surveying
Broad-scale surveys and monitoring
particularly for species with large
ranges, rare encounters, or in difficult
to sample habitats
Not suitable to detect some
species; characters
required for identification
may be obscured or
missed. Sex, age, and
other phenotypes not
preserved
None
Observation
Visual or auditory
observation
reported by
individual
Potential species record at a
locality
Phenology (e.g.. Bird migrations),
distribution records, citizen science
(e.g., iNaturalist, BowerBird, eBird)
Unverifiable record; relies
on expertise of observer
and knowledge of
observer’s expertise by
end user
None
144
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
1. Taxonomy, recognition of biodiversity, and conservation
Species are the fundamental unit of biodiversity. Therefore,
responding to the modern biodiversity crisis (Pimm and Raven,
2009) requires a robust taxonomic and geographic understanding
of species’ limits. Delineation and description of species require
the definition of physical characters that can be measured or
observed on specimens. For every species, a designated holotype
(and usually a series of associated type specimens) provides the
physical evidence that justifies the application of a specific
name. Any changes in taxonomy require comparison to relevant
type specimens preserved in museum collections. Thus,
taxonomy without specimens does not exist.
Properly prepared and curated voucher specimens last
indefinitely, and thus provide a unique historical record of the
fauna of a given area (Gans, 1993). Taxonomic revisions, even
those using modern molecular techniques, that result in the
‘splitting’ of a nominal species into two or more taxa may not
only require the collection of new specimens, but also the
re-examination of existing specimens in order to determine
the identity of taxa that occur (or once occurred) in an area.
For example, morphological and genetic analyses demonstrated
that the lizard Rhynchoedura ornata consists of five species
(Pepper et al., 2011); however, specimens from Museum
Victoria were not included in this analysis, and assignation of
Victorian lizards previously referred to as R. ornata will
necessitate examination of existing preserved specimens from
Victoria, and perhaps collection of further specimens (P.
Robertson pers. comm.). The revision of the dasyurid
marsupial Antechinus stuartii revealed that southern
populations were a distinct species, Antechinus agilis,
requiring re-examination of voucher specimens from across
the range of the two species to determine distributional limits
(Dickman et al., 1998). Descriptions of new species of
Australian mammals demonstrate the need for effective
collecting (e.g., Kemper et al., 2011; Baker et al., 2012).
Similarly, taxonomic revisions in fishes are common; for
example, Galaxias olidus has recently been divided into 15
species (Raadik, 2011; Adams et al. 2014), necessitating a
re-examination of museum specimens from across Victoria
and south-eastern Australia to determine their identification
and distribution. In addition to providing the basis for naming
and describing species, voucher specimens are necessary for
the identification of morphologically similar taxa, such as the
freshwater fish Craterocephalus stercusmuscarum fulvus and
Craterocephalus fluviatilis (Ivantsoff and Crowley, 1996).
The conservation of species is increasingly concerned with
preserving evolutionary potential (Moritz, 2002), including local
adaptation and variation within species, which are population-
level phenomena, and dynamic over time. Subspecific taxa and /
or local variation are the drivers of evolution (Schodde and
Mason, 1999); only a comprehensive series of specimens from
across the geographic range of a species allows an appreciation
of variation within the species - an understanding that is essential
to the conservation of the diversity contained within that species,
and hence its evolutionary potential. In the words of Joseph
(2011), collections are ‘repositories of the evidence for and results
of evolution’ (p. i).
2. Ecology and the environment
Museum collections that include a variety of preparations, life
stages, geographic locations, and time series provide unique
opportunities to explore species’ ecologies and the status of
their environment (Pyke and Ehrlich, 2010). Specimens form a
primary resource for studying topics as diverse as reproduction,
morphology, skeletochronology, diet, habitat use and
preferences, and geographic distribution and variation (e.g.,
Shine, 1980a; 1980b; 1981; 1989; 1991). For example, fish
otoliths provide researchers with information on growth rates
and aging, general biology, habitat occupancy, recruitment,
movement and migration, as well as the diet of other species
(Campana, 2005; Furlani et al., 2007). This may be particularly
important for threatened, endangered and declining species, for
which these data are necessary to develop effective conservation
plans (e.g., Clemann et al., 2004). Specimen collection that
targets communities, such as marine surveys or general
collecting trips, can provide additional information, not only on
individual species present at a given location, but also give an
indication of community composition (Grinnell, 1910).
Understanding species’ distributions requires vouchers for
reliable and verifiable identification of the species, in addition
to locality data. The presence of a vouchered record from a
region helps to substantiate less verifiable records (such as
catch-and-release records, sightings, acoustic records, nests,
burrows and tracks) from that region. Significant records, such
as range extensions or first records of a species from a
jurisdiction (e.g., Raadik and Harrington, 1996; Clemann et
al., 2007; Gillespie and Chang-Kum; 2011; Kemper et al.,
2011), are best substantiated with a voucher specimen to
eliminate ambiguity in identification. Conversely, a lack of
vouchers can render published results unverifiable (Wheeler,
2003), and supposed records of some significance that are not
substantiated with sufficient evidence (e.g., Urlus and Marr,
2011) can be open to criticism (e.g., Clemann and Gillespie,
2012) . Distributional data (preferably substantiated by voucher
specimens), when combined with other spatially- and
temporally-explicit data (e.g., temperature, precipitation, land
use) can be used to predict the presence of species in areas that
have not been sampled (species distributional modelling; e.g.,
Kearney and Porter, 2004), or project likely distributions into
the future (e.g., Kearney et al., 2008).
In a dynamic world, collections have both a temporal and
spatial element (Gans, 1993; Feeley and Silman, 2011); changes
in geographic distribution, size class representation, disease
status over time (e.g., Cheng et al., 2011; Richards-Hrdlicka,
2012) and even physical changes in species over time (Gardner
et al., 2008; Eastman et al., 2012) necessitate specimen time-
series of varying duration. Newly emerging techniques can be
applied across historical samples to investigate temporal
changes in species’ distribution (see Smith et al., 2013). Natural
systems are dynamic, and processes such as climate change
mean that the value of specimens from a particular region is
not static; the faunal situation at any point in time provides a
data point for comparison with conditions before and after that
point in time. Shifts in distribution, age structure, timing of
breeding and migration (Green and Scharlemann, 2003), and
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
145
trophic level (Becker and Beissinger, 2006) can all be assessed
using long-term collections of specimens. Specimen series also
provide evidence of movement of taxa due to seasonal changes,
such as the transition or replacement of migratory species
across different seasons.
3. Future opportunities and value
Voucher specimens provide the most complete record of an
organism and the greatest opportunity for repeated and future
biological study, especially for unexpected uses (Rocha et al.,
2014). Failure to collect specimens can render some studies
unreliable because the identity of the study species cannot be
verified (Krell and Wheeler, 2014). The unexpected value of
museum specimens for future research is best exemplified by
the environmental disaster created by the pesticide DDT
(dichlorodiphenyltrichloroethane) in the middle of the 20 th
century. Comparison of eggshells in museum collections from
before and after 1946 (the onset of DDT use) demonstrated a
dramatic decrease in eggshell mass (Ratcliffe, 1967; Peakall
and Walker, 1994). This examination of museum specimens,
collected for entirely different purposes, was the first indication
of the devastating impacts of DDT on wildlife, and ultimately
led to legislative control of DDT use, and the subsequent
recovery of wildlife.
In 1857, when Wilhelm Blandowski, the first state zoologist
of Victoria, set out to chart the natural history of the arid
interior near the confluence of the Murray and Darling Rivers,
he presumably had no conception of a looming biodiversity
crisis and could not know that 11 of the mammal species he
collected would be extinct or extirpated from the region within
100 years (Menkhorst, 2009). Blandowski’s specimens,
preserved in the collections of Museum Victoria, provide a
critical record of species’ prior to their extinction or decline.
For example, the Lesser Stick-nest Rat Leporillus apicalis was
extinct by the 1930s, but on Blandowski’s expedition it was one
of the most common species collected, with 27 individuals still
in the collection of Museum Victoria. These specimens provide
a verifiable record that L. apicalis was a common component of
Victoria's semi-arid ecosystem prior to its extinction. Similarly,
there are Victorian species that have not been verifiably
recorded in the state for more than 40 years, such as the Eastern
Quoll Dasyurus viverrinus, the Grassland Earless Dragon
Tympanocryptis pinguicolla and the Southern Barred Frog
Mixophyes balbus\ it is plausible that these species no longer
occur in Victoria, and specimens of these species held by
Museum Victoria may represent the only material evidence
from their former occurrences in the State.
At the time of Blandowski’s expedition, the discovery of
DNA was about 100 years into the future, and, unknown to
Blandowski, the skins and skeletons he collected also
preserved fragments of DNA that can be extracted and
analysed today (Rowe et al., 2011; Bi et al., 2013). Stable
isotope analysis, in which slight changes in the atomic mass of
elements preserved in voucher specimens can be informative
about the diet, environment and movements of an organism, is
another emerging field that highlights the unexpected
information that can be obtained from voucher specimens
with new technology (Kelly, 2000; Newsome et al., 2007;
Inger and Bearhop, 2008; Hobson, 2011). The value of voucher
specimens and the depth of information that they preserve will
only increase as new technologies emerge.
Impact of voucher specimen collection on wild populations
The impact on wild populations of scientific collecting of
specimens is usually infinitesimally small, especially
compared with other causes of mortality, including predation,
disease, weather events, hunting, collision (e.g., road kill), and
habitat loss or alteration (Erickson et al., 2005; Skerratt et al.,
2007; Collins and Kays, 2011; Rocha etal., 2014). For example,
the entire vertebrate specimen collection of Museum Victoria,
compiled over more than 150 years from localities all over the
world, totals less than 640,000 specimens. Of these, fewer
than 200,000 individuals have been collected within Victoria
(Figure 1). These amount to fewer than one vertebrate
specimen (fish, amphibian, reptile, bird or mammal) per
square kilometre of Victoria over the last 150 years. Of course,
sampling is not evenly distributed across the state - the greatest
concentration of collecting has occurred in the Melbourne
metropolitan area (Figure 1). In many cases, specimens were
collected from localities where subsequent urban development
has eradicated the habitat and the populations of fauna that
occupied it. Key elements of the biology and the ecology of
those populations are now preserved as voucher specimens at
Museum Victoria.
Roads present a major source of mortality for wild
populations of native vertebrates. An estimated 377,000 to
1,500,000 vertebrates are killed along Tasmanian roads each
year (Hobday and Minstrell, 2008). Other studies have
estimated single species rates of road kill ranging from 2.1 to
78.8 individuals km 1 y 1 (Freeman, 2010 and references
therein; Quintero-Angel et al., 2012). Vehicles kill an
estimated five million Australian reptiles and frogs annually
(Ehmann and Cogger, 1985).
Exotic predators such as foxes and feral and domestic cats
also are a cause of significant mortality for small vertebrates
in Australia (Read and Bowen, 2001; Spencer and Thompson,
2005). Studies looking at predation by domestic cats have
suggested upwards of 85 million vertebrates were killed across
Great Britain within a 5-month period (Woods et al., 2003),
between 39 to 730 million animals are killed annually within
the state of Wisconsin in the USA (Coleman and Temple,
1996), and suburban cats in Canberra kill between 10.2 and
23.3 animals per cat annually (Barratt 1998). Similarly, in
freshwater environments, salmonids (trout) and other
introduced predatory fish species prey extensively on smaller
native fish (McDowall, 2006; Raadik, 2011; Harris, 2013) and
frog species (Gillespie, 2001), eliminating populations and
driving some species close to extinction.
Hunting and fishing, both of which are regulated for
sustainability in Victoria under the authority of the Wildlife Act
(1975) and Fisheries Act (1995), are also significant sources of
animal mortality within Victoria. In 2012, duck and quail
hunters are estimated to have killed 638,000 native birds
(Moloney and Turnbull, 2012). Likewise, commercial and sport
fishing around the world results in many times as many fish
146
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
8000
Mammals
7000
O 3000
.
ifi’n mar
1910
1950 1970 1990 201!
Sampling Intensity per
100 square km
mu square Km
no. specimens
1
2-10
11-100
■ 101 - 884
150 75
150km
150 75
Amphibians
12000
10000
c 4000
1850 1870
1010 1930 1050
decade
Sampling Intensity per
100 square km
no. specimens
1
2-10
11 -100
■ 101 - 568
Figure 1. Geographic distribution of Museum Victoria’s non-marine Victorian vertebrate specimens. Each pixel represents the number of
specimens collected within a 100 km 2 grid (10 x 10 km square) from the earliest georeferenced specimen (collected in 1858) to 2012, spanning
154 years. Yellow, green, light blue, and dark blue pixels represent single (1), low (2 - 10), moderate (11 - 100), and high (> 100) numbers of
specimens, respectively. White pixels represent areas with no specimens. Histograms represent the number of specimens by decade.
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
147
3500
Fishes
■
1571)
1910 1030 1050
1070
1000 0010
Sampling Intensity per
100 square km
150
150km
no. specimens
1
2-10
11 -100
■ 101 - 978
Sampling Intensity per
100 square km
no. specimens
1
2-10
11-100
■ 101-578
Birds
3500
1000
■
1870 1000 1010 1930 1050 1670 1990 2010
148
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
Sampling Intensity per
TOO square km
no. specimens
1
2-10
11-100
■ 101 -1065
Reptiles
9000
0000
7000
S oooo
|sooo
c
3000
2000 '
1000 '
ie$o loro
1010 1930 1950 1970 1990 2010
decade
30000
All Vertebrates
11-100
■ 101-1417
150km
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
149
mortalities each year than all the fish ever collected for scientific
collections (Pauly et al., 1998; Allan et al., 2005). In Victoria
alone, there are approximately 720,000 fishers in the Victorian
recreational fishing sector, 290,000 of whom annually target
freshwater species (VAGO, 2013), including native species.
Loss of habitat is often the single greatest immediate threat
to fauna populations (e.g., Wilcove et al., 1998). Voucher
specimens can be the primary source of information on
populations prior to habitat loss (or even the only source, in
cases where species have been entirely extirpated, such as is
likely for the lizard T. pinguicolla around Melbourne). Healthy
habitats often harbour locally abundant populations of
otherwise rare taxa that are resilient to targeted collecting, for
as long as the habitat is secured. For example, although
restricted to a few alpine plateaux in south-eastern Australia,
the nationally threatened Alpine She-oak Skink
Cyclodomorphus praealtus and Guthega Skink Liopholis
guthega can be locally abundant where they occur (N.
Clemann unpublished data), and judicious collecting does not
pose a threat to these populations. A legislative preoccupation
with protecting individuals of Australian animal species,
instead of habitat and populations, has been strongly criticised
(Rawlinson 1980; Ehmann and Cogger, 1985). Judicious
collection of specimens of these individuals for research has
been shown to be a negligible component of overall mortality
from both natural and human-induced sources (Ehmann and
Cogger, 1985). Furthermore, once an organism is included on
a threatened species list, resistance to collecting is often
greatly magnified (Gans, 1993), despite an often urgent need
to gather information to promote the persistence of these
species. There is concern about the impact of collecting on
small and vulnerable populations (Minteer et al. 2014),
although it is likely that, if judicious collecting resulted in the
total loss of a population or species, that population or species
had little chance of persisting for much longer whether or not
collecting occurred (Rocha et al. 2014), and there may be
immense value in securing specimens prior to the final loss.
Considered collecting: a framework to guide the collection
of voucher specimens
Despite their value and importance, careful consideration
should be made when deciding whether or not to collect
voucher specimens and, if the decision is made to collect, how
to do so. In this section, we propose a framework to guide the
decision-making process for the collection of vertebrate
specimens within Victoria and elsewhere.
Decisions regarding the collection of vertebrate voucher
specimens should focus on four main issues (Fig. 2): 1) are
there knowledge gaps for the target species?; 2) do sufficient
voucher specimens exist to address knowledge gaps?; 3) will
collection have detrimental impacts on the targeted population?;
and 4) can the target species be collected ethically? These
considerations should include both species- and population-
specific aspects, rather than individual-based criteria.
As discussed above, there are many reasons to collect
voucher specimens. For example, are there taxonomic,
phenotypic or genetic questions that cannot be answered with
existing specimens? If there are such questions, which
populations and how many individuals would be needed to
address the current research objectives? If there is a
demonstrated need for voucher specimens additional to those
currently available, the collection may be warranted. In this
case, targeted collection from populations that could provide
unique insight should be prioritised. Where species are known
to be in decline, or where habitat that is known or likely to be
occupied by a threatened species will be destroyed, the need to
collect representative specimens is urgent. For example,
expansion of Melbourne’s urban areas is resulting in the
removal of grassland habitat occupied by the federally
endangered Striped Legless Lizard Delma impar. Before this
habitat is cleared it is imperative that representative specimens
are collected from this area so that we have some record of
what has been lost. Habitat currently earmarked for clearing
includes areas where no collection had occurred, but samples
were required for molecular analyses aimed at defining
Evolutionarily Significant Units in this species (Maldonado et
al., 2012). Consequently, there is an urgent need to collect this
material prior to the loss of these habitats and populations.
Collection of specimens during a decline can even help to
highlight the processes driving losses (e.g., Green, 2008), with
the potential to aid in population or species recovery.
Deciding from which populations to sample and how many
vouchers to collect should be firstly based on ecological and
population considerations, and will likely vary between
species. For example, both the global and local distribution of
the species should set the context for targeting populations for
collecting. Geographic gaps, populations at the species’ range
limit, or isolated populations may be particularly informative.
Alternatively, repeated sampling at known localities can
inform change or stasis of a species through time.
Secondly, local abundance should be considered - is the
species widely distributed and generally uncommon, but
locally abundant in the focal population? In this case, targeted
collection within the locally abundant population could be
particularly informative with minimal impact on the species
as a whole. At times there is considerable resistance to
collecting specimens, especially threatened species, from
certain land tenures, such as the parks system or land
covenanted for conservation purposes (Gans, 1993). However,
we believe that more biologically relevant criteria than land
tenure alone should form the basis for prioritising areas for
collection. Being prevented from collecting in reserved areas
where a species may be most abundant, and therefore being
forced to collect in non-reserved areas where the species is
less common, can result in strain on non-reserved populations
that would not be evident on those in reserves.
Thirdly, the reproductive biology of the species should
guide numbers and timing of collection. Different consideration
should be made for species that are long-lived with slow
reproductive rates, versus those that are short-lived with high
reproductive rates. The reproductive stage of the population
should also be considered. Individuals considered less valuable
(according to biological criteria) than other individuals to a
vulnerable wild population may be preferentially chosen for
collection; for example, Clemann and Beardsell (1999)
150
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
Figure 2. Decision process when considering collecting voucher specimens. Questions to consider are given in blue, with responses to each
question given in black. Directions on how to proceed through the process are given in green. Further details and examples are provided in the text
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
151
captured a gravid female of the threatened Swamp Skink
Lissolepis coventryi, and chose to release the female and all
but one of the resulting offspring - the remaining neonate
forming the voucher specimen to confirm this significant
record. Similarly, excess bachelor males could be sampled for
a species where few dominant males control territories and
access to reproductive females, as in fur seals (Kirkwood and
Goldsworthy, 2013). However, for some purposes one specific
sex is needed, such as taxonomic studies of some bats where
penis morphology is diagnostic (Reardon et al. 2014.).
Fourthly, researchers should identify if there are any
existing local impacts on the focal population and consider
how collecting will compare to those impacts. All populations
are regulated by mortality rates, natural and human-induced;
in almost all situations where judicious collecting of specimens
occur, such collection represents a negligible fraction of
mortality rates. If current threats outweigh the collection of
limited numbers of vouchers, and collection could provide
valuable information about the current status of the population,
then collection of vouchers may be warranted. In addition,
population-specific factors, such as local abundance, should
guide numbers of vouchers (although collected numbers
should not exceed the minimum to achieve all objectives).
Ethical considerations for the collection of vouchers are an
important part of the process. Procedures for the collection of
fauna in the wild are guided by established standards and
upheld by animal ethics committees. Limits on the numbers of
specimens that may be collected are regulated through federal
and state agencies, under advice from scientists and wildlife
managers. Collection of specimens should be judicious, with
only the numbers needed collected. But, equally, it is folly to
‘under’ collect, as the cost of returning to the field to collect
more specimens may be high; and in worst-case scenarios for
declining species, future collection may not be possible due to
scarcity or a total loss of a taxon from an area. Finally, the
proper preparation and curation of specimens, along with
accompanying data, should be mandatory to maximise the
value of the specimen to future researchers.
Increasing resistance to returning research animals to the
wild (e.g., Clemann, 2013) can create another source of
specimens when research animals are retained at the
conclusion of a project. Specimens collected for research
purposes should be (and often are) required by permit
regulations to be deposited in curated museums. These
specimens should be accompanied by at least a minimum
amount of collection information (e.g., collector name and
affiliation, date, and accurate location details) in order to
facilitate future research.
Conclusion
We acknowledge the role that advances in technology and
increasing animal rights and welfare concerns play in the
protection of individuals and populations of wildlife. However,
judicious collecting of faunal specimens has underpinned most
avenues of zoological investigation, and we argue that targeted
collection of vertebrate voucher specimens will continue to
provide a crucial component of our understanding of the natural
world. Now and into the future, collections that are refreshed and
expanded will provide the basis for advances in understanding of
native animal zoology and conservation management.
Acknowledgements
We thank our colleagues for helpful and insightful comments
on this topic. Peter Robertson provided information on species’
distributions in Victoria. Lindy Lumsden and Jenny Nelson
provided helpful critiques of earlier drafts of the manuscript.
We thank Richard Marchant and an anonymous referee for
reviewing this paper.
References
Adams, M., Raadik, T. A., Burridge, C. and Georges, A. 2014. Global
biodiversity assessment and hyper-cryptic species complexes:
more than one species of elephant in the room? Systematic Biology
(doi: 10.1093/sysbio/syu017 First published online: 13 March
2014)
Allan, J. D., Abell, R., Hogan, Z., Revenga, C., Taylor, B. W.,
Welcomme, R. L. and Winemiller, K. 2005. Overfishing of inland
waters. BioScience 55(12): 1041-1051.
Baker, A., Mutton, T., & Van Dyck, S. 2012. A new dasyurid marsupial
from eastern Queensland, Australia: the buff-footed Antechinus,
Antechinus mysticus sp. nov. (Marsupialia: Dasyuridae). Zootaxa,
3515: 1-37.
Barratt, D. G. 1998. Predation by house cats, Felis catus (L.), in
Canberra, Australia. II. Factors affecting the amount of prey
caught and estimates of the impact on wildlife. Wildlife Research
25(5): 475-487.
Becker, B. H. and Beissinger, S. R. 2006. Centennial decline in the
trophic level of an endangered seabird after fisheries decline.
Conservation Biology 20(2): 470-479.
Bi, K., Linderoth, T., Vanderpool, D., Good, J.M., Nielsen, R., and
Moritz, C. 2013. Unlocking the vault: next generation museum
population genomics. Molecular Ecology DOI: 10.1111/mec.l2516
Campana, S.E. 2005. Otolith science entering the 21st century. Marine
and Freshwater Research 56: 485-495.
Cheng, T. L., Rovito, S. M., Wake, D. B. and Vredenburg, V. T. 2011.
Coincident mass extirpation of neotropical amphibians with the
emergence of the infectious fungal pathogen Batrachochytrium
dendrobatidis. Proceedings of the Na tional Academy of Sciences
of the United States of America 108(23): 9502-9507.
Clemann, N. 2013. Release or retain? Prioritising biodiversity
conservation when deciding the endpoint for Victorian reptiles
and frogs removed from the wild for research purposes. The
Victorian Naturalist 130(5): 207-211.
Clemann, N. and Beardsell, C. 1999. A new inland record of the
Swamp Skink, Egernia coventryi Storr, 1978. The Victorian
Naturalist 116: 127-128.
Clemann, N., Chappie, D. G. and Wainer, J. 2004. Sexual dimorphism,
diet, and reproduction in the Swamp Skink, Egernia coventryi.
Journal of Herpetology 38: 461-467.
Clemann, N., Robertson, P., Gibbons, D., Heard, G., Steane, D.,
Coventry, A. J. and Chick, R. 2007. An addition to the snake fauna
of Victoria: De Vis’ Banded Snake Denisonia devisi (Serpentes:
Elapidae) Waite and Longman. The Victorian Naturalist 124: 33-
37.
Clemann, N. and Gillespie, G. 2012. Response to ‘A call record of the
Southern Barred Frog Mixophyes balbus from East Gippsland’ by
Urlus and Marr. The Victorian Naturalist 129: 120-121.
152
N. Clemann, K.M.C. Rowe, K.C. Rowe, T. Raadik, M. Gomon, P. Menkhorst, J. Sumner, D. Bray, M. Norman & J.Melville
Coleman, J. S. and S. A. Temple. 1996. On the Prowl. Wisconsin
Natural Resources. 20(6):4-8.
Collins, C. and Kays, R. (2011). Causes of mortality in North American
populations of large and medium-sized mammals. Animal
Conservation 14(5): 474-483.
Dickman, C. R., Parnaby, H. E., Crowther, M. S., and King, D. H. 1998.
Antechinus agilis (Marsupialia: Dasyuridae), a new species from
the A. stuartii complex in south-eastern Australia. Australian
Journal of Zoology 46: 1-26.
Eastman, L. M., Morelli, T. L., Rowe, K. C., Conroy, C. J. and Moritz,
C. 2012. Size increase in high elevation ground squirrels over the
last century. Global Change Biology 18(5): 1499-1508.
Ehmann, H. and Cogger, H. 1985. Australia’s endangered herpetofauna:
A review of criteria and policies. Pp. 435-447 in “Biology of
Australasian Frogs and Reptiles” ed. by G. Grigg, R. Shine and H.
Ehmann. Royal Zoological Society of New South Wales.
Erickson, W., Johnson, G., and Jr, D. Y. 2005. A summary and
comparison of bird mortality from anthropogenic causes with an
emphasis on collisions. USDA Forest Service General Technical
Report PSW-GTR-101. Pp. 1029-1042.
Feeley, K. J. and Silman, M. R. 2011. Keep collecting: accurate species
distribution modelling requires more collections than previously
thought. Diversity and Distributions 2011: 1-9.
Freeman, S. 2010. Western weka road-kill at Cape Foulwind, Buller,
New Zealand. New Zealand Journal of Zoology 37(2): 131-146.
Furlani, D., Gales, R. and Pemberton, D. 2007. Otoliths of common
Australian temperate fishes. A photographic guide. CSIRO
Publishing, Collingwood, Victoria.
Gans, C. 1993. How many snakes need we catch and how many frogs?
And, where belong our pickled turtles? Thoughts on environmental
protection. Pp. 359-362 in “Herpetology in Australia: A Diverse
Discipline” ed. by D. Lunney and D. Ayres. Royal Zoological
Society of New South Wales, Mossman.
Gardner, T. A. et al. (23 co-authors). 2008. The cost-effectiveness of
biodiversity surveys in tropical forests. Ecology Letters 11(2):
139-150.
Gillespie, G. R. 2001. The role of introduced trout in the decline of the
spotted tree frog (. Litoria spenceri) in south-eastern Australia.
Biological Conservation 100(2): 187-198.
Gillespie, G. R. and Chang-Kum, K. 2011. The bleating tree frog
Litoria dentata Keferstein (Anura: Hylidae): an addition to the frog
fauna of Victoria. The Victorian Naturalist 128: 256-259.
Green, R. E. 2008. Demographic mechanism of a historical bird
population collapse reconstructed using museum specimens.
Proceedings of the Royal Society of London. Series B. Biological
Sciences 275: 2381-2387.
Green, R. E. and Scharlemann, J. P. W. 2003. Egg and skin collections
as a resource for long-term ecological studies. Bulletin - British
Ornithologists Club 123: 165-176.
Grinnell, J. 1910. The methods and uses of a research museum. Popular
Science Monthly 77: 163-169.
Harris, J. H. 2013. Fishes from elsewhere. In, Humphries, P. and
Walker, K. (eds.). Ecology of Australian Freshwater Fishes. Pp.
259-282. CSIRO Publishing, Collingwood, Victoria.
Hobday, A. J. and Minstrell, M. L. 2008. Distribution and abundance
of roadkill on Tasmanian highways: human management options.
Wildlife Research 35(7): 712-726.
Hobson, K. A. 2011. Isotopic ornithology: a perspective. Journal of
Ornithology 152: 49-66.
Inger, R., and Bearhop, S. 2008. Applications of stable isotope analyses
to avian ecology. Ibis 150: 447-461.
Ivantsoff, W. and Crowley, L. E. L. M. 1996. Family Atherinidae.
Silversides or hardyheads. In, McDowall, R. M. (ed.). Freshwater
Fishes of South-eastern Australia. Pp. 123-133. Reed Books,
Chatswood.
Joseph, L. 2011. Museum collections in ornithology: today’s record of
avian biodiversity for tomorrow’s world. Emu 111: i-xii.
Kearney, M. and Porter, W. P. 2004. Mapping the fundamental niche:
physiology, climate, and the distribution of a nocturnal lizard.
Ecology 85: 3119-3131.
Kearney, M., Phillips, B. L., Tracy, C. R., Christian, K. A., Betts, G.
and Porter, W. P. 2008. Modelling species distribution without
using species distributions: the cane toad in Australia under
current and future climates. Ecography 31(4): 423-434.
Kelly, J. F. 2000. Stable isotopes of carbon and nitrogen in the study of
avian and mammalian trophic ecology. Canadian Journal of
Zoology IS: 1-27.
Kemper, C. M., Cooper, S. J. B., Medlin, G. C., Adams, M., Stemmer,
D., Saint, K. M., McDowell, M. C. and Austin, J. J. 2011. Cryptic
grey-bellied dunnart ( Sminthopsis griseoventer ) discovered in
South Australia: genetic, morphological and subfossil analyses
show the value of collecting voucher material. Australian Journal
of Zoology 59: 127-144.
Kirkwood, R. and Goldsworthy, S. 2013. Fur Seals and Sea Lions.
CSIRO Publishing, Collingwood.
Krell, F. T. and Wheeler, Q. D. 2014. Specimen collection: Plan for the
future. Science 344: 815-816.
Lunney, D. 2012. Wildlife management and the debate on the ethics of
animal use. I. Decisions within a state wildlife agency. Pacific
Conservation Biology 18(1): 5-21.
Maldonado, S. P., Melville, J., Peterson, G. N. L. and Sumner, J. 2012.
Human-induced versus historical habitat shifts: identifying the
processes that shaped the genetic structure of the threatened
grassland legless lizard, Delma impar. Conservation Genetics 13:
1329-1342.
McDowall, R.M. 2006. Crying wolf, crying foul, or crying shame:
alien salmonids and a biodiversity crisis in the southern cool-
temperate galaxioid fishes? Reviews in Fish Biology and Fisheries
16:233-422.
Menkhorst, P. W. 2009. Blandowski’s mammals: clues to a lost world.
Proceedings of the Royal Society of Victoria 121: 61-89.
Minteer, B. A., Collins, J. P., Love, K. E. and Puschendorf, R. 2014.
Avoiding (Re)extinction. Science 344: 260-261.
Moloney, P. D. and Turnbull, J. D. 2012. Estimates of harvest for deer,
duck and quail in Victoria: results from surveys of Victorian game
licence holders in 2012. Arthur Rylah Institute for Environmental
Research Technical Report Series No. 239. Department of
Sustainability and Environment, Victoria.
Moritz, C. 2002. Strategies to protect biological diversity and the
evolutionary processes that sustain it. Systematic Biology 51(2):
238-254.
Newsome, S. D., Martinez del Rio, C., Bearhop, S., and Phillips, D. L.
2007. A niche for isotopic ecology. Frontiers in Ecology and the
Environment 5(8): 429-436.
Nishimura, O., Brillada, C., Yazawa, S., Maffei, M. E., and Arimura,
G. 2012. Transcriptome pyrosequencing of the parasitoid wasp
Cotesia vestalis: genes involved in the antennal odorant-sensory
system. PLoS One 7: e50664.
Pauly, D., Christensen, V., Dalsgaard, J., Froese, R. and Torres, F.
1998. Fishing down marine foodwebs. Science 279 (5352): 860-
863.
Peakall, D. B. and Walker, C. H. 1994. The role of biomarkers in
environmental assessment (3). Vertebrates. Ecotoxicology 3: 173-
179.
Value and impacts of collecting vertebrate voucher specimens, with guidelines for ethical collection
153
Pepper, M., Doughty, P., Hutchinson, M. N. and Keogh, J. S. 2011.
Ancient drainages divide cryptic species in Australia’s arid zone:
Morphological and multi-gene evidence for four new species of
Beaked Geckos ( Rhynchoedura). Molecular Phylogenetics and
Evolution 61: 810-822.
Perkins, S. L., Osgood, S. M., and Schall, J. J. 1998. Use of PCR for
detection of subpatent infections of lizard malaria: implications
for epizoology. Molecular Ecology 7: 1587-1590.
Pimm, S. L. and Raven, P. 2000. Extinction by numbers. Nature 403:
843-845.
Pyke, G. H. and Ehrlich, P. R. 2010. Biological collections and
ecological/environmental research: a review, some observations
and a look to the future. Biological Reviews 85(2): 247-266.
Quintero-angel, A., Osorio-dominguez, D., Vargas-salinas, F. and
Saavedra-rodrfguez, C. A. 2012. Roadkill rate of snakes in a
disturbed landscape of Central Andes of Columbia. Herpetology
Notes 5: 99-105.
Raadik, T. A. 2011. Systematic revision of the Mountain Galaxias,
Galaxias olidus Gunther, 1866 species complex (Teleostei:
Galaxiidae) in eastern Australia. PhD Thesis, University of
Canberra, Canberra, Australian Capital Territory.
Raadik, T. A. and Harrington, D. J. 1996. An assessment of the
significance of the fish and decapod Crustacea of Cardross Lakes
(main lakes), Mildura, with special reference to the Southern
Purple-spotted Gudgeon. Report to the Department of
Conservation and Natural Resources, Victoria. Arthur Rylah
Institute for Environmental Research, Victoria.
Ratcliffe, D. A. 1967. Decrease in eggshell weight in certain birds of
prey. Nature 215: 208-210.
Rawlinson, P. A. 1980. Conservation of Australian amphibian and
reptile communities. Pp. 127-138 in “Proceedings of the
Melbourne Herpetological Symposium” ed. by C. B. Banks and
A. A. Martin. Zoological Board of Victoria: Melbourne.
Read, J. and Bowen, Z. 2001. Population dynamics, diet and aspects of
the biology of feral cats and foxes in arid South Australia. Wildlife
Research 28(2): 195-203.
Reardon, T. B., McKenzie, N. L., Cooper, S. J. B., Appleton, B.,
Carthew, S., and Adams, M. 2014. A molecular and morphological
investigation of species boundaries and phylogenetic relationships
in Australian free-tailed bats Mormopterus (Chiroptera:
Molossidae). Australian Journal of Zoology 62: 109-136.
Richards-Hrdlicka, K. L. 2012. Extracting the amphibian chytrid
fungus from formalin-fixed specimens. Methods in Ecology and
Evolution 3(5): 842-849.
Rocha, L. A. et al. (120 co-authors). 2014. Specimen collection: An
essential tool. Science 344: 814-815.
Rowe, K. C., Singhal, S., MacManes, M. D., Ayroles, J. F., Morelli, T.
L., Rubidge, E. M., Bi, K., and Moritz, C. 2011. Museum genomics:
low-cost and high-accuracy genetic data from historical
specimens. Molecular Ecology Resources 11: 1082-1092.
Schodde, R. and Mason, I. J. 1999. Directory of Australian Birds:
Passerines: Passerines. CSIRO Publishing, Collingwood.
Shine, R. 1980a. Comparative ecology of three Australian snake
species of the genus Cacophis (Serpentes: Elapidae). Copeia
1980: 831-838.
Shine, R. 1980b. Ecology of eastern Australian whipsnakes of the
genus Demansia. Journal of Herpetology 14: 381-389.
Shine, R. 1981. Ecology of the Australian elapid snakes of the genera
Furina and Glypliodon. Journal of Herpetology 15(2): 219-224.
Shine, R. 1989. Constraints, allometry and adaptation: food habits and
reproductive biology of Australian brownsnakes ( Pseudonaja ,
Elapidae). Herpetologica 45: 195-207.
Shine, R. 1991. Strangers in a strange land: ecology of the Australian
colubrid snakes. Copeia 1991: 120-131.
Skerratt, L. F., Berger, L., Speare, R., Cashins, S., McDonald, K. R.,
Phillott, A. D., Hines, H. B. and Kenyon, N. 2007. Spread of
chytridiomycosis has caused the rapid global decline and
extinction of frogs. Ecohealth 4: 125-134.
Smith, K. L., Hale, J. M., Gay, L., Kearney, M., Austin, J. J., Parris, K.
and Melville, J. 2013. Spatio-temporal changes in the genetic and
acoustic structure of a frog hybrid zone in south-eastern Australia:
a 40 year perspective. Evolution 67(12): 3442-3454.
Spencer, R-J. and Thompson, M. B. 2005. Experimental analysis of
the impact of foxes on freshwater turtle populations. Conservation
Biology 19: 845-854.
Suarez, A. V. and Tsutsui, N. D. 2004. The value of museum collections
for research and society. Bioscience 54: 66-74.
Urlus, J. and Marr, R. 2011. A call record of the Southern Barred Frog
Mixophyes balbus from East Gippsland. The Victorian Naturalist
128(6): 272-275.
VAGO (Victorian Auditor General’s Office). 2013. Management of
freshwater fisheries. Victorian Auditor General’s Report 2012-
13:24. Victorian Government Printer.
Vuilleumier, F. 1998. The need to collect birds in the Neotropics.
Ornitologia Neotropical 9: 201-203.
Wheeler, T. A. 2003. The role of voucher specimens in validating
faunistic and ecological research. Biological Survey of Canada
(Terrestrial Arthorpods), Document series no. 9.
Wilcove, D. S., Rothstein, D., Dubow, J., Phillips, A. and Losos, E.
1998. Quantifying threats to imperiled species in the United
States. BioScience 48(8): 607-615.
Woods, M, McDonald, R. A. and Harris, S. 2003. Predation of wildlife
by domestic cats Felis catus in Great Britain. Mammal Review
33(2): 174-188.
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11